Oryctolagus_cuniculus Locus Mono:204:SNORA33
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:204:SNORA33
Oryctolagus_cuniculus
Mono:204:SNORA33
GeneScaffold_6933
SNORA33
1001..1129
1358
GGCACAAAAGATCTCGCGGCAAGCACCTGAGACAGAGTGGGCAGGCAGGCTCGCACCCT
AACTTGGCAGGAGCATAAGAGACTCTGCCGGACTCTCTCAGCCTTCCCATCTCAAAAATG
GGAACTTAAAGGGCCACCCACCTGCAGGAGCTTTTGTCAGATTTAAATGAAGCCATTTAA
GTGACAACCATCACCTGCTTGGCTTGCAGGTGTGACATTCAAAGTATCCAAAGCCAGCCG
ATGAATCTGCTTACCTGTTGTGCTTCTGCAGAAATCTAGAAAAAGCTGGCAATAGTGATG
CCATGCTAGGAGCCTTAAAGACACTGAAGTCTTTGAGGTCCCTGAAAATGGCTACAACAG
ACTTCTGTGATAAGAAGGAAGCATTTTAAAGGCATAGTTAATTAAAGGTTCATAATAATT
AGTTGTTAAGGGCTTCAAATGAGATTTGGAATGATAATAAGAAATTATAATTTTTTTTTC
AAGAAAAAAAAAGTATCCAACAGCAGGAGTGCGCACACTGGACAGCCAGACCAGCCCGGC
ATCCCCCCCAGACTAGGCATTCCATCTCTAGGGGCAGTCAGCGGGGCAGGGGGAAGCTGA
GGCATTTCACCCTTTAGGAACTGGTATCCTTACTGGTGCATGCTGGTGGAGTATCAGCTC
TGAATGCATCAGGTTAGAATCTGCATTATGGTTATGCTTTGTGGCCAATGAATAAACCAA
AAAAAGAAGAGTGTGTCTCTCCTCTAACTCTCCCCTCCCCGAACCCCCACCTCCCCAAGG
CTGTGGAAGCCATGAAGGCTCTGATAGGCCTCCTGCTCTCCCATGACGGAGGCAGAGGCT
GGCATCCGGGGTGCTGTCCCTTCTGCCCCAGAAGCCACCCCCAACCCTGCTCCCTAGCAC
TACCCCCCATCCCTCCTACCCCACCCCTGTTACCTCGTAGTCTGGGTTGGGAACAGGCGG
AGGCCTCTCCTTGTTCTGCCCTGCAAAGAGAGAGGGGAGGAACTGCATCTCCAGGCAGCA
GCAGCAGTCCTGCTGCCCGACCACGGCAACCGGCTGGGCTCGGGATGGCCGCCGCGCTGT
TCTTTCCTCTCCTCCCCTCCGTCCCCAAGCTGTGCTGCCTCCCATCATTGGGTGACTTTC
CCCGGCCCAAGGCCCTCTTGTTTCTTCCCATGGAGGAGGGGAAAGGAAAAGGCAGGAACA
TCCCAACTTCTCTGTTCTCACAGCTTGGAGGTGAAATCTAATTTATTTTTTAAAAATTCA
AATTATTTATTTAAGTGTAGAGAGACCGACGCAGGCAGGGAGTTCCCATCTGTTGTTTCA
TTCCCCAAATGCCTATGATGAGTCAGGGATCTAATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved