Oryctolagus_cuniculus Locus Mono:220:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:220:SNORA51
Oryctolagus_cuniculus
Mono:220:SNORA51
GeneScaffold_2106
SNORA51
1001..1126
2126
TTCTCAACAAACTTTTAACTGAAGACTATTATTCCAAATGTTGAGGATGTCTCTGCCTT
TGCTAGTAATATTCTACCTTGCCAAATTGAAAATGAACTTCTTGAACCAGCAGATGGAAG
ACCTTTCTCTGTCTCTACCTCTCACTGTCTGTAACTCTACCTCTTGAATAAATAAATAAA
ATCTTTAAAAAAATGAACTTCTTAAGTACTCTATATTTTTATACAGAAGAAATTTAATAG
GGAAAAGAAATTTTACATTGGTAGCTACTGGTGATAAGAAACTCATAAGCAATCCAAAAT
CTCTGGTACATCTGGCAACATAAGCAAGATACCTTAAAAGTAATGTTATCTCTTAAAAAT
TGATGCACAACCAGAAAAGGTAATAGAGAATTAGATATGAGATGAAAGGTAGTATTTTTG
GGGGTGAGTTCCTTATTCCATTAAATCAAAAATTTGTTACAGACAGGGACTATATCTTAT
TCACAGCCCTTAGCATACAGTTTTATAATATTTGTTGAACTGAATGACATATGCTTAACA
TTACAGAGGTATTATAAGTACCCCTCATTTCCTAAAGTTTTATATTTACAAAATGAAAAT
TATTTCATTTCTGGGTTTCTAAGAAATGTTCAAGTCTGGGATATGTGGCCCAAAGTGTGT
GAGGGAATCATATATAGGAAGAGAAGTAAGTTCTCTTTCCCACTGATCTCTGGTCAGCTT
GCCACGGTGTCAATATTCCTCCTTCAGTACCAGCTGAGGAATTTCTGCTAGTCTTTGGAA
ATAGAGGAGTGGGAACAGCAAGAGCTCTGTTTCTGGTTTCATTCATGTTTACAAAATGGG
TTTGCATCCAACATGATATCTATTAGGTCATTAATCAAAATAACACTTTTAAAGGAATAG
GGTTTATAGGCAATATGAAGGTACTTTCTATATTTAATATCTATAATACAAATTTTATAA
GAGTCTGATTAGTAATTATGTGTCCCACTTCAATTATCTGAGGCCTCCTTACCACTGGCT
GCATTCTTACACTGACTGTATAGAAAGAGGAGGCAGAGTAGACTTTCCCCAAATATACCT
CAACTCAGGCTTCATGCCTGGTCTCTACTATGAATGGGGGGACATGGCAAAAAAAATGAA
TAGATGTTTCTCACACAGCTACTGGGTGTTACAGGTTATGGCTATCCTGATACATTCCCT
GCCAGTTTCTCAGAAGGAGAGGCAGTTTACCAAGTCAGTATTGTAGCAAACTGCTAGCAA
CTGCTATTAGCAAATTTAAAAGAGAAACCCAGACTTAACTACTCTGTCCTCATCTTCCCC
ACTCCCCCTTCCAGAGGGAGATATGGAAATAAGAGTAGGCTCTAGGGCTGCTTCTCTCTA
GGGAAATAAGCTCTCCATGTCGCTTACCAGTTCCACTCACAAAGCTGGGAGGCTACCTTA
TTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved