Ornithorhynchus_anatinus Locus Mono:ACA59
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:ACA59
Ornithorhynchus_anatinus
Mono:ACA59
1
ACA59
1001..1173
2173
TTAAGCGGTTGGGAAAGTACGGTGCGGTTGTTAGATCCTATCCCTACTCTCGAGGAGCT
CGCGATACAGCGGGGCAGACGGACATTAGAATAAATTATGGCTTTTGTAACGTTGCCCTT
TCACCTGCTGCCTCTCCCCGTGTGAATAACCAGCTCCCCTCCAATCACACCCTTGGAAAC
CCCTGAATGATTCTTGCTCGTGAATGAGATGGGGGGGGGGGGGGCGGGGTTTGAGTCAGA
TTCTCCCAGTGAGTAAAAGCCTCCCACTCTCCGAGACTACATCCGTGCTGTCACAGGACG
AGAGGATCCTCGAAGGCACGGCAGAGACCCGATTCTCTGTGGCTCGGCGTGCAGCTAAAT
AGTGACGCGTCAAACCGAGCCCCCGCGATTTTAGGTTTTTGACTGTTTAGTCTTCGGCTG
CCTTAGCCTAGTGGAAAGAGCGTGGCTCTGGGAGACAGAGATCTGGGTTCTAATCCCAGC
TCTGCCATTCGCCTGCCGTGTGACCTTGGGCGAGTCGCTTGACTTCTGTGTACCTCAGTT
TCCTCGTCTGTCAAATGGGGATTAAGTATCTGCCCTCCAACCCTTTGGCTTGGGAACCCC
AAGTGGAAAAGGAACTCTGTGGTACCTAAATGCGTACACGCTAAGTGCTTAAGGAATAAT
AGTAATAATTATTATTTATACTAATAATTATCTCCACTGAGCAGCGCGGCTCAGTGGAAA
GAGCACGGGCTTTGGAGTCCGAGATCATGGGTTCGAATGCCGGCTCTGCCCCTTGTCAGC
CGTGTGACTGTGGGCGAGTCACTTCACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAAT
GGGGATTAAGACTGGGAGCCCCACGATGGACAACCTGATTCCCTTGTGTCTGCCCCAGCG
CTTAGAACACTGCTTGGCACACAGTAAGCGCTTAACAAATGCTAACGTTAACATTAATTA
CCACTGTACAATCTTAAAGGAGGAAGAAGAGAAGCAGTGTAGCCTAATGGATAGAGCACA
GGCCTGGGAGTCAGGAGGACCCGGGTTCTAATCCCACCTCTGCCACCTGTCCGATGGGTG
ACGTTGGGCAACTCACTTCACATCCCTGTGCCTCAGTTACCCCATCTGGAAAATGGGGGT
TAAGACTTTGATCCCCATGTGAAACGGGGACTGTGACCAACCTGATAACTTTCTATCTAC
TCCAGCTTTTAGCACCCGTGGCTTAGTGGAAAGAGCACGAGCTTGGGAGTCAGAGGTCGT
GGGTTCGAATCCCCGCTCTGCTACTCATCACCTGTGTGACTTTGGGCAAATTACGACTTC
TCTGTACCTCAGTAGCCTCATCTGTAAAATGGTGATGAAGCCTGTGGGCCCCACGTGGGA
CAACCTGCTTACCTTGTATCTACTCCAGCACTTAGAACAGTGCTTGGCACATAATAAGCA
CTTAACAAATACCATTATATATATATATATGTATATATATATGTGTGTGTGTGTATTTGT
GTGTGTGTATATATCTCAGTGGAAAGAGCACGGGCTTGGGAGTCAGAGGTCATGAGTTCG
AACCCCGGCTCTGCCCCTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTGACTTCTCTGT
GCCTCAGTTCCCTCATCTGTAAAATGGGGATTAACTGTGAGCCTCACGTGGGACAACCTC
ATTACCCTGTATCTCCCCCAGCGCTTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACA
GATACCAACATTATTACATTTGTATATGTAATGAACAAATACCGTTAAAAAGAAGGCTGG
TGCAGAAAAGAGGAAGTATAAGGAGACAACAGTGTAGCTGGAGGTCTTTGTGCCAGGCTG
CTAGAATTTTCCGTTTCCCCAGCGTCGGGGGAAGGGTCGGGCTGTTTGCTACACACCCTG
GAGTGGGATTGGGTGACTATACGTTTACTGGTTCTGAGTGGGGTTCGAAAGGCTTCTTCT
CCATCCCCACCAAAACACTGGGGGGAAGGGCCGAGGGTGCTAAAGGGAGCATCAACCTTA
TACAAAATGGGAAATTAGACTTCCATTTATTAATGACGCTATTTGTTAAGCACTTGCTAT
GCATCAAGCAGCGTTTTAAGGACCGGGGTAGATGCAAGCAATTCAGGATGGACACAATCC
CTGACTCCCAGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved