Oryctolagus_cuniculus Locus Poly:2:SNORD16
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:2:SNORD16
Oryctolagus_cuniculus
Poly:2:SNORD16
scaffold_203434
SNORD16, SNORD18
1001..1099, 1643..1712
2712
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGTCGGAAGTGTTCGGGGTGCCCTAGCGCCGAATCTTA
CTTGGATACAATTTCCGAGCGGCTTCCCGGGGAGGTGTGCTTGCTGTGATGTCGTAATTT
GCGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCAGCGCGCTGGTTCAGAAGGTTG
ACGAAACTGCTAACTGAGCAAGACAACCTTCCTAAAAAGACTGAAGTTTTACAGACAGTG
ACTCTCGAGTGGCCATGTGGGGATTGCGGAGGAGTGCACAGCGTGGCCGGAGGGGGTGGG
GGTCCCAGCAGGGGCTGGGAGAGGCATCCAAGGGAAGCCGGCTGTGTGGGCCCAGCCTGC
AGCCCTGGGTGTCGCGGCCAGAAAGTAACAAAGGCCAGCGCTGAGGGAAGTTTATTCCCG
AAAGGTGCACTTCACCGGAGATGATTAGGAACGGAAGTTCGGATGAGTCGAGGGTGGAAA
TCGTGGGGGCAGGGCCCGAGGTCCTGAGTGTCTGTTCTCTCCCCGAGGCGTGTGCTCGTC
CACTCATATCGGTGTACTCCGAGAAGGGGGAGTCGTCCGGCAAAAATGTGACTTTGCCCG
CCGTGTTCAAGGCTCCCATCCGGCCAGACATCGTGAACTTCGTGCACACCAACCTGCGCA
AGAACAACAGGCAGCCCTATGCCGTCAGTGAGCTGGCAGGTACGGCTGTGCGCCTCTCCT
CGGCCTCGGGTGGGGCCGCTTTGCAGCCGTGATGAGATCCCAGCTCATTGGTCCGTGTTT
CTGAACACGTGATGTTCTCGACGCTCTGATGCTGCTTGCTGCCTGGCGTTGTCATGATGG
GTGTAATGAAGTAGCTAGAACATCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved