Oryctolagus_cuniculus Locus Mono:165:SNORD64
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:165:SNORD64
Oryctolagus_cuniculus
Mono:165:SNORD64
scaffold_189198
SNORD64
1001..1067
1481
GTCTAATTTTAAGTCCTTGAATTAGTTTGTAAAAGTTTGGGGAGAATAGAAAGTTACTA
ATATCTATGTCATTTGACTGTGGTGACACTTTATTATTTTCACTTTCAGTGTATTAATTT
CAATTTATTTCGTTGCGTGTGGCAATTTGTTAGTATTATGTTTAATTTTATAAAACCAAT
GATCTCAGTATTATTCTGGCATATTGCCAAGGCTGTGTGTGTGTGTGTGTTTTGTCTCTC
TTTTCCTTATAATTCTGTCTCTTGAATTACTTTGTTTCTGTTTCACATCCATTGTCACAA
AGTGGATTATTCTCCCAGGGCAAAGGAGTATGAGTAGAAATGTACTTTTTGCAGGTATTA
ATACTTTTACAAAGTTGCCTTAGTGGTTGAGGAAGACCTTGGAAAGATCTGGGCTGGATT
TATGATGAGCTGTATTTACTGAGCATAATGAAGGGAGGCTCCATGTGATTACTCTGAAGT
CCAGCCTAAGTGTCAGTCCAAGGACTCAGGACATAAATTTTATGAGCATTTCCTATCAAT
ACTTTAATAGAACTGTAGGTTTTTCTACTGTAGTAGCAGGGAATTGTTTCCGTATCTACT
AATACAGTTCCCTTTGTAGAAGATCTTCTATATTCAAAGCATTGATATAGTGTACCTTTC
TTTGTCTTAAAGATTTATTTATTTGAAAGGTAGAGTTACAGAGAGGCAGATGCAGAGAGA
GAGAAACCTTCCATCTGCTGGTTCACTACTCAAATGGCTGCAACGATGGGAACTGAGCTG
ATCAGGAGCTAGGAGCTTCCTCTAGGTCTCCCACATGAGTGCAGTCGGCGAAGCACTTAG
GCTCTCCTCCACTGCTTTCCCAGGCACATTAACAGGGAGCAAAGTATTAAGTGGAGCAGC
CCAGACCCATATGGGTTGCTGGCACTGTAGGCTGCAGATTTACTGCTACATCACATGCAG
TCCCTACCTTTGTGTTTACACGAATGTTGAGTGATAAATCAAGAGTACAGATTAAAGTAC
ACTTTTTTCCTGTACTAACGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved