Oryctolagus_cuniculus Locus Mono:102:SNORA66
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:102:SNORA66
Oryctolagus_cuniculus
Mono:102:SNORA66
scaffold_193864
SNORA66
1001..1126
2126
GGAGCCAGGAGATGGGAACAAAATATAGGCCTTCCACGTAGTGCAGGAACCCAATTGCC
TGAGCCATCGCCTCTACCTGGCAGGGTCTGCATTAGTAGGAACCTAGAGTCAGGAGTCAG
AGACAGGAATTGAAACTATACTCCAAAGAGGAACCTATGCATCTTTACCACTAGGCTACA
TCCCTGCCCCCTGAGATTTTTAAATTCCAAGTTTGGAAGATAAAAGAGCAAATGAAAAAT
ATATCAAGGTAGTGTGAGTTAAAATAGGGAAAGCAGTAGAAATAGAACAGATGGAACACT
AATCCAATATAAAGCCAAGTTAGAAAGAATTGAAAAGTAAGTTCCAATAATAGAAAAAAA
GATTCTCTAGTAACATTGATAGGCAGCTGTTGTGGGAATTTGGGCAGTGCGCTAGTGAAT
GGAAGATTGATCTCTCTCTCTCTCTGTGCCTTTCAAATAAATAAAAATTTTAAAAAATTT
AAAGTAAAAAAATAGAATTATCATACGATCCAACAATCCCATTACTGGTTATATATTCTC
AGGAAATTAAATCCATCTGTTAAAGAGACATCTACACTGCTATGTTTACTATAGCACTAC
TTACAATAGCCCAGAAGTGGAAACAACCGGAATATGTATCCAATGATGAAGGGATGAAGA
TTATTTTGAACACGTACACAATAGAATACTTCTCAGCCATAAAGCAGAATAAAATCTTGC
CATTCACAACAACATCGATGGAACTGGAAGTCATTTTTAGGTTAACTGAAATAAGCCATG
CACAGAAAGACAAATATCGCATTGTCTCATTCCCATGTGGAATACAAGAAAAAGGTGATC
CCGCAGAAGTTAAGAGCATAATGGTGATTATCAGAGGCTGGGGAGCGACGGGGAAAGCTG
ATCAACAGGAACTAAATTACACTGAGATGGGAGTTGGAAGTTCTGGGGTTCTACTGGACA
GTAGAATGACTATTGATAATGTACTGTAAATTTCTCTGTTAAAAAAGACTAAAACATGAT
GTGTGTGGCAGAAGTGAAAGAAATCGTGTTTGCTAAAGTAATTGTGGTGATAGAAATAGT
TTAGCCTCAGAAGCTGCTGAGGTGGCCCATTCTATCCCAGTACAAGGCAGATTAAGAAAG
AAAGAAAAAAAAAAAGGTAAGATTTTGGATCTTTAAACCATAAAGAAATTTTAAATGTTT
TAGGAGATAAATATACTTACACTTATTGGACGTTATACAATTTATACACACATTAAAACA
TCACTTGGTTCCCCCTATGTACGTACAATTTTTACGCCTATTAAAAAATTTTAAGGAGCT
GGTGTTGTGGTGTAGCGGGTAAAGCCACTGCCTATAGTACCGGCATCCTATTTGGGTGCT
GGTTCGAGTCCCAGCTGCTCCACTTCTGATCCAGCTCTCTGCTATGGCCTGGAAAGCAGT
AGAAGACGGCCCAAGTCCTTGGACCCCTGCACCCGCATGGGAAGACCTGGAAGAAGGGCC
AGTTGGGGAGTGAACCAGCGGATAGAAGAACTCTTTCTCTCTCTGTGTCTCCTTCTCTCT
CTGTGTAACTCTTTCAAATAAATAAATAAATAAATCTTTAAAAAATGTTTAATAAAATTA
AATAACTAAAATGTGGAACCTGTGTATATGATTATTAAAATCTATATTTTGAAAAGATTT
ATATCCTTTTATATAATATGCAAGTTATGCAAAAGCAAATAATTAAAGACTATCCAGAAT
GGGAAAGAATAATTAGCAAATTACTTACATAGAATCCTCTTTACAGTCTATTATCAAAAA
TATTCAAAGAATTACAGAATTGTAGCACAGGATAGAATCTCAGTGTTCATTCAGACCAAA
CCCTCAGTATCTCTGAAGAGACAAAGTGTGAGAAATGACTGCTTTAAAGTCATCTAGCTG
GAGAGAAACAAACTTAGGCCTGGAATTTATTTGTTCTTGAATTCACTTAGCTGTCAGGGC
ATGCTTCCGAACTTTCACTCTGGCCGTTGTGGACATTTGGAGAGTGAACCAAAGTATGTG
AGCTTTCTCTCTGTGTCTACTTGTATATCAAATAAATAAATAATTTCAATGAATATTTTA
CATCTCAAAAGTCAATTAACATGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved