Ornithorhynchus_anatinus Locus Mono:SNORA33
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA33
Ornithorhynchus_anatinus
Mono:SNORA33
X5
SNORA33
1001..1123
2123
TAAAACAATGAGGTAAAAGATACTATCTGAGTTGGGTGAGTTGTGAGGTACGGGGAGAC
TTCACTGAGAGATTTATATCCTGTCTATGACCTGATGGAAAAACACTGTTTTCATGCCTC
TATGAAGTTTGCAGTTTTTGAAGGGCACAGTTAATGGATGTGCACTTCTAAGACATATGG
GGAAAGGTCATCCAGCACCTCTTAACTCAAATTTTTTTTTTTTAAATTGACTTCCTAGTT
ATGTGAATCTGCACAGATTTAATTGTTCAGAGCTCACCCTACAACTTGGTCAAAATTTCT
ATTGCTTTTTCTTATAGCACATGGCCTTTTCAAATGTCAGTAACTTGGTTAATTCCTAGC
CAATTATTTTCAAACTTTGCAGTGCATATACTCACCGTGGATACAAATAATTTCAGATGC
ACACACCAATCTGATCATCTAAACATCTGTTATCTGGACGGATTGTAAACCATAGGGCGG
CTAGTTCAGTCAATAACAAAAATCAGAATAGTACCAAAAAAAAATTGCTAGTAGTAGATG
AATTGTCTTCAGGTTCCAAACTGACGCTGCCAGATGGTAAGACTTCATCCACTAACATGA
GAGTAACTTTGTGAGAGAATCCTTTGGATATTTATGCACTGTGCACACAGAGATACATGG
GAAACTTTTCTGTCCCCTTGTCATTAAGGTTAGTATTGCTAATAAAAATGTTTACTAACA
AACTTGAGAAGCACTTATCTGATAGATTCATACATATAAGTATACAAGACATTATTTATG
AAGATATTGGTACTAATAGGTTTGTTGTTAGGGTACCAATAAGGTTGAAAAGATGAATTT
GTATCCTGTGATATTTTCTGTCTCAGGACATTCATAGCAACTAACGTCAGCCTTTTTTTT
TCTTCAGTAGCATATGACTAGGAGCTACAAAGTATCTTGAAGAAAAAGTATCAAGGGTTG
TTGGGACCTGCCTCTGATCCTTGGTAAAACCCAATAATTACAAGGCAGCAAATTTCTTCT
GTGTATCTGAATGTGTTCTACAGAAGTGAACTGCAAAATGCTGGCAACATCATAGACAGG
ATATAAGTCGTAAAGACTTAGTGATCTTGAAAATGACTACATTTTCCCATAATTCAATAT
TTCTTGGAACTACACATGACCCCTTATGTCACAGGGGACTGCTATTAGGTTGCAAACTCG
TTGAGGGCAAGGACTGTGTCTTCTACTTTTATATATGCTTCCAAGCACCTCATGTGGTAC
TCTGAACAAATAGACAATGATGATGTTGAATAGGATGATGAGGAAATACAATTTCTCTCC
TTAAAGTGTTTACAATCTAAGTATTGACATAGACACACATGCTAATATTTTCTTTTGGTA
TTTGTTAAGTATTTACTGTGTGTCAAGCACTATTCTAAGCACTGGGGTAGCTACAAATTA
ATCAGGTCAGACACAGGCCTTGCCCCACATGGGGCTCACAGTCTAAGTCAGAGAGAGAAC
AGATGTTAAATCCCCAATTGACAGATGAGGAAACTGAGGCACAGAAAAGTTAAGTGACTT
GCCCAGAGTCACACAGCAGGCATATGGCAGAACTGGGATTAAAATTCAAGTCCTCTGACT
CCAAGGCCCATGCTTTTTCTACTAGGCCATGGTGCTCTTCATTCACACAAGTGCAACATG
TTATTTATTTTCTTTAGGAGGCAGATAGGTAGAGGGGAGGATGAGGAAGAGAGAGGGAGA
GAGAGAGATAGAATCCAGGCAGGTTCAGGTTCTATTTTCTGAGGTTCTATTGAGTCTATT
GTCAGTGAGATTTTATCACTCTGTGAGTGTGTGTGTGACATGTCACAGAGGTGTGACTGA
CCACCCTTTTTTCATTAGCTTCTTGTGTCTACCAACTCTGTTGTACTGTACTCTCCCAAG
TGCTTAGTACAGTGCTCTGCACACAATAAATGCTTAATAAATACCATTGATGATAATAAT
GATGATGATATAATGATTTCCCTTTGTAATACGTCATAGCTTACATTATTTTCATTGCTC
TTTCTTGGTGTTACAATCTTCTTGAAATTTTTATTTGAAGAAACACAATCAACAGCATAC
AGCAATTTCTGGATGGCTGTCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved