Ornithorhynchus_anatinus Locus Mono:snoR53
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:snoR53
Ornithorhynchus_anatinus
Mono:snoR53
X5
snoR53
1001..1077
2077
AACACTTAGTACAGTGCTTGACACATAGTAAGTATTTACCCAAATGCATTAATTTGCTA
ATAGGACAGCCCACGAACAAAGCATTTCTGTGAGAAGCTAAATATTCCTGTGGTACTACT
AGAAACAAAACGATATAGAGCAAATACTTTCTCAACGACATTATCTGTATAACGCAGTAG
CATTCTCAAGTTCCTAGTCTGCGTTGTGCATCTGTCAAGTCTAAAGCCCTTGTCACTGAA
GAGAGTTTCATTTTTTAGAAATCAAGTCAGGACTCCATTAAAGATTAATGTAGCGCTCCC
TTAAAGAAGAAAAATGTTTCTGATAAACACCCTGCATCATTAATTGGAATTTGGAAGCAC
TGCCAGGGAACCGTAATTGACACTACAAGGTGGCTTGTTTAACAAAGTCCCATCACTTTG
CATTATATTAGAAATCTATTCGTATTCCATGCTTGCCAAGGTGGATGATGCATACATTTA
TGTTACTTCTACTTGTCAACTAGATAGCTCTTTCACAGCAATCACACTTTGGCTATCTGT
AGCCTGCTTTTTGTCCTGGGGGGCCACTTGATGTCACTGATAAACCATGCAGGTGGAGGT
TAAAAAGTATTTTTTGACCTCAAGTCACTCTGGCCAATAGTTGAAGAGTACATCTCTGAG
GTACAATTATTCTTTTGGAGTCACCTCTATTGTATTGCACTCTCCCAAGCGCTTAGAACA
GTGCTCTATACACAGTAAGCACTCAATAAATACCATTGATTGATTGAGTCAGTGGGCTTT
CTATAAGAAGGACAAAGCTTATGCTGCTAAAGACTAATTTAGTTAGAACTTTGAATGAAC
TCAGTTCACATATTATGCCTATAACTGAATCACTCCTATTTTGTATTCTGACTAAGTTGT
CCAAGGCACTGTCAGGATTATGAAGAATGCTAGAAAGTGGTTCTCTCTGAAAGCAGATAC
CTTCTCTGTCATTAAAGCACCCTATCGATATTCAGTGAACATGAATTGATGATTACACTC
CATGCTAAGGACAAACAGTTCAAAAATACAAATGATATGGATGTTCACCTTTACCACAAA
CCATGTTACTTATAATTTGCCAAAAGATAAAAGTCACAAGATTTCAGAGAGGGAGTTAGT
GTTATTGGAAACCAATGAATTTTAAAATCTTATAAAGAGGGTGTTGTTTCTATTCAGAGC
TTTCAAACTAGTATAACATAGGTAATACAAAAAAACACATTATTTTAGAATGCTCCTTCC
AGAAAGGAAAGCATGTAATTCAGATCATTTTCCTATTTTCCTTAATGGGCACTGTATGAT
AATGTAGATGATTGGATAATTAAAGTCTATTTTACAGAGAAGTAACGCATCCTATAACCC
CCTGGATCTTGCAAAAGTGAATGTATTCTCTTAGAAATTAACATGCTACCAAAGACAAAG
CCAGACAATAAAGAGAATCTCGTTTAGCATTTCTATTCAGAGCAAACCTGATGCTAGGCT
GAAAAAAGTCAACAGAAACCACCTGTTACAGAACAGCTTGAGCTTTTCTTGATCCATTAG
CCACATAAAGAAATGAATATTTGCCACTGGTACATTTTGTTATTGTTCAACTCCCAACTC
CTGGAAAATGCTAGGTTGAATTTGTGTAGAGCAGGCAGGTTTGGTGAGGGATAGCTGAAG
AGTCTATCAAATAATTTGGGATGTTTGAAGAGGGCTGACAGATGTGCCTTCCCTATCTTA
TTCCATCATCCAGCCTACCCGGAGTCAGAAGCCTTTTCTGAGGCTATCCAGGATAGCAGT
AGGATGGAGAGTGTGACCAAAATGGTGGGATGAGAGAACCTTAAATTCTAATAATAATAG
TAATGGCATTTGTTAAGCACTTATTATGTGCCAAGCACTGTTCTAAGCACTGGGGTAGAT
ACAAGATAATCAGGTTGGACACAGTCCCTGTCCCACACTGGACTCACATGGGGGAACTGA
GGCACAGAGAAGTTAAGTACCTTGCCCACAGTCACACAGTAGACAAGTGGCAGAGCCAGG
ATTAAAACCTGGGTCGTTTTGACTCCCAGGCCTGTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved