Oryctolagus_cuniculus Locus Mono:4:SNORA32
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:4:SNORA32
Oryctolagus_cuniculus
Mono:4:SNORA32
scaffold_5023
SNORA32
1001..1121
2121
TTTTCAAATAGATAAATCTTTCATTAAAAAGTAAAAAAAAAAAAAAACACATAATTGGA
AAAAATATTTGCAAATCATGCATCTGGTAAGGATCTTTTTTTTTCTTTTCTTTTTTTTTT
TTTTTTTTAATTTGAGAGACAGATCTACAGACAGAGAGAAGGAGAAAAGGAAGGTCTTCC
AACCAATGGTTCACTCCCCAAATGGCCACAATGGCCGTAGTTGGGCCAGGCCGAAGCCAG
TAGCCAGGAGCTTCCTCTGGGTCTCCCACAAGGGCACAGGGCCCAAGGACTTGGGTCATC
TTCCACTGCTTTCTCAGCCATAGTAGAGGGCTGGATTGGAAGAGGAGCAGCCAGGACATG
AGCCAGCACCCATATAGGATGCTGGCGCTGCAGGCAGAGGCTTAGCCTACTACGCCACAG
CGCTGGCCCCCTCTGGTAAGGATCTTGTACCTAAAATGTACAGTGTTCTAATCAGTACCA
AAAAGACAACTCAGTTAAAAATGGGCAAAGAACAGTTACAGCTGAAAAGAGGTAGCCAAT
TAAACTCTTGAAAAGATGGTCAGCATCATTCGTCCCAAGGGTAATGCAAATTAAAACCAC
AAGACGGGTGGGTATTTGGCTTAGCAGTTAAGTTTCCATTGGGACACCCAAAACCCATTT
TGGAATGCCTGAGTTTGAGTACCAGCTCTGTTCCTGATTCTAGGATGCACCCTGGGAGGC
AGTAGGTGATGGCTCAAGTAGTTGGGTCCCTACCACGACCTGAATTGAGTTTCTGGCTCC
TGACTGGCCTGGCCTGGATTGAGCCTTTGCAGGCGTTTGAGGAATAAATCAGTGAATGAG
AGCTCTCTCTCTCTGCCTTTCTCTGTCTCTCTGTCTCTCTCTGTCTCTCTCTCTCTCTGT
TTCTTTCCCTCTCTGCCTCTCAAATAAAAAAAAAAGTAATTGAGAAATAAGAGATACCAC
TTTTTACCCACTAGTTTCACTACAATTGAAAAAAAAGGATAAGGTCATTATCAAGGTTTT
TAGAATGCAATTTCTCATTTGCTGTGGACATGACCATAAAAAAATTTTCCACTTGGATTT
CTCTCTGCTATCTTGCTAGTAATTAGCCTATTGGGAACAATTTCAAAAACAAAAAGATAG
TGGGGCCAGCACTGTGATGTAGCAGGTAAAGCTGCCACCTGCAGTGCCGGCATCCCATAT
AGATGCTGGTTCAAGTCTTGGCTGCTCCATTTCCAATCCAGCTCTCTGCTATGGCTTGGG
AAAATCCTTGGGCCCCTGCACGCACATGGGAGACCTGGAAGAAGCTCCTGGTTCCTGGCT
TTGAATCCGCACAGCTCCAGTCATTGTGGCCATCTAGAGAGTGAGGGAGGGCTTCTCTCT
CTCTCTGCCTCTGCCTCTCTGTAACTCTGCCTTTCAAATAAAAATAAATAAATCTTTTTA
AAAAAAGATAGTAACAATATTTGACAGTGGATATGGAACTCTCATACACCGCTAGTGGAA
ATATACAATGATGTAGTCACTTTGAAAAAGTATCTGGCAATTCCTCAAAACTTAGATATA
GAGTTACCATATGGCCCAGCAATTCCACCTCTAGGTGTATATCCAAGAGAAATGAAAATA
TGCCTACACAAAAGCTTATACATGAACGGTCATAACAGTAATATTGATAATAACTAAAAG
ATAGAAAAAACTAAATGCCCATCAAATGATGAATGAGTAAACACAATGTATATAATCACA
CAGTGACATATTATGCAGCCATAGAAAAGAACAAAGTACTAATACATGCTACGCCATGGA
TGACTGCTGAAAACAAACTAATGCAAAGTCAGCCCTGAAAGATCACATAGTCTGTGACTC
CTTTTATAGGAAATGTCCAGAATGGATAACCTATACAGACAGAAAGCAGATTAGTTGTTG
TCTAGAGTTGGATGGGAGGATGAGAGGTGTGGGAGGCAGTAGCTGAAGGGTATGAGTGTC
TTTGGGAGATGATGAGAAACATTCTAAAATTGATGGTGATGATCCCGCAACTCTGTGAGC
ATACTACAAACCATGAATTACTGTTTTATATCACTATGCTTTAGTGAGATCGCTCGGACT
GTAGTGGAGACACAGAAGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved