Ornithorhynchus_anatinus Locus PPP1R8
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus PPP1R8
Ornithorhynchus_anatinus
PPP1R8
Contig5003
SCARNA1
3678..3841
14795
AGTCACTTAACTTCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGGGATTAAGACTGT
GAGCCTCACGTAGGACAACCTGATGACCCTCTATCTCCCCCAGCGCTTAGAACAGTGCTC
TGCACCTAGTAAGCGCTTAACAAATACCAACAGTATTATTATTATTAACTTCTCTGTGCC
TCAGTTCCCTCATCTGTCAAATGGGGATTAACTGGGAGCCTCACATGAGACAACCTGATG
ACCCTGAATCTCCCCCAGCGCGTAGAACAGTGCTTTGCACATAGTAAGTGCTTAGCAAAT
ACCCACATTATTATCTTCCCCAGTGCTTAGAACAGTGCTCTGCACCTAGTTAGCGCTTAA
CAAATACCAACATTAACTTCTCTGTGCCTCAGTTCCCTCATCAGTCAAATGGGGATTAAC
TGAGGGCCTCCCGTGGGACAACCTGACCCTGGATCTCCCCCAGCGCTGTGAACAGTGCTC
TGCACCTAGTAAGCGCTTAACAAATACCAACATTATTAACTTCACTGTGCCTCAGTTCCC
TCATCAGTCAAATGGGGATTAACTGGGGGCCTCCCGTGGGACAACCTGTCCCTGGATCTT
CCCCAGTGCTTAGAACAGTGCTCTGCACCTAGTTAGCGCTTAACAAATACCAACATTATT
AACTTCTCTGTGCCACAGTTCCCTCATCAGTCAAATGGGGATTAACTGGGGGCCTCCCGT
GGGACAACCTGACCCTGGATCTCCCCCAGCGCTTAGAACAGTGCTCTGCACCTAGGAAGC
GCTTAACAAATACCCACATTATCATCTCCCCCAGCGCTTAGAACAGTGCCCTGCACCTAG
GAAGCGCTCAATCAATACTATTGCCTGCCTGACTGACAAGCTTAGGGAAGGCCGCGAACG
ACAGTCCGCGCGGGGGCTGTCGGGAAAGGCCCCCCCCGCCCCGGAGTCCTCCCGCTTCCC
GGCATGCCCCGGGCTGGCCAAATGGGAGGGGGAGACCTAAGATGGCGGCCGCCGCGAACT
CAGCCTCCAGCCTCCCGCTCTTCGACTGCCCGAGCTGGTGAGCGGCGGGCCGGGGACCGG
GAGCCGGGGACCGGGGACCCCCCCCCCCCGGACCCCAGCGTGTCAGGGGCCGCCCCTGGG
GGCCGGCGGAGGGAGCCGGGGCCACGGGAGCGAGGGCTGGTCCTGCCCGGAACGAGGAGA
TCCCACCCCCCTGCCCCCCTCATCACCCCTTCTCAGGCCCCGAACCCGTCCCTTTCCCTC
TGCTCCTCCTCCCCTCAGCACTGTGCTCATTTGGCTATGTTTTTATGCCCCTGTTGATTA
AGGAGGTGTCCATCGTGCTTAAGGCGTCTTGGTTTTTGACCGTCTGTCTCCCCCGATTAG
ACTGTGAGCCCGTTAATGGGCCGGGATGGTCTCCCTCTGTTGCCCAATTGTCCATTCTAG
TGCTCAGCACCCAGTAAGCGCTCAGTAAATGCTATTGAATGAATGAGTGAATCCGGCCTG
GGATCTGCCCCGGGGATTGGACCCGACTTGGACTTTTCACGTTAGGGGGAGATGGAAAGG
GGGCATGGCCACCCCTGGCCTTCCTGGCCTCCTGGGGTGACTTCCTAATCCTCTCCAGCC
TGATCCCACAATGCAGGCCTCTCTCAGAGGCAGGTACCATCACTGCTTGAAGCGTACGAG
CCCTGCAGACTTTCAGCTCAGGGCTGGCAAATGCTTGGCTAGGGGTGACACCAGGTGACC
CTCCCTGCCTCCTTCCAAGGTTTACCCCCTCCCTGTCCTGGGATGGGGCTCTCCCCTTGG
TCCCCAGCTCTCCCCCTCTTCCCAGGAGACCAGGGCTGAAGACACTTGCCCTCCTTCCCC
CGCTCCCTCAGCCCCCGTTTGATGTATTCCACCCTCCCACACCATGAATGAGAGACATGT
CTGGACTCAAACACCGGGCATCCCCGTTGCAACCCTCCCACCCCATCCCCCTCTCTGCCC
TACAAAGTGGACGCACCTTGCCAAAAGTAGGTCTCCTCAGGGCTGCTCTAGATCCAGCCG
CTCGACTGATGGCTCTTTTAGAACAGCGGAATCACTGGGGAAGGGATGAGCCTAAAAAGA
AAGTTTTAGAAGTGACGGTTCAAGGAGGTGGCATCGCAGCCCCAGGGCTGTGGCGGGGAA
TAGCTTTCAGAATGGCCATCCTGAAAGGATTTTTTTCCCCTCTCTTTCAGGGCAGGTAAA
CCTCCGCCCGGATTGCATCTGGATGTAGTCAAAGGAGACAAGCTAATTGAGGTATGAAAA
ACAGAGAATCATCATCATCATCATGGTACTTGATATGCACCAAGCACTCTGTTAAGGGCT
GGGATAGAAACAAGGAAATCAGGTCGGGCACTGTCCTTGTCTCGCTTGGGCCTCACAGTC
TAAGCAGGAGGGATAACCGGCATCGACTCCTCATTTTACAGAGGAGGAAACTGAGGCCCA
GAGAAGATAACTTGCCCAGGGTCACATGGCAGGCGAGTGCAAGAGCGGGTTTAGAACCCA
GAGTTAGGAAGGTGCCTGTTTTTTCCAGGATGAGCTTTTGTCAGTGACTCACTTGTCCTC
CCCCCTCAGTCAGTCAAAATCAATCAGTGGTATTTATTGAGTGCTTACTATGTGCAGAGC
ACTGTACTAAGCACTTGGGAGAACAACACAACAGAATGAGTGGACATATTCCCTTCCCAT
AATGAGCTTACAGTCTAGAAAGGCTTTCTGGTAATGACTGGCTCTCTGCTTACCAGCCCT
CTCCCATCAAAGCCTACAATGGACAGGGACTGGGCGACCAGTCAGTCAGTCAGTTAATCG
TATTATTGAGAGCGTACTGTGTGCAGAGCACTGTACTAAGCACTTGGTAGAGGAAAATAT
ACAATAAACAGACGCATTCCCTGACCACAACAATCTTACAGTCTAGAGGGGAAGGAGAGT
GCCACCCAAAAATACCTCACAGCTTTTACCAGCCCCCACTCGTGGCGACCTGAACAGTAA
TAACGGTGGTGTTTATTCAGCACCAAGCCCTGTGCTAAGCTCTGGGGTCTCAGGAGAGCA
GCAGACTGGCCATTGATGGGGAACCAGTGCAGGCTGAGTGGGGCTTGACAGGAGTTGGAG
CCAGCGGACTGAGGATGGAGGGTCCAGGTTGAATTGAGGCCCAGCGTATTTGGGGGACAA
TGACCGCCCCCTACAAGACTGAAAGTTTATGGGCAGCGAACGTGTCTGCTAATCCTGTTG
TATTATACAGTGCTTAGTACAGTGTTCTGAGCACAGTACCCACTCGATAAATATAATTGA
ACGAGTGAATAATTCTGTTGTACTCTCCCAAGCGCTTAGTACAATGCTCTTTGCACGTCC
TAAGCACTCAGTAAATGCCACTGATTGATTGAATTCTGCTGAAAGAAGGAGAAGCCTGAG
CAGCTAGAATTGGGCCCCTCTGGGGTTAGGGGCAGGAGAGCTGACTCCAGGAGTCGGACT
CAGCAGTATTATTAACCCCTCCGCACTGTCTCTCTGCATCTGTTCTGCTGAACTTGGAGG
CCCGAGGGAGTCTGACTCCCGGGACAGTCGGGGGTTTCGCTCCCTGGGGCGTCTGGGCTT
TGCCTGTGTCCGGGAGGAAGAAGAGATGGGGGAGGAGGAGGAGGAGACCTGGGCTGCCCT
GGCGACTTAGGAGGCGGCACGCACTCGATACTAACCGAGCCATCTGGCCCTGGCCTCCCT
GCGGGGCTCCTGGGGCTGCCTTGTGGTGGCTGGGTCTGAGCAGTGCAAAATTAGCCAAGC
CGTGAGGACTCTGAGCTCAGCGTGGGGAGACACACTCTGGGTTATAACTCAAAGGCACAG
CCGGGCAGGGCCTGGTCACAGGGGGCCCCGAACCGCTTCTCAGCATTTGTAGCTTTTGGG
GAGCATCAAGTCCCCAACGTGGTGTGCTCCTAAAGCCCCCCTAGCGTCCCGGTTGGGTTG
CCCGGGGCAAGGCCCGAAAGATGACCCGGGGCAAGGCCCGTGGTCCCTGTGCTTAATGTT
GGCCTTGGGAGGAGGCTCAGTGTCCCCGAGCTGGATTTTGGTCGCTTCCTTCTATCGTTA
GACCATGGGCTAGGGCCAGGGCTGACTCTTGGACACCTCCGCAGGACATCTGGAGGCCTC
AGGGCTTCTGCAGTGGTCCGGGCTGGCCAGCTTGCATTGACAGTGCTCCCTGAGTCAGGG
TAGTGTGGGGGCACCCCTGAGGCTTTTGGGTGGGAAGGCCATCTCCTTAGAGGAGGAAGG
TCCATCTCAGTACCCGCCTACACTTAGTCCTGCCTCATTCCTGGCTCATTCCCCACCATG
TCCTCTCACCCTTTGCGGTGGTGGTGAGGGCTTGGGGTATTTTATAAAGCTGCCCAAAGG
ACTGCCTGTCCCTGGACTGCAGACAGGAACACTGAGGCACATAGGAGAAGCCTAACTACT
CAGGCAGGGCCTTCGGGCTGAGCAGGACGAACAGCTCAGGTCTCCTGACTGTGGATTCAT
CTCCAAGCTGGCTCATGCCGTGTGCTTCGGGCTTCTGGCTCCGGGCAGGCAGGCTCTGTG
ACAAGTGCCTTGTTCTGAACACTCACCCGAATGTGGGCCTGAGAAACGTACAGTTCTCAG
CCGGGTAGCTGAGTGCTGTTGGCCTTTTGGTGGTGCCAGTTAGCAGGAGGAGAGCTGGTC
TGTCAACTGCACTTGATCCAGAAATGGCAGTGGTCCCCCTCCAATCCTTCTGTCCTTTGA
GAAGGGCCAGTCCTCTACTGGGGGAGACATTGGGCTTTTGGCAATCTGCAGATGCTGGAA
CTGCAGCTGCCGTGTTCATCGCCCTCCCAGGGTAGTTGGGGGGCTCCCCTGGGGTGACTT
TCCAGGGAGCAGGGCTGTTGTTGGGACCAAAGGCCTTGGGCCCCCCGGATACCAGCAGCC
GGGAGACGGGGACGCTGTAGCCCAGCGACAAGAGTGACATATTTGCTTGGGGCTGAACCT
TAGAAACTGATCATTGACGAGAAGAAGTATTACCTGTTTGGGAGAAATCCGGACCTGTGC
GACTTCACCATCGACCACCAGTCTTGCTCGCGGGTCCACGCTGCCCTGGTCTACCACAAG
CACCTCAAGAGAGTTTTCCTCATAGACCTCAACAGCAGTAAGTGCCCCGTGGGCCCAGCC
CGGCCCCCTGAGAATTAGAGAATGTGCCGATTTCCCACTCTGAGAATGATGGTTCTCTGC
CTGTGACAGCCAGGTTGGGTGACCCTTGGCCCCCTGTGGTTTCTCCCCACGGTGCCTCCC
CGTGGGTCCTCCAGCCGAGGGAAAGGAATCGGGGGAGCCGGTCCAGGGAAGAGGCCTTTG
ATGCGGGCTCGGAAGAGCAGGCACACTGGTGGGTGGTGGTCGCTTTCCTTACGAGCTGGG
AGCTGGGCTTTGGGTGGGAGGGGAAACGGAGTGGTCCCAAGGGGAGCAGCGTGAATCGCT
GGGGGCCGGGCAGAGAGAGAGCGACCGTGGTGGCCTTGGGGAACACTGTGTGGAAGTGGG
CCCAGTGGGTGCGGAGTGTGACGCCCCTCGTCTGACACGTTCCGTTGGGCGGTCCCCAGC
GCACGGCACCTTCTTGGGGCACATCCGGCTGGAGCCCCACAAGCCCCAGCAGATCCCTAT
CGACTCCACCGTGTCATTCGGCGCCTCCACACGGGCCTACACGCTGCGCGAGAAGCCGCA
GACGCTGCCCTCGGCCACCAAAGGGGATGAGAAGATGGGCGGAGAGGACGACGAGCTCAA
GGGGCTTCTGGGACTCCCGGAAGAGGAGACGGAGCTTGACGTAATGGAGGCACCCGGGGG
GTCAGCGGCTCCTCAGCTCGCGGGAGGGCAGGGGGCAGGGTGAGCCGTTCACCCCGGGGA
CAGCTCGTGCCGGGGGCCGGGCCGGGGTGGATTCTGGTTCTGATCGATGGCCTGTGACCC
GTTTCCAGAATCTGACTGAGTTCAACACGGCCCACAACAAGAGGATCTCCACCCTGACCA
TAGAAGAGGGGAACCTGGATATCCAGAGACCCAAGCGGAAACGGAAGAACTCGCGGGTCA
CCTTCAGCGAGGATGACGAGATCATTAACCCAGGTGACTTCTTCCCCTGCCTGGCTCTCC
TGGCCTCCTTTGGAGAAGGGGTGTCTGAGGCCAGGCCTCCACCCAGGGCGTGAGCTGTGC
TCAGGCACTAGGCTGTGGGGTTGAAGTTTGGGGGTGGGGGGGCGGGCAGCGTGACAGCAT
GACCTAGTGGATAGAACATGAGTCTGGGTGTCAGAAGGACCTGTTTCTGCCACTTGTCTG
CTGTGTGACCTTGGGCAAGTCACTTTACTTCTCTGTGCCACAGTTACATCACCTGTAAAA
TGGGGATTAAGGGTGTGCCCCATGTGGGATAGGGACTTTGTCCAACGCGCTTAATTCGTA
TCTGTTCCTCAGTTCATCTGTAAGACTGTGAGCCTCATGTGGGACGTGGACTGTGTCCAA
CATGATTAAGTTGTATGTAATTGGTACAGGGCCTGGCACACAGTAAGTGCTTAACAAATA
CCTTAAAAAGGGGGTAGGGGAGGGAGGCAATGACAGAGCAACCTTGCCCCGATAGCTTCA
TCTGGTTTACCCGGCCTTCACTGTGATTTCTAGACGGCCGCATTGTCTGGCCGTGGTCTG
AGAAAGTCACAGGATGGAGCACAGACAGTGTGAGGCAGTGAGAAGCGTTGGGCGGCTGGG
CTGAGGGTGGTCCAGGGAGCAGCTGGGCCGGGCAGGGCAGGACAGGGCCAGAGGGACGGA
CGGCCTCCAGAGGCAGCTTGTGTCAGCTGTCCTCACTCCAGAGCAGACAGTGACCGACCG
GCGCAGTCTCCCGGGCTCAGCCCGCCAGTGCGGCCAGGAGGGGGTTGTGGGTGGTGGCCG
GTTCAGTCCCAGTCTAACCCTAGCTGCACTCCCCTTTTTACAGAGGACGTGGACCCCTCA
GTCGGGCGCTTCAGAAACATGGTCCAGACGGCGGTGGTTCCCGTCAAGGTACGATAACCC
CCCTCCTCCCAGAGGTGGGGACCAGGATGGGGGTTTTGGTGGGCCCGGGCTGGGCTGGAG
GAGGAAGGCATGGTGATAGGGATCCACGCAGTGTGGACGGCAGTCCTGGGCTTGGCGTTG
GTTTTCCCAGTTTATCAGGTAAGACGGGCTTTTGGTCCAAGGAGGAGGCTGGGGTGTTTT
GAGGGGACCCAACCCCCTAGAAGTAGAAAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCGCCCTGGTGGCCGGCCAGCCCTCCTTCCCCTCCCCCTCCCGACCACCGCCCCAACCCC
CACCCCCTGCGAACGTCCGCCTTCAGGATGCTTTTTGTATATATCCGGGAACATCCCACC
CGAATGAATTCCCAGCGCTTCCTGAATCGTTTCGCCAGGATGGATTGGCATTACTGGGAG
GTTGGACTGGACAGAGGTCAGATGAGTGCCCGAGGTCGGGCTGCCCGGGACTGGGTCGGT
GTTGGCCGCCGGGCCCAGACCCTTTTCCTTGCAGTTTTATTGCAGCGATTGCTTAACTCT
GGGTGCGCTCGGCACCCCCCTCCTCCAGGGCCGCAGGGCCGGGATGCAGTTGGTCCAGCT
CGTGGCTCGGCTTCCTTGCCCTCACGGGCAGCCAGGAAGGGTGGAGGCGGCGGGCCAGTA
GGCAGGGCATCTCATGGGACACCCCTGCCCTTGCTGGTCGGCCGCGGGGCTGGCGGCTTC
CAGGACAACGGAGCATCTCTCCACACGAGCTGGCTATTCTCCCCGAGCCCCCAGGGCCAG
CTGGTTTGGTTCACGCCGGACAACCCCCTTCTGTCCAGATGCCACCCCTCTCCCTTCTCC
CCAGAAGTGAAGCCCAGGCCATCATATGGGCCCAGGGAGTAGGTAGCTACCTTGATCTGA
ACTTCTGCTCCTGGCTGAGCCCTCTCTCCATGCAGGAGAATGGGGGTGTGGCCTGGACCA
AGCCCTCCATCCACTAGGCTGGGCACGGCCTGGGACTCAGGAAAAGGACGATGACTGGAG
CGGAGCTCTCATGTTGCCGCCTTTTTAAGTTGGACATTCCAGAATCTGAATCAAAGGTGG
AGAATGGGTGACCTCGGGCCAATGCCAGCACGGTGAGTGACCGGGCCACTTCTCTCTAAG
CCTTCTGGCATCGTCACTCTGGGCACAGCGGTTCCCTTGCACCTCCCCCCACCCCCCGGG
GGTTCTCCCACACACGGGGCTCAGGAGAATTGGAGCGGCACAAAGGTTGAACGTGTGGAC
AGAGGATCCGACTCAGATTTAGCAAGTGACTGGGCAGCTCAACCGTCTTCTGGGGGCTAG
CTGGGGAGCCGGGCCTCCAGAAGCCCCCAGGCCTTGGCCCACATTAGGGCACCCGGGCCC
TGGGTCTCTGGGGTGAGTCTGCCTGCCCAGCCCGGGCCAAAGGAGACTGGCTCGCCGGTG
ACCTCTCAGCACTCCATCCCCTGGCCGTGGGGAGCTTTAGTCAGGGCTCCCCCTAAGCCG
TTGGCCTTCCCAAACTATGTCCCAAAGGGGATTTTTTTAAGGGTCTGACCAGGTAGGGTG
TCTAAATTAAACAGGAAAAGATTTTACTTTGCAAGTGATTGACTTATCTCTTTTTGAGTG
GGGGCAGTTGGCATTGAGGCAGGGGCTCTTGGCCCCGTTAGGCCCTCGCTGGCTCGAGGC
TGGGTGGCCGGCTTCTCCCCGCAGGTTGGGGGCCAGGGGCGGAAGTGTCCTGCTCCCTGT
GTGTGTAGCTGCAAACCTGAATGCCGGGCCGCAGTGGAACGGAACCAGCTGCAGCTGGGA
TGCCCTGGCCACAGGCTCTGCCCCTAGAGCTGTGATTGCAGCCTCCATCCTGGCCGAACC
ACAGTTGTAGGTCTGGGCACAAACCACCTGGAATAGAGTTAGTTTCTACCTGCAGCTTCC
AGTGTTTCTAAACTTACTGGACTGGACTGAGTGGCCTATGGCCACCAGAGGACAGCACAC
ACACAAACTTAATAGTAATGTTGGTATTTGTTAAACGCTTACTATGTGACGAGCACTGTT
CTAAGCACTGGGGTAGCTACAAGGTAATCAGGTTGTCCCAGTCTTCATCCCCATTTTACA
GATGAGGGAACTAAGGCACCGAGAAGTGAAGCGACTTGCTCAAAGTCACCCAGCTGACAG
GTGGCAGAGCAGGGATTAGGACCCATGACCTCTGACTTCTAAACCCGTGCTCTTTCCGCT
CAGCCAAGCTGCTTCTCTGACTTGTAGGGCTGTAGTGGAAGAGCGCAGACCTGGTAGCCA
GAGGGCACAGGTTCAAGTCTCAACTCTGCCCCTGGCTTGCTGAGTGACTGTGTCTGAGGT
GCTTAACTCTTTGTACTTCAGTTTCCTCATCTGTAAAATGGGGATAAATCCTACTTTTCT
TACCTACCTCGCAGGGTTGTTGTGAGGGCAAAAATAAGATAATTGATGTGAGAACACTGG
GAATAAAAGCACTATACAAAGTCAAGGTAGAAGTCAGAGAAGCAGTGTGGCTGAGTGGAA
AGAGCACGGGCTTTTAAGGAGAGGTCTTGTTTGCTAGGTGACTATCGAACGCCTATACCC
AGACCCGACATACGTAGTTTGAAAAGGGGATTGTCTATGCTCTTGTCCTTTTTATTTTGT
TGAGGTAAAAAACGTCATTTTGTTCAGCCTTTTTTTTATGTAGGACTCTGTTCCTTTTCT
CCGGTCAATGGAGTATCGATCATCTGTAAAACCGGGGATTAAGACGGTTGAGCCCCCATA
AGGGGAATACACACTGGGTAAGCAACATAGCCTAGTCGGGGCTAAGGATTTCACATAAGA
CGTGGGTTTCCTAACTCTAGANNNNNNNNNNGTTCAAGTCTCAACTCTGCCCCTGGCTTG
GTGAGTGACTGTGTATGAGGGGATTAACTCTTTGTACTTCAGTTTCCTCATCTGTAAAAT
GGGGATAAATCCTACTTTTCTTACCTACCTCGCAGGGTTGTTGTGAGGGCAAAAATAAGA
TAATTGATGTGAGAACACTGGGCATAAAAGCACTATACAAAGTCAAGGTAGAAGTCAGAG
AAGCAGTGTGGCCCAGTGGAAAGAGCACGGGCTTGGAAGTCAGAGGTCGTGGGTTCTAAT
CCCCACTCCACCACTTGTCTGCTGTGTGGCTTTGGGCAAGTCACTTAGTACAGTGTGCTT
TGCTTATAGTAAGCGCTCAATAAATACTATTGAATGAAAGTCGCTTAACTTCTCTGTGCC
TCAGTTACCTCATCTGTAAAATGGGGATGAAAACTGTGAGCCCCACGTGGGACAACCTGA
TCACCTTGTATTCCCCCCCAGTGCTTAGAACAGTGCTTGGCACCTAATAAGTGCTTAATA
AATGCCATCATTATTATTATTAATAAGTATTACAGGGCTGAGGGCAACAAGAGCCAAGCG
GGTAGTGTGAAGGGTCATATAGCCTGTGGCCACCAGAGGGCAGCAAGGAGCAAGCTCGGC
CCGTAGCCAGGGGAGGGTGGACGAGTCACTTAAAGGTGCAGGGTGCCCTTTAGCCACCAG
GGGGCAGCACAGAAACTATGCCACGTAAAGTGTCATATGTCCTGTAGCCACTGGAGGGCA
GCAAAGGCGCTTCAAACTCCTATACCCGAAGACGCCAAAGAGCGTCAGAGAAATAGTTTT
AAACCCATAAGCTGTGGCCTCCAGTTGAATAATAATAATGGGATTTGTTAAGCGCTTACT
ATGTGCCAAGCACTGTACTAAGCGCTGAAAGTTTAGGGCCACACGAGGGCAGCAGAGCGA
CAGTTCAAGGAATCAGAAACCCCATAGCAACGAGAGAAAATTGAATGAGTGAATGAGAAA
GACTTTTGGGTGGCAGCAGAGAAGCATCGCAATCTGGCTTATATCTGTGGCCCCCGGAGG
GCGACAGAGGAGAAGTTTAAACACATAACTTTTGGCCACCGGAGGGTGGCAGAGAATTGA
AGTTGCATCCACTATGGGCACCCCACGGTGCCAGAGAAACCCGTTAGTCATAATTACTGA
GCGCTTACCGTGTGCAGGGCACTAAACGCTTGGGAAATTGTCAAAAGAGGGCAGCAGAGC
AACAATTCTAAGGATCGCATGGCCTGGCAACAGGAGAGAAGCCAAAAGGAAACTCCAAAA
GAAACTCCAAAACTCCAAAAGGAAACTCCAACAGCCAAAATCAGACGGTTGAGAAGCACT
GCAAAACTGTCCTATACCCGTGGCCGCCAGAGGGCGGCAGAAAGTTCAAACTCATAATAA
TAATTATAATAATTGTGGCATTTGTTAAGTGCTTACTGTGTGCCAAGCACTGTTCTATGC
GCTGGGATAGTTTCAAGGTAATCACGTTGTCCCAGTTGAGGCTCACAGTCTTCATCCCCA
TTTTACAGATGAGGTAACTGCGGCATAGTGAAGTGACTTGCCCAAGGTCACACAGCAGAC
AAGGGGCGGAGCTGGGATTGGAACCCATGTCCTCTGACTCCCAAACCCGTGCTTTTTCCA
CTAAGCCACGCTGCTTCTAACTCATAGCCTGTGGCCACCAAAGGGTGGCAGAGAAATGGT
TCAAACTGTCCCCCGAACGTGCCAGAGACTCTCCGAAGTGCCATATGGCCTGTGGCCACC
GGCGGACAGCAGAGAGACGATTAAAGGGGTTACGGAGCCTATGGCAAGAGGAGAGAAACA
ATTCAAGGGCCTTCTCAAGGAGGGAAGGAGTGAGACACTTCAAAGTGTTATATGGCCTAT
GGCCACAAGAGGGAAGCAAAGAGCAAAGTGTCATACGAGCTGCAGCCAACAGAGGGCGGC
AAAAAACCCGCTTCATATGCTCATATTCTGTGGCCAACAGAGGGCAGCAGAGAGACTTTA
AAAAGTCACATGACCCGTGGCCATCGTGGTCAGCATTCATTCATTCCTTCATTCACTCGT
ATTAATTGAGTGCCTACTGTGTGAAGAGCACTCTACTAAGCGCTTGGAAAGTACAATTCA
GCAACAGAGACAATCCCTACTCAACAACAGGCTCACAGACTAGAAGGTGGAGACAGACAA
CGAAACAAGTAGACAGGCATCAGTAGCATCAAAATAAACTGAATTATAGATATATACACA
TCATTAATAAAGTAAATAGAATAATATGTACAAATATACACAAATGCTGTAGGGCAGGGA
AGGGGATAGAGCAGAGGGAGGGAGCAAAGGCGATGGGAGGAGGAGCAGAGGAAAAGGGTG
GCTCAGTCTGGGAAGGCCTCCTGGAGGAGGTGAGCTCTCAGCAGGGCTTTGTAGGGGGGA
AGAGAGCTAGTTTGGCGGATGTGAGGAGGGAGGGCAATCCAGGCAAGAAGTTGGACGTGG
GCCAGGGGTCGACGGTGGGACAGGCTAGAACGAAGCACAGTGAGGAGGTTGGGCAGAGGA
GCAGAGTGTGTGGGGTGGGCTGTAGAAGGAGAGAAGGGAGGTGAGATAGGAGGTAGGAGG
GGGCTAGGTGATGGAAAGCTTGGCTTGTAGCAAGACTTGTAGCCTGAGGAAGATTAGACT
GTGAGCCCGTCAATGGGCAGGGATTTTCTCTATCTGTTGCCGAACTGTACATTCCAAGCG
CTTAGTACAATGCTCTGCACATAGTAAGCGCTTAATAAATACTATTGAATGAATGAATGA
CAAGCCACTTAAAGGACCGGAATGCCCCGTAGCCACCAGAGGGCTGCATATAATCATCAT
GGGACCCCAGGGCCGCTAACAAGAGGAAATCACACCGTCCAATATCTCATAGCCACTGGA
GGGCANNNNNNNNNNCAGAGGGCAGCACAGAAACACTATGGGACATTAGGGCCGATAACA
AGAGGAAATCACACGTGTCATATATCATGTAGCCACTGGAGGGCAGCAAAGAAGCTGCAA
ACTGTCCTATCGCAGCAGACCACAAAGGGCGACAGAGAAATAGTTTAAACTCATAAGCTA
TGGCCTCCAACTTATATAGTTTATGGCCCCACGAGGTCAGCAGAGCGACAGTTCGAGGGA
TCAGGAAGCTTATAGCAACAAGAGAAAAGCAGACTATTTTGGGTGGCAGTTGAGAAGCAC
TGTAAACTGGCCTGTACCCAGAAGGCGACAGAGTTTACATTGTCATATACCCTATGGCCA
CCCGAGGGGCCCAGAGAAACCCTTTACTCAACCAATCGATTATAATTACTGAGCGCCTAC
TTTGTGCAGAGCACTATACTAAGCGCTTGAGAAAGTTAAACGAGGGCAGCAGGACAACAA
TTCTAGGGGTCAGAGGGCCTGGCAACAGGAGAGAAGCAAAAAGGAAATTCAAAGGATTAT
ATACCTTGCTCTCAGAGGAAGGCCGAGAAGCACTGCAGAACTGTCCTATACCTCTATGCC
AGGGGGCGACACAAACAGCTCAAACTCCTAGCCAGTGGCCACCAAAGGGTGGCAAACAGT
TCGAAGAGTGCCAGTGACCCTTTAAAGTGTCATATGACCTACGGCCGCACGAGGGCAGCA
GAGCGACAATTCAAGGGATCAGAGAACTATGACAACAGGAAACACAATTCAAGGGGCCAT
GGAGGGGCGGGGGGCGGCCTGTGGCAACAGGAGTGAAGAAGTGAGACTCTTCAACATGTC
ATATGGTCTCTGGTCACCAGAGAGAAGCAAAGAACAAAGTGTCACAACAGGCTGCAACCA
GCAGGGGGCGGCAAAAACCAGTCCATAGAGTCATATAAGCTGTGTCCGACAGAGGGCAGC
AGAGACCTCAAAAGGGTCACCCGACCCGGGGTTACCGTGGGCAGCAGCAGAGACAATGCT
TGGTGTAAGGTAGGTTCAGCCGCAGCCATGACCAACAGGCTCCCCCCTGCCAGATAATGT
GTGACCTGGGCCTGCCCCAGGCCAGAACACAAGGTAGCCAGTATCTGGTTGTGAAAAACA
TGTTATAAGAGAAATGGCTCTTCGGCATCCTCCACTGAGCAACCTAATGGAGCCCTTCCT
AGTTGGGGACCTAGTGGCCCTGGTTCCAGACAAATGAAGTGTCTGTCTCCCCCTCTAAAC
TATAAGCTCCTCAAGGACAGGGATCTTGTATAATAACTCTATTGCACTACTTCAAGTGCT
TAGTACAGTGCTCTGCAGACTGTAGGCTCTGATTCATTAGAGAAGCAGTGAGGCTCAGTG
GAAAGAGCACGGGCTGGGGAGACAGGGGTCATGGGTTCGAATTCTGGCTCTGCCACTTGT
CAGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCATTGACCTCATCTGTA
AAATGGGGATTAACTGTGAGCCTCACATGGGACAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1058, 2209..2270, 4983..5136, 5579..5799, 5948..6092, 6943..7012, 11559..11628, 13784..13795
1001..1058, 2209..2270, 4983..5136, 5579..5799, 5948..6092, 6943..7012, 11559..11628, 13784..13795
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved