Oryctolagus_cuniculus Locus Mono:54:SNORD50
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:54:SNORD50
Oryctolagus_cuniculus
Mono:54:SNORD50
scaffold_89562
SNORD50
1001..1075
2075
TTCAAAATAGGCGTGAGATCGAGCTGTCTTGTTCCTAGGCGGTATGATGTTCAGGTCGG
ATTAATGGAGGGGAGAGACTTTGTGCTAAAAAAAAGAAAAACAAAAAAAAACCTTGGATT
GTTACATCCTCCAAGAGGGCTAACTTTTCCAACACCCGTCCCCCGCAGGAACAATGGCGC
TGGCGCTCTTCGGTGTGTGTGAGCAGTTCTGTGTAGATGCTGAGGTAAGCGCTGTTGAGC
TGTTTTCGAACTGACAGTGTAAACCTGTTGATTCAACAGGACGAGAAAGCAGTGTGTCTC
ATTTGGAATTTGCTACTTTTTATTAGGTGCAGGAGAAAATTCCAAAACATCTGGAAGATA
CTTAATGGAAGATTACTTGGATAAAGGCTGACCGACTACCAGGTATGTGTTAAGCTAGTG
CTTAGAACTGAGCCTGCATGTAATCCATGTGTAAGCTGAAAGATATTTTTGTCGTTGAAC
AGTTGCCTGGATGTTGCTGAATGCTAATGAAGCTATAGCCATGCCACTTCATTTTGATGT
AAGTTGTGTGACTTCCAAGTTCAGTGGTATTTCCAGTATGTTTAGCAGGCTTTGTGATAA
AATCTAAGATACAGGTTAACCCATTATGTCTCATTCTATGTATAAGAGCCATTAAAATGA
GCAATGAATATAATATACAACTTATGGTAATTTTGAAATAATTGACAAAAAATTGGAAAG
TTGGGACTTAATGGGTTGATGTGTTATTACTTATGAACATATAAGGCATGATTGGTCTAC
CCAATGATGAACCTATCCCGAAGCTGAGTACCTGAAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGATTTTGCTTAGCGTTTAATGAATATTAAGCCTCTGGTCTTATCTATGATGATCTTATC
CCGAACCTGAATTTTTCTGTTGAAAAAAAACGCTATACGGATCTGGCTTCTGAGATAGAC
CATTTTAAAAATAATACTATTTTTATGCTTTTAAATTATTTTAACATGGAGTTTTATAAA
TCTCCTGTATTTCCTTTTTTAGGGCTAATCCTGGAAGCTTATCTGTATGAAAAGCTATTG
AAGAAAAACATCCAGAAAGAAAAGGTGGACATGAAAAGAAAACTTAGTTTTGGATTCTAC
TTTTTATGGGCTTTTTGTTTCCTTTGTAAACAGACTGAAACAGTGGGGTTTTCTTAATGA
AAGGTTGTCTTCAGCTAACTAGCCCTGTAAACAAATATTCTGAATATGACTATTTCATAT
TTAGTCACCTGTTTGTCTTTAAAATATTTGTAATTAAAATAATATTGAGTTAAATTTATA
ATGACGTGGGAAAATCTTTTGTGGGATGTTATTGGAAAAAATGGCTGTTTGCTCATCACA
GGATTAAGATGGGACACCTTGACTTTATGCTGGGCACTTGTATTTCAGAACTGAATGAAG
TAAGAGCAAAGTGGAAATAAAAGAATTATTTGGGGAGGAATGCCACACATGAAAATAAGT
GATTGCTAACCAAATCACAGACTACTTAGTCCTATGCTAATTATAACCTTCAAAGTAGGG
GTGCTCAAACAAAAGAATGGGATCCTGAAAGTTTGTGAGGCATGGTGCCTCATAAAACAT
CAGGGTTAAAACTAGTAAAATACACATAATGCATTTAGTATGAACAGCAATAGCATCTAA
CCTAAATGGTTGGGCTTCACATGTAAATAGTTTTGTAAATAAATGCTTACCAAGCCCAAA
TTGTTTGGAAGGCAGATCTTCCCATGTTTTTTCTACACTCAAACAGGTACAGGAACCCAA
GTACTTGGGCTATCTTAAGCTCTTTCCCACCCCATCCCAAGCTCAGTGAACCTGGGGGAA
CTAGGACTCCAATATATGGAATGTCTCTTCATTCCAAGCAGTGGGTTAATCTGATGCACC
ACAGTGCCCATCTGTCCCTCCCATTTGAAAGTTGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved