Oryctolagus_cuniculus Locus Mono:164:SNORA8
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:164:SNORA8
Oryctolagus_cuniculus
Mono:164:SNORA8
scaffold_167335
SNORA8
1001..1140
2074
AAGAACTGTCAAAAGGAAGCTTAGCACTTTGGTGTAGCAATGTTGGCATCGCTTATGGG
TGCTAGTTTGAATCCCAGCTGCTCCACTTCTGATCCGGCTCTCTGCTAATGTGCCTGGGA
AAGCAGTGGAAGATGGCCCAGATCCTTGGGCCCCGCACCCACATGGGAGACCTGGAAGAA
ACTCCTGGCTTTGGCTTGGCCCAGCCCTGGCCATTGCAGCCATTTGGGGAGTGAACCAGC
CAATGGAAGATCTCTCTTATCATTATTTCTTCCTCTCTCTCTCTGACTCTGCCTTTCAAA
TAAATGAAATAAATCTTTTAAAAAAATTTTTAAAGGGACTTGGGAAATTTTGAGTATATT
TTTTGAAAATAGAAATAAACTCCTGAAAATTTTTTTAAAAATTAGCTATAGACATAACAT
TAACCAATATGAGATTGGCTTTGTAAACTCCCAGAAAGTAAAAAAGAAGTGACAGTTTGA
AAATTTTTAAAAAAGATTTACTTATATGTTCAAAAGGCAGAAGAGCAGGGAGAAGCTAAA
GAGAAAAGAGAAAGGTTTTCCATTTGTTGGTTTACTCTGGGACAGCCAGAATCAGGCCAT
GCAGAAGCCAGCAGCCAGGAACCCCATCCCAGTCTCCCATGTGGGTGTCAGTCATCTGCA
GTTTCCCAGGTATGTTAGCAGAAAGCTGAAAGGGAAGTGAAGTAGACAGAACTTGAAAAT
GGTACTCCAGTGTGGGATATGGGTGTCCCAAGTGGCAGATTAACCTACTGCCCCCCAGTA
CCTACCCTAAATATTATATTTTGATGGAATTCTTGTTTTTTGTTTTATTTTGTTGTATCT
TTTTTTTTTTACATTTGGGGAAAGGGCAATATTTCCCACTGTTACTGATTTCAAATGGTT
TTGTATTCAGGAAGTTTTAAAATTTTTTATTTAACTGCACTGGTGTGGTAACTGCATACA
GCAGTTTATTCCTGCTGGGGTATTCAAAGGACAATGCAATAGAAATTCAATGTCTGGCAT
TTTGTGTTTTCTTGGCTTTGTGTGTATTAAGCTTGGTATTTATGTTGATGTAGTATTTGT
AGGAAAAAAAAAAAACAAAAACCTAATTTATTTAAGAGATACAGACAGAGAGCTCCCATC
TGCTGATTCACTCCCCAAAAACCTCAGAGGGCTGGGGCTGGGCCAGGCTGAAGTTAGGAC
CCAGGGACCCAACTATTTGAGCAATGATCTGCTGCTATCCAGGGTACACATTAGCAGAAA
TCTCGGGTTGGGAGCAAAACTGAGATTCAAAACTCAGGCTCCTTGGTACAGATGTGGGGC
ATCCCAGCAGCAGCTTACCACTATACCAATGCCCATTCCTATATTCAGGAGTTCTGAGAA
CCCTGGGGGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved