Oryctolagus_cuniculus Locus Mono:238:snoZ7
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:238:snoZ7
Oryctolagus_cuniculus
Mono:238:snoZ7
GeneScaffold_1073
snoZ7
1001..1053
2053
TAGAACTCCCATCAGCTGGTTCACTATCCAAATGCTCACAGTGATTGGGCCTGGGTGGG
GGCCAAAGTTGGGAGCTGGGAACTCAATCCAGGTCTCCCATATGGGTGACAGGAGCCCAA
CTTACTTGAGTTGTCACATGCTACTTCCCAGGATCTGTGTTGTCAGGAAGCTGGAATTGA
GAATGAGAGCTAGATACTTAGATACTGAACCCAGCTGCTTTGCTATGGGATGTGGCTATC
TTTAACTGCTAGGCCAAATGCCCATTCCTTTGATTCTTAATGGCTAATTAATATCTAAAA
TTACATTGGGTTTGGATAAGCATACTGTGTGTATATATAAGAAATAGTATGGGCCTGCGC
TGTGGCGCAGTGGGTTAATGCCCTGGCCTGAAGCGCCGGCATCCTATATGGGCGCTGGTT
CTAGTCCCAGCTGCTTCTCTTCCGATCCCGCTCTCTGCTATGGCCTGGAATAGCAGTAGA
AGAGGGCCCAAGTCCTTGAGCCCCTGCACCCATGTGGGAGACCCGGAAGAAGCTCTTGGC
TTTGGAATGGTGCAGCTCTAGCTGTTTCGGCCATCTGGGGAGTGAACCAGCAGATGGAAG
ACTTCTCCCTCTACCTTTCTCTGTAACTCTTTCAAATAAATGAAATAAATCTTAAAAAAA
TACTAATAAAGTTGGGATAGTTATGATAAGGATTAGGTTTTAGTTGAAAATTCTACAATA
TTCAGCTCTTTGATACAATATGCTATTTTCCTGTTATCCAGTGTTAGTCTCTTCAAGTAG
GAGATAATACAGTCTTCTATGTCTTCTAATTACTTAGTTTTCAGAATAGATGTTTATTTA
ATATAGTATTTCATTATGTAGTTCTACTGTTTGTACTATGGAAAGTAAAAATTTCCCATG
ATAATCACTAGATAAGTTTATGTTGATGCACTGGCTGAAGTACATCTGCGTATTTTCCTT
TTCTATTGAGAAAGAACAGATCTTGTATTCTGTTATGTTTTCAAATTTTGCTTAATGCTA
AACTATGGAATTACTGTGTTATTTAAACAAATTGGTTTTCCTTTTTATCACTGAGTGTAA
CTTTGCTATCCAAATAGTATACTGTTTTTTTGCAAATATCTGTAAAGTAGTCCAATTTTT
TTTTTTACACGTTAAACAATGTTAAACTTGATGTTGGATTCAAATATTCAGTTTTACCAT
ATGAAAATTTTAAAAAAATTTTACTTAATTAAAGTGTTAGAATTGGATGGGACTGCCCCA
TTTAGGTTACTTATTGTTACTTTGTGGTGTTGCTGCCAGATAAGCATTTGTAAGTCACAA
ATTTGATTATCATTTTTCATAAATCTTAAATGGTTTATTATGACTCCAGGAATCAAATTA
AGAAATGGAACTAATATTTATTAAGCCCCTTTTGTTTGTTAGGTAGTTTGCTGTTTTTAA
GATTTACCTATTTGAAAGGCAGAGTTAAAGAGAGAGAAGGAGAGAGAGAGAGATCTTCAT
CTGCTGGTTCATTCCCCAAATGGCTGCAATGAGCAGGACTGAACCTAGCTGGAGCTAGGG
GCTTCTTCCAGGTCTCCCAAGTGGGTGCAGGGTCCAAGCACTTGAGCCGTCCTCCACTGC
CTTCCAAGGCACATGAGCAGGGAACTGAATGGGAAGTGGAGCAGCTGGGACTTGAACCAG
CATAGGCCAGGGCTATAATTCACTGAGCCACAGTGCTGGCCCCAGGCGCTTCACATTTTA
AGGAAATTTCTAAGTTCTTAATTTGTATAATTAGGCAGCCACATTTTAGAATCAACTAGT
AAATGATAGAAATCAGACTTTGAAGTCAGTTCATAGTTCCTAATTCCTTGTATTGCTTCC
TTCAATATGATAACTTATTACAAAACTGAACAAAATAAACAGTTTGACCATCAAGTGGTT
AGTCATTAAAATTTAATTGAGAGTGCTAAGAACAAATTGACAGAGGACTGGTGTTACCGC
ACAGTGGGTTAAGCTACTGTCTGCACTGCTGACATCCCATATGGGCACTGGTTCAAGTCC
TGAGCTGCTCTACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved