Ornithorhynchus_anatinus Locus Mono:SNORD33
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORD33
Ornithorhynchus_anatinus
Mono:SNORD33
X3
SNORD33
1001..1080
2080
GGTGGTTTTTTTTTCCTTATTATGTGAGGTAAGGAATGATTAGTGATAGGACTGGGATA
TTCATATTGCATATTCCACCTTAGAAAATGATTTTTGAATGCTTGGAATGCACAAATAAA
GGAAGACTGCTTTCTGGGTCCCAGTATTAGCCGTCTTGGGTTCTTATAAAAATAAAAGCC
GATGTCTCTCCCAGGCTTTTCCAATTTCCCTACTTGAGCAATAGTTTTCTTACTGAGACT
AATTGGCAGTTATTACATGGCACTTAAAGTAGTGTTTGACAAAAAGCTTAACAAATACCA
TAAAACAAACTGAACAGATATGATCTTCATCAGTGGTGAATATTCACCAGTCATTATTCT
TGGTACAACCCCATGTACAAAGGGATGAATGGAGATTGCTAATGACCTTTAGCAATATCT
TGATGCTATCTTAGCAATATCTCATAGTCATTTGGTCTTGGACTCCAATTATGAAAGGCC
TTCCTTAAGCCACCCAAACCCTTCTTCCCCTTGGCACCATTCTCGTCCTACTCCAGAGTC
CTGTGTTTTCTTCGATCAGGGCTAGAATCCGATATTTGGCCACCCAGAGGTGGGGAAGAT
TTACCATCTCCTCCCATTCTGTATGATGCCCATATGCTAAGTTGGATAGGCAGTGAAATG
TAGAAATGTGCTTGAACCCCTAAACCTGGAACATTTTTTCGGACCCACCCCGACTCACCT
GATCCCTCACAGCAATATCACGGCATTCCTTTCCAAGGGTCACGTTCACACAGGTGCAGC
TTTTAATTTGGGCAGAGAGAAGTTGGCTACTTTTCAAATATCCCCAAATCACATCCACCT
CTCCGCCAGTGTGTCCTGAGGCAGTCACCTCACTCGCTTACTATCTGAAACTACTTCCGT
CTGTGAGTTGAGAATGATTTTTCCTGTCAGGGACTGGATCTGGTTCTAAACTAAGCTACG
CAGGCATCCAGCTCAGGATCTGGTCCACAGGCCCTCTCCTTCTGGTGATGAGGAACATTC
ATCATCTTTCGTTCGAGTCTCGCGACCGTGAGTCCAACTCCATGCACTGCTCTAAGGCCT
CTCCTCTCCTCTGCTTGAAGCGGCGTGGCTCAGTGTTAAGAGCCCGGGTTGGGAATCAGA
GGGGATGGGTTCGAATCCCAGTTCTACCACATGGCAGCTGTGTGACTATGGGCAAGTCAC
TTCACTTCTTGGTGCCTCTGTTCCCTCATCTGTAAAATGGGGAGGAAGACTGTGAGTCTC
ACATGGAGCAATCTGATTACCTTGTATCTACCCCAGCATTTAGAACAGTGCTCTGCACAT
AGTAAGTGCTTAACAAATATCAACATTATTATTATTATTATGAGGGACTGGGATGAGAGT
AGGTTAATAATGTTAATAATTATGGTATTTGTGAAGCGCTTACTAGGTGCCAGGCACTGT
TCTAAGAACTGGGGTAAATACAAGGTCATCAGATTGCCCCACGTGAGGCTCTCAGTCTCA
ATCCCCATTATACAGATGAGGTACCTGAGACAAAGAGAAGTGAAGTGACTTGTCCAAGGT
CACACAGCAGACAAGTGGCGGAACCGGGATTAGAACCCTCGACCTCTGACTCCCAAGCAT
GGGCTTTTGCCACTAGGCCATGATACGCCACAGGTCCTGGTATCATTGGTGAGCTATATT
ATTTTTTAATGGTATTGTTAAGCATTTACTCTGTTCCAGGGGCTGTACTAAGCTCGGGGT
TAGATACAAGGTAATCATTTTGGACACAGCCCCTGTCCCACCCATGGCTCACAGCCTTAA
TCCTCATTTTACAGATGAGGCCATCGAGGCACAGGGAATTTAAGTGACTTGCCCAAGGTC
ATACAGCAGGTACATGGCAGAGCCAGGATTAGAACCCAGGTCCTCTGACTCTCAGGCCTG
TGCTATTTCCATTAGGCCCTTTTGTCTCTTGGGGCAAATGCTGATTAGAGAGCATATGGT
GTTATAGGGGAGATCAGAAAGTACCTTGCATTTCCAACGTGCCCCAAAACTAGAACAATC
TTGCTGAAGTGAACCCTGGAACAGAAGGCTCCATTCAACAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved