Oryctolagus_cuniculus Locus Mono:157:SNORA67
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:157:SNORA67
Oryctolagus_cuniculus
Mono:157:SNORA67
scaffold_169113
SNORA67
1001..1144
2144
AAATGCTAATTGGTTAATATCAGGTGACTCCAGGTTACTTTTTTCTAAGGTTTTAGTCA
GAGGGGACTTCCTTATTGCACTGACTCAGGTAGACTGGAATCTCCTGTTTTAAGGAAAAA
CTGGTCTGTTTGAGGACCTGTCTGCTTCCTTAAAGTTTCAGTTTGATTATGTGGCATCTT
GCATGAGTGCCTATTTTTTGGTTTGATCCTGTCTGTGGTGCCCTAGTGCAGTAACTCAGT
CCAAAACAATAGCCTCCCATAATTTTTGTTGAACAGCAGGCATGAATGATTAAGTCACAG
GTCATTGGTGCACAACTTAATCCTCAGCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGGCACTGCCTTCTCATTCCACCATATTTCCCTCTTTTCCTGTATATAGT
CCAACTTTTCCGATATAAAGCTTGAGAAATTGCATCCCAGCAAGGAAAAGTGACATGCAG
CATGCCCAAAATTGAGACTATCAAACACAGAGTTAACCTGCAAGAAAATGTTAATAAACA
AGTACTAGGAAACATGTGCAGCATCATTAATAATGAAAGAAATACAAAATAAAAGTCCCA
CGGCACTTCTATTAAATTACCAAAAATGAATAAAACAGACAGAACTCAATGTTAATAGGA
TTGTGAGAAAAATAAGTGTATTTGTGCATTGGGAGTGCACTACAAACAAGCAAAATCTTT
CTAGAGAGAAATTTGGCAATAGCTGTCAAGAATCATAAAAGTGATCAGACTCTCAACCTG
AGTAAAGCTACATTGGGGAACACATCTTAAGGAGATCATTCATCCAAGTTGATTCCCTTT
CCCAGGGGCCTGACTAGTGCCTCTCTCAGGAAAGTAGCAACTTGGAAGAAAATCCGGCAT
GCCCAAATGCTCTAGGAGACAAGGGGATGCTTGCTTCTTTTGCCTGCTTTGGACTGCCTA
CATGTACTCACTAAGCTCCTTCTGGATGGATTATATGCACTGAATTCCTCTCTGTCTCCA
CATAGGCCAGATGCATTGATGTACAACAAGTTTCTTTAGTCATCAACTATGACCTTCCCA
CCAACAGGGAAAACCATATTCACAGAATTGGCTGTGGTGGACGCTTTGGTTGTAAGGGTG
TGCCTATTAACCTGGTGACAGAAGAAGATAAGCAGACTCTTCGCGACATTGCGACCTTCT
ACAACACTTCCATTGAGGAGATGCTGCTCAGTGTTGCTGACCTCATCTGAGATGGACTGT
CCTGCCACCTAGCCCCAGCTGGGGTTCAGTCCTGGGGGGCTGAGGAGCAGCAGGAGCAGG
GAGGGGAGGGAGCCAAGGGATGGACATCTTGTCATTTTTTTTCTTTGAATAAATATCACT
TTTTGAGGCAAAAGGAAAAAAAGGAGATCATTTAAAGGAAACAAAACTAGATTTGAACAC
CAACGATTACAGCAAAATAATAAGGTATAGCAACAAACTAGAAACAATCTAAATGCTCAT
ATAAGGAAGCATGGTTGACTTGAAACAGGCCATAGTGAAACATAGCCCCATCCCTGATAC
TTCTGATATAGAATCTATCAGGCCCTAGAATCTCCTTCTTGGCTTTCAGTTCCTCTGACT
CCAACTTGATGATTACAAGTCAACTTCTGATTAAAGATCAACTTAAATTAGGGAGTGGTG
CATAGGTCAGGCCAACCCCCTGAAGACCCCAAGTAACAAGACTCAGAATCTGATGATGAC
CCCTATAGTTAACATCCAAATGCAAAGTGAGATGCTTCTTAGAAACCCCGGGCCTTGATA
AAGTAAAAATCAATCTACCTACAGACCCCAGACAGACTGGCACCCACCTTACCATCACAT
CATTCTCAGAAAAAAACACCAAATGTCCTGTTTCTGACCAAAGTAGGCCATGAGCACTGT
GAACCAAACAGAGACCTGCCACAAGTTGACCATGCACTGCTCAAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved