Ornithorhynchus_anatinus Locus Mono:SNORA31
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA31
Ornithorhynchus_anatinus
Mono:SNORA31
X1
SNORA31
1001..1119
2119
TCCTCACAACATTCATTCATTCAATCATATTTATTGAGTGCTTACTGTGTGCAGAGCAT
ATATTAGATGCTTGGGAGAGTATACAATAACAATAAACAGACCAATAAATCTACACATCT
AAATATGCACTTTCAATTTAGAGTAAATGTTCAAGAACTGAACATGCAAATAGATAGTAT
CTGATACATACTTAGGGAATCTGAATCTTTCTTTAATGGGAATAGAAGAAACATAAGTAG
TGCAGCAGAGAGTAGATTAAAAATTGTCAGGATGGTTTTGTTTTTTTTTTTAGTGGTGTT
TGCAAAGCCATTACTATATGCCAGGCACTTTACTTGTAGATACAAGATAATCAGGTTGGA
TATTATCCAAGTTCCACATGGGGCTCACAGTCTTAGTCTGCATTTTACAGATGAAGTAAC
TGAGCACAGAGAAATGAAGTGACTTGTCCAAGGTCAAACAGAAGACAAGTGGCAGAGGCA
AAATTAGAACCCAGGTCCTTCTGACACCCAGCCTATGCTTTATCCCCTATATCACACTTC
TGCTCCCAGACCATTCTTGTGCCTCCTAAATGGCATTTTTCAGCAACTTAAAAGGAATGC
TAGAAGGTCCCTGAACCCTCTAAATAATTCACATTTGGCAACTCATGTATGAAAGTGTTC
TAAAATGGTTTGCAAAATAAGTCAATCAATGGTATTCATTAAGTGCTCTCTGTGTGTAGA
TTCAGTCAATCAGTCATTCATAATTATTAAGTGCTTACTGTGTGCTGAATACAGTACTAA
GTGCTTGGGAGAGAACAATATAAATATATAATAGAATGTACTAAACTTTTGAGAGTGTAT
AATATACTGGATTTGGTATGAGTAATACTTGTTCACAAGGAATTCACAGTCTAAGAGAGG
AACAGATTTAAAATAAATTACTAAGAGAAAATCGTGGAATATTAAGATATGCATATAAGT
ATTGTAGACCTGGGATGAGTATTAAAGTGGTTAAGTGCTTAATGCAGCTGGGGCAGTTCT
ATCTGCTTTAACGGTTTCCACTTAGTTGCAAGAAAAAACTTCCTTGTTCTTTCTACCTGC
TTGATCTGTGGAAGTGCAGATTAACTAGGGAAAGACAAGTCCCTGGAGTAAAGGACTCTT
AGAAACTCTTAGAATGGAAGTAAGAGGACTGGACTGAAGTAGTTATTGGACTCCAGACAA
TGGTTTAACCAATTTTGAACATCTTTTCCCAAATGGTCTTAAATAGTTCCTTTAAAAAAC
ACTTTGAGCTGTTTTTCTCTAGACTGTGAGCTCATTGTGGACGGAGAACATGTCTGGCAA
TTCTGTTGTATTGTACTTTCCCAAGCACTGTGCACATAGTAAACACTCATTAAATACTGA
TGATGATGATGAAGATGATGATGATTAAAGTGTAGGTAGCCAAGAGCAGGTAAAAGTAGA
GTTTACATTTAATCAATCATCCACCAACCCAATATAACCAATAGCTTAACTTCTCAATTT
ACTCGCTCACTGGAGACCCATCAAAAGTGTAATTCTGATTAATTACATTATATGGATTGA
GAAACTGAGACTCACCTGGGTTAAAATTGCATAAGACTCCCTGCAGTTTTCTTGTGGGCT
GTTCCACAAGGCTTGAGAAGAAGGGCAGTCTATAATTATGTGATGGAGTCTCCTATCATA
TAAGGTGGATGAGCCTCATCTGGTATGAAAGATTTTGGGACCGAACTGACTTTGGGATTG
AAAACCTATATGAAGGAATTGATTACAGCATTTATAGTTTATGCAGATTCCACTTACAGT
ATCCCAACCCTGCTAGCTGTGTTCATGCTGGAGGAGTGATGTAACTAGGGACAATACAAA
CAGGCATAGAAGTAGGTGATTCCTGTGCTATCTGCTCACATCACTGGTCTGTTATACTGA
TAGCACCATCTGTCATTCTCTTGAAAGTCCTTCAATAACTCCAGTTTCATCTGTCATCTC
CCCCCATCTCCTCCTCAAAGAGTTCTAAAAGTTCTAAAAGTTATATTACTAAAGTGCTGC
AATTTTGGCATATCTATTGCACCAGGAGTTACATAAAATTAAAATAAACTGTAAAATATT
TAGGAGAAAACATGGCAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved