Oryctolagus_cuniculus Locus Poly:10:SNORA5
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Poly:10:SNORA5
Oryctolagus_cuniculus
Poly:10:SNORA5
scaffold_176961
SNORA5, SNORA5
1001..1134, 1503..1631
2631
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTAAAA
GCTCTGGCACCGGGAGAGCAGCCCCGCCTTTGCTTCCTGCTAATGGATGCCGCCTGGGCT
GCTGGCATCTCACAGGCCAGGCAAGGGGGCGGCCCCTGGAGAGACCCCGCTCGGAGGTGC
TGCTAGCTTCCCTGCCCAAGAAGCCTCACCGTCGGGTTGGGTCGGGGCTTTCCCGCACGC
AGAGAGAGCGCAGGCACTGAGACTGAGCGCCTCTGCAGGGCACCAGGCCTGGCAGAGCGG
GGTGGGAGTGAACTGTCCTGAGGAGGGCTAGGAAATCCCAGCGACGCCTCCTGCCCTGCT
GCAGGGCCAGGGGAGCCACCTGTGACGGGCCTTTGTCCTGCCCCGCGCAGATCAGCTCCG
TGTGGCACGGGACCCTCGTGAGGCTGCTGCGGAGCCTGTATGCGCTGGAGCTGCCTGAGG
CTTCCAAGGAGCTGCGGTCGGTGGAGCAGGAAGTGCGCTGGCGCATGCGGAGGCTCAGGT
ACAAGCACCTGGCCTTCCTGGCCGAGGCCTGCGCTGCCTCCACGCGGGAGCCGCACTCCC
AGGAGCTGCTGGCCGAGCTGCTCGTGCACCTGGAGAGGCGCTGGACAGAGATCGACGACG
GCCGCACGGCAGTGACCTTGATGATGAAGGCAGGGCACCTCTCGGAGTCGCTGATGAACC
GCCTGGAAGACAAGGTACGGGGCTCACACGCCTGGCACCCAGCCGTGCCCTGGGGGCTGT
GCAGCTGTTCCCTGGGTGACAGTCCTGTGAGGCAGAGGGCTGCGGGTGGCCACTCTGTAA
CTGTGAATCCAGCACGGCGTGATCTCGAGAGGCAGCAGAGCAGACGTCCCAGCAGTGGCC
CAGAGGCACTGGCCGGGCACAGGCCAGCCCTGGGCGGCCCCTGCAGTCAAGTCAAATTCA
GCCCCGGCCTGTGGTGGTGTGGGCTGGCCAGGTGGCTGCCACAGCGAGCTCTGCAGTTCA
TGGGCCCCAGGTCCCCCACTCTGGGGCCTGGGGATAAGTTTGGCTGCGGACAGGGGTTCT
GGGCCCAGGGCGGGCGGGAGGCTGGCCCTGCACAGCTGAGCCCATGCTGGGTCAGCTCAG
GCCCAGTTGCTGTCTCACAGGGGCTGCACTGGATGGGACCCCTGCCCCCAGCTCGTCCCC
GCTGCCTCTGGCCACCGGGCTGACCCCTGCACGGCTGTGGTTGACAGTGCCTGGAGCTGG
TGGAGCAGTTTGGCCCCGAAGAGATGAGGAAGGTGCTGGTGACGCTGGCGGCACAGGGCC
GGCGGTCGGTGCCCCTGCTGCGGGCCATCTCCTACCACCTGGTGCAGAAGCCCTTCCCGC
TGACCAAGAGTGTGCTCCTGGACCTGACCTACGCCTACGGTGAGGCGCTGGCTGGCACGC
ACCTGCAGCCGTGTCAAATTCGGCACCTGCCTGCCGTGGCGGACGCTGGCCCAGAAGGCT
GCCACAGAAACATGCGGCTCATGGGCCCTGCCCCGCACTCGGGCTCAGGGATAAGTTTGG
TCGCAGACACGGAGCCCTGGAGCTGAGGGCACGGGGGTCTAAGCCCGTGCTCTGCTCTGT
CCCGAAGGCAAGCTGAGCTTCCACCAGACCCAGGTGGCCCAGCGCCTGGCCACTGACCTG
CTGCCACTCCTGCCCAGCCTGACCCCCGCCGAGGTGGCCCGCTGCGCCAAGTCCTTCGCC
TTCCTCAAGTGGCTCAACCTGCCCCTGTTCGAGGCCTTTGTCCAGGTGAACTGCGAGCTG
GTCATGGGTTCCGTGGGGAGCCAGTGGACCGGGGAAGCCAAGCTGGTCAGGGAGGCTCAC
AGGGCTGCCAGTTGAGATGTTTCAGCTTGTGTGGGAGAGGCGCTTGCTGCTCAGTGGTGG
ACACGTGGCGCGGTCTCGTGTTCTCACTGAACGTCCTGCTTCCACGAGGCTGGGGCTGAG
GGTCTGCTCAGAACCCTCCTGACCTGCCGCCCACCCCCGAATGGACTGTGTGGGGAGACG
CCCACGTGTGCCTCTCCTGTCACTGCCCTCAACCACCTGTGCCTGCAGTTCAGGGGCACT
CATGGGGTTGGGGGGGGACAGCCCTGGCCACCCTCAGACTCAGAGCCAGGCAGGGGCAGT
GCTGCCGGCTGGGAGCTCATCCTGTCCTCTGCCGCCCCTGACCGGCCCAGCACATCCTGA
ACAGAGCCCAGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved