Oryctolagus_cuniculus Locus Mono:207:SNORD24
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:207:SNORD24
Oryctolagus_cuniculus
Mono:207:SNORD24
GeneScaffold_611
SNORD24
1001..1073
2073
TTCAGCATCAACGTGAGTCAGAAGAACTGGGGTTTTCTTTCACAAACAGAGCTAACTGC
AAATTATAGCTAATGAAAACTGGACAGGGGCACCTGGGTTCTAGGCTTACAAAAGAGTAC
AAGATACTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAACTATTTTTCA
TAAAATTTATATTTAAATTTTTTATTGAAAGACATACAAACATGGGGAGAGAGACAGAGA
GCAAGAGCAAGCTCTCATTTTCTGGTTCACTCCTCAAATGCCCACAATGGCTGGGGCTGG
GCCAGGCCTAAGTCAGGAACCAGTAACTCAATCTGGGTCTCCCATGTGGTCTGTGGCAAG
GACCCAACTACTTAAACTTTCATTTTTGCTTTCCAGAGTATGCATGCACAGGAAGCTAGA
ATTAGAAATGGAGTGAGAAGCAGAATCCAGGCTCTCTAATAAGGAATGTGGGTGTCCCAA
GCAACATCTTAACCACTGTGTCAAACACCCACCCCATAAGTTTTTCATTTATTTCCATTC
TTCTATGAACATTTTAAAACCCCCTTGCTACATACATTGTGTGAAAATAACTCAGTATGA
TATACCTCAGAATCAGTAAAAAAGTTGTAAAGGAGGACATCATCAAATTCTAAGCCTTTT
GCTTCATAAATTGTTAGTACAAGTGCTAACCCCAGCTCTTCTGGAATTTTCTCCTTAGCC
GTTTCATTGGCTACAAGGATTACCTGAAGAAAAACAAAACAAAAGTCAAATTCTACAATG
AAAAACCTAGTAACAGTCTACTTCTTTAATTAGAAACAGCCCACAGATGACGTGAAGGAA
TATTTGCTATCTGAGTGTGGTGACGACATCAACACCACCCAGATGGCTGATGTGCAGGAA
AAGAAAAAAGAAAAAAGAAAAAAAAAAGAAACCAACAAAAAAAGAAACAGCCAGCATGGA
CTTGGCCAGCCAGGCCAGTGGAAAGATGAAAACAATCAATCATTCACCCAACTCTGGAAC
TCACCCATTCTGAAACAGGAGCTGCTGAATTCTACCTTGTGGAATAATTCAGCCTTTCAA
ACCTTTTTTCAATTGCAAACTGCCTTTTATTTCAAAATATAAATACCATTACAAGCAGCT
CACCTGGTGGGCTCCAAATTCAATGGGCTGGGTTTTCCTTTTATTCCCTCTTAGCAAAAT
TGCCAAGTCGCTTACACTGCAAGACTCCAGGACAGTTGGTTTGGGGCCATCCAGGAGGCC
AGAGTCCCTGGGAAGGCGATCAAAAGATTCTGGGAAATAGAACTGAAGTAAATCCACCAC
TCCAGATGCCAGAGTGAGGATTCCTGGAACAAACAGAAAACATGTCAGACTGTACAACAT
GGCTGAGTTTGTGTTTGCTTGATTGTTTTGCTTTAGTCTTGCTTATCTCCTGAGAAGCAG
TTTTGGCCCTGACAACATGTACAATTGCAAAGCCTATTAGTAGTGCCCAGTGGCCCTGAG
CCATACCACTTGGGATGCAGCGGATGAAGGTGGAAACATCCACAGTGTTGCTATGCTGAG
AGGGTCTTGTGGGATAACATTCTCAATTTATATTCACATTAGAAAAAATTACCTGATAAA
GAAGATTCAAGGCAGAAATATAATCTAATTAGAGTTATTAGAAGGCCTGGATAAAGGAAG
AAAACAAAAATCATCATGTTCCTCCTTATGCAGCTTACAGTACTGGAAGCATCATTACCA
TGGTAACAGCAGTGCTGGACATTAGTTGGGGAAGCAATCGAGGCCTCCATCATGCTTTCC
CACCAGGTGTGCACACAGCTGAGAGAGGACTAAGAAAAACTGTTAGAGCAGAGGAAACAA
CTTTCCAAAGAGCTTTCTCCCTGCATCCCATCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved