Oryctolagus_cuniculus Locus Mono:138:SNORA51
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:138:SNORA51
Oryctolagus_cuniculus
Mono:138:SNORA51
scaffold_154272
SNORA51
1001..1125
2125
CAGACCCTTCATGTAGATCCACAGTGTCCCTCTAATCTTCCCATTTTCTAATCCTCCCT
GAGATGGAACTGTCTCCCATATTTTTTTGTTTGTTTGTTTTAACTATTTTTCCCTAGACT
AGAGCAGAAAGCTCCCCTGCCTATTTTGCCCGTGCTTGTGTCTCCCACTGATCTCAAGCA
GCATCTTAACTGCATTGACAGTACTTTTCTCTAAATGAAATAAAATTTTTTTTAACTTAA
GGAGCCATAGCTATTTAGCACTTCATTTCTGAAGTTAACATTGAAATTATACAGAAGTAA
TTTTTAGGTATATTAACCAGAAAGCATAAGGAATCCTATCAATTGAAGCTTAGGAGGTTG
AAAGCTTGACACTGAAAATAAAACTGTTAGAAGGCAGTGTAATTTATTATAACATTGTTT
ATACATACAAATGTAAAAGACAACATGGTCATCTGTTGCATGTAAAAGAGGGGATCTGAG
TTAGGGAAGAAAAAGTGCAGATTCTTCCTCTACCATACATAAAAATTAAAAAAAAATTCT
TCCTGTTTTTTAAACACTGAGTCATAAATAATTATCAGATTACCTCCAGAAGAGGCCTTA
AAGTAGGATGACTTTATATCAGAATTGTTTTAAATGTTCTAGGCACCGATAATTGCCATG
ATGAGTTAAATAAGGATGTTTAATCTGGTATTTTTAATCATGCTAGTATAAGCCATGTAA
CCTTTAAAACTCCTTAAAAATAATACATGGAAGATACTACATATATGAAGGTATTACTGC
AGTTCCTTAGGGGGAAGCAATCACCTGGAAAGTAGCAGTTGCCAGTCCCTTTCCTCAGTT
TGAGTCTATAATACCAAAACAGTGAAACTCACAGGTCTGAATGTTAAAACTCTAACTAAA
ATGCTAATAGCTGGACGTCAGCAAAGGAAAGAAAAACCAAATGACCAAAAGGTTAACCTA
GGAACCTGAGGATGTTTCAATATTAAGAATATTGGCTTCAGGGCCTCCTCGTGCTTACCA
CAGGCTGTGTTCTTAACACTGTATGTAGAAAGAGGAAGCAGAGTAGACCTTCCCCATATA
CACCTCAGCTCAGCTCTCATTCCTGCTTGTGAATGGGGGGACATGGAGTTTAGGAAAATG
GGGGGTGGGCTTTAAAACACTATAAAAATAAGCTATAAGCTGTGGTGATCTGATTGCCTT
CTACTGAATTCCACATCCACTTTAAGTATGGGAAGAAATTCTTCATGTATCATAGAAGTT
ATCACTCTAATCTCAGTAACTGAAAATGTCATAATTGTAACAAACTAGAGGTGGTTCTAT
TCAAATCAAGACTAAGGAAAAGTGGCACAGTAGGTTAATCTACCCCTGGACACCTGCAAC
CCAGAGTACCTGGTTCAAGTTCTGGTCACTCCATTTCTGATCCAGCTTCCTACTAATGCA
CATCCTTGGATGTAGCAAGTGACAATTCAAGAATTTGGCATCTGGGGCCGGTGTTGTGGC
ATAGTGAGTATTGCTGCCTGCAATGCCAGCATCCCATATGGGCACCGGTTTGAGTCCGGC
TTGCTCTACTTCCAGTCCAGCTCCTTGCTAATGCAACTGGGAAGGCAGCTGAAGATGGCC
TGAAGGCTTGAGATCTGCTACCCATGTGGGAGGGCCCAGATGGAGTTATGGGCTCCTAGT
TTTGGCTTGGCCCAGCTCAAACTGCTGTGACCATTTAGGGAGAAAACCAGCAAATGCAAG
GTTCTCTCTGTCTCTTTCTCCCCCCCCACCCCACTCCCCCGTAACTCTGCCTTTAAAATA
AATAAATAGACTGTCCATGCGCCAGGAATTGGTTTTAGATCCTTGATCAAATATAAGTTG
GCTGTAGATGTTTGGATTGATTTCTGGTGTTTCTATTCTGTTCCATTGGTCTATCCATCT
ATTTCTGTACCAGTACCATGCTGTTTTGATTGCAACTGCCCTGAAATCTGGTATTGTGAT
GCCTCCAGCTTTGTTTTTGTTGTACAAGATTGCTTTAGCTATTCGAGGTCTCCTGTGTCT
CCATATGAATTTCAGCATCACTTTTTCTAGATCTGAGAAGAATGTCTTTGGTATTTTGAT
TGGTATCACATTGAATCTATAAATTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved