Oryctolagus_cuniculus Locus Mono:28:SNORA52
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:28:SNORA52
Oryctolagus_cuniculus
Mono:28:SNORA52
scaffold_62091
SNORA52
1001..1144
1453
GCGGCCAGCGCGGGCGAGAACACGGACGCCATCGGCCGGTCACGCAGACCTCGTGTCGC
GCGCGGGGCCCAGGCGAGGCGGCTGGGCGCGCAGGCTCGCCGCGCCCACGTGCGGCCGCT
CCAGGCCGGCAGGGGCCGCGACTTTCCGGTAGCGGTGCACCATGGGACTCGTGGTTTCGC
GGCACGAGATGCGCACGCGCGTGGCGGCCGCGCTGCATGCTGGGCTCTGTAGGCGCCGCG
TGGCATGCTGGGAGCGCGAGGCGCGGAAGGCAGACGAAGTCCCGGTCGGCCTTCTTCGCC
CGCCGCCCCGCCCATATCCAGGGACCTTCGGCCCTACGGTATCCGGGAAGCCAGTCCGGG
AACAATCTTTCGCTTTTGCCACGGCGACCGCCTGGGTAGGCAGCGGACGATGGCGCCTCT
CCTGCCGTCATTGGCTGCGCGCCGCGGACGTCATCCGGAGGCGCCTCGCATTCCGGCGCA
GAGGCTTCTGGGTAGCGGTTTACCCCCGCCCACTGCGCCGGCGCCTTCCTTTCCGCCCCG
GACGCCGCCGAGGTCGCACGCGTGAGGCCCGTCCGCCGCCGCCGCCGCGTGAGTGGAGCG
CCGGGCCTCGGGAGCGGGCGCGGGGTCGGCGGGGGTGCGGGGCTGGAGACCTCCCCCCGA
GCTGCCGCGCGCGGGTCGCCGCGGTAACGCCGCCGCCCGCCCCGCAGCATGCGCTACGTG
GCCTCCTACCTGCTGGCCGCCCTCGGAGGGCAACTCCTCGCCCAGCGCCAAAGACATCAA
GAAGATCCTGGACAGCGTGGGCATCGAGGCGGATGACGACCGGCTGAACAAGGTGGGGGC
GCGGGAGGGCTGGGCCGGTCACGCCGCCGCCGAGCGTGCGGGCCCCCGCGCCCGTGCTGA
GCGCCCCGCGCGTGTCCCCGCCAGGTCATCAGCGAGCTGAACGGGAAGAACATCGAGGAC
GTGATCGCGCAGGGTGAGCGGGGGGCGCGGGCCGCGGGCGGGGGTCCATCCTAATCCCTG
CCGGCCGGCTCGTGGCCCGCCAGGGTTCGCTTGTGGACCAGAGCAGGGCGGAGCGGCGCG
GGCGCCGGCGTCGGGGTCGGCGTCGGGGCGGTCCCGGGCGGGCGCTCCTACAGCTCCGCT
CCCGCGCGGTGCGGGCAGTCCCGTTGGGGGCGCTCCTACGGCCCCGCTCGCGCGCGGTGC
GGGCAGTCCCGTTGGGGGCGCTCCTACAGCCCCGCTCCCGCGCGGTGCGGGCAGTCCCGT
TGGGGGCGCTCCTACAGCTCCGCTCCCGCGCGGTGCGGGCAGTCCCGTTGGGGGCGCTCC
TACGGCCCCGCTCCCGTGCGGTGCGGGCAGTCCCGTTGGGGGCGCTCCTACGGCCTCGCT
CCCGTGCGCGGGGCGGGCAGTCCCGTTGGGGGCGCTCCTACAGCTCCGCTCCCGCGCGGT
GCGGGCAGTCCCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved