Oryctolagus_cuniculus Locus Mono:19:SNORA26
snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus Mono:19:SNORA26
Oryctolagus_cuniculus
Mono:19:SNORA26
scaffold_173601
SNORA26
1001..1113
2113
GAGCATATGTTGAGTGATTTCATTTATATGAAATATGCATAAGGGGTAAATCTATAGAG
AAAGAAGCTTGGAAGAATGGGGTGGGGCATGGTGAATGTTTGCTTGTATGACCAGGTATG
GATTTCCCATTTATTGTGATAGTTGTAAAATTTGGTGGATATGCCAAAAATCATTGAATC
ATACAGTTTAAATTGAAAACTCTTATGGTATTTGAATTATAGCTCAAGAAGTCTATTAAA
ATGGCTGCAAAATAAACTTGTAGATATATACAGGACAAAAGAATTTAATAACAGAAGACC
TACACTACATGACAGATTAAAGGATTTCCTTAATGCAGAAGAAAAATTGTACCAGAAGGA
AATTTGGGTCTATATAGGGAAATAAAGAGCACCAGAAATGACAAATACATGGTCGCCAGT
TTTTTAAGTATTTAAATTTTGTAAAATAAAATTGACTTTGTAAAGAATAATGTAGAAAAG
ATTTTTATAATATATGTAAAGTACTTGCATAATATAGTACATAAATGTATGTATGAAGTG
TACATATATTTAAGTATACCACATGTAATGAAAATAGCACAGAGATCAAGAAGAGAAAAT
AGAACTAGAGGCCATCACTGTGGCATAGAGGGTAAAGCAGTGATGCAATGCTGGCATCCC
ATATGGGTGCTGGTTTGAGTCCCAGCTACTCCATTTCTGATCCAACTCTCTTCTATGGCC
TGGGAAAGTAGTGGAAGATGGCCTTGGGCCCCTGAACCCACGTGGGAGACCAGGAAGAAG
CTCTTGACTCCTGGCTTCAGATCAGCACAGCTACAGCTGTTGCGGCCATCTGGGGAGTGA
ATCAACAGGTGCAAGACCTCTCTTTTTGTCACTATCTGCCTCTGCCTCTCTGTAACTCTG
CTTTTCAAATATAGTAAATAAATCTTAACAAATAGAACTATACTAAGTGGTATAATATCA
CCTAAAGGTAGACTGAAGTAATTTCACAATGCATACTATAAGCCCTATAACAAATAGAAA
ACCATAGCAAAGCACAGAAGGGGAAAGTAAGTCTCCATAAAACCCAGAGAAGAGATGCTC
GTTTCTTCTTTGGATCCTGTCTGGAGTCACAAATGCAAAACAAAACAAAACAAAACAAAA
ACAAAAACAAAAAACAAAAAACAAACAAACAAAAAGACATAGCAAAGTGTTACAGCTAAT
AACATAGCAAAGAAAATCAATTCAATAATTGTCGTTAGTACAATAGGTCTGAACGATATT
AATATGGCCAAGTTTTTACTCCATCCATGCTGTACAATGCCAACATTGTACTATACTGAA
CTCTTAACCCAATCACTCTTATGTTACAGATGAATTCGATCAGATTGTTATGGATATTGA
TGGCTAGTTAGCTGGATTGAGTCAGTGGGGAGAGTCAATGCTTCTGCAGAATTATTTGTG
CTATTCTAGGAAAACTCAGGATAGAAGGGAGACTCATAGGCCAGTAGTATGATTTTTGGA
CATAAGTACAGCACATTACAATGAGAAACACAGTCCCTCAATTATAAACTGGAATGTGGC
TTGTTCTTCTAGGACTTAGTTTGTTTTTCTAAAATGTTGCCAAGAAAAGATTTGTTTGTA
ACATTTTTTCAGAGATGGAATAGACCCTAACAGACCAGGCCAATAGGCATCTGCTCAACT
ACAGTCTGCTTCTGATTACCTGTTCAAGATTGGGAGAAAAAAATTGTAAAATAGAAGTGT
GTTTGTTATGGGAAGAAAGCTTGCAGAAATTCACCAAATTGATGCTGATTGAGACTTTGT
TTACTTTTATAGCACAATACTGCATTCAGGTTAAACTTAGAATATTTATGACCTACTGTG
TGAACATTGTGTGTGAACATTGACCACCACACTGAAGAACATGAAAATTCTTTGTTCTTT
GAGGAAAACTATTAAACTCCATAATATTATCAGTTTTTCTAAACAGTTGTTTGATCTTGA
TTAATTTTAGTGATAACAATGACTTTTCCACCTACCCAATTGTTTAAAATCTGTTTGGAG
TTTCATTATTGTCAATGAATCATTGAATTGTTTTCCTTCCTTATTATTAAATCCACTGAC
AGAACATTGGATTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved