Ornithorhynchus_anatinus Locus Poly:SNORA7
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA7
Ornithorhynchus_anatinus
Poly:SNORA7
X1
SNORA7, SNORA7
1001..1147, 3179..3325
4325
ATCTTTCTAACTCCCAGGCCCGTCCTCTATCCACTGAGCCACGCTGCTTCTCGGTGCAT
GGTTGAACCTGGAGCTGACAACTATTTGTCAGCCCAGAGAGGGGAAAGCAGGAGGACATC
TACAATTCCCCAGCTCCAGGGAGGACAGAGGAGTCAGAACAAGAAGACTTGTCTTTATTT
TCCTTTTATTTTAAAAACTGACAAAAACTCAAACCCTGGGTCCAGCAGCCATCCAAGACA
GGAAGGACACCAGAACCGGGAAAGGCTGCCATTAAGGGGGAACGGTCATGAGACTACCAT
CAGATTGCATTTATGAATGGCGAGGGAGCCAGCACCATATTGTGTCATTGTTCAACCTCT
TCTACTAAGGAGTGGTACCTCTGATAGGGTGCCCATATAAATTTGTCTACTGACCACTGC
CATTAAATAAATCATGCCTTGCCTCCCAATTACAGACCCATGCAGCCAGTCAATTGTATT
TATTGAGCACTTACCTTGTGCAGAGCTCTGTACTAAGTGGTTGGGAGAGTACAATATAAG
AATAAACACACTGCCTGCATACAACGAACTTACATTATGTAGTTGTATCAATCCCGTCGG
GGTGGGATAGATGAGCTATCCCAGTTAAGACTTCCTCCTGCATTTCTCAACCAAAGGTTA
AACTCCCATATAACCTACCAACAGGTTTCAGGTGATAGGATGGGATGGTAAAAAGCATCT
GAGTTTGGCCTTGAGCAAGAGGTATAGTCTCACGGCACAATGGTCTCAAGCTCCGCACAT
AGTAAGCGCTTTACAAATACTATTATGGTTATTATGTGCCAGTGCATCCATAACTACAAC
CCACTATGGGCTGGGACAACTCAGGGCTGTTTCTGGGACAGGCTCGTCTAGATGACCACC
CAACACATCCTAGGCTTTAGACCAACTGTATTCTTTGGGCCTTTGCTATTCATCCCACCC
TCAACCCCACAGCAGTTATGTTCAGATCTGTAATTTATTTCACTCTCTCAGAATGGCACC
CGGAGAGTTTCCAGTCCACTACCGGTCTCGGCTACGGGGTGGGTGCGGGGAGGCGTCAAG
AAGAGGTCTGTCCATTCCATTCCTAGCTGGAGCAGTGGCTAGCGAGTGGAAGGCCATCTG
CTACAAGTCAAAACTCACCCGTGCTGGACGGCAGCGGCATGGGAGAGAGTTGAGGGTAGA
GACTCAAATTAGCACAGAGGGAGGAAAGGTAAACCACTTCCACATATTTTGACCAAGAAA
ACTCTATGGATGCACAGCCGGAACGATTACAGATGGAGGTAGGATATTCTGAGAGAGATG
TGTCCAGGGAGTCGCTGTGGGTCGGAGACACCTTGACAGCATAAGACAAGTAACTTGTTT
ATTAATTGTTATTAATTTCTATCTCTTCTTTTCAAACCTAAGCTCACTGGGGACAGGGAA
TGTGTCTAACCACTCTGCTTTATTGCCCTTTCCTAAGTGCTTAGTATAGGGCTCTGCACA
TAGTAAGTCCTAATTAAATACCACTGAGTGATGGGTTCGCTGATCGAGGGCCAACTTCAG
AAGGCCATGGGTAAGGTAAGAATCTTATGTGTTACCAAGATGGGTCTGCTATAGAAGACA
GCTTGGTAGAGGGGCATCGTATGCGGTGATGGGAACAGGGCAGCTACATTAGAATAGACA
GCAGCGTNNNNNNNNNNCTAATCGGGGGAGACAGACAGACAAAAACAATGGCAATGAATA
GAATCAAGGTGATGTGCATCTCATTAACAAAATAAATAGGGTAATAAAAATATATATGCA
ATTGAGCGGACGAGCACAGTGCTGAGGGAACATCTACAACTGTTCTGGCGGTGTATCCAG
AGAGTTTTCTTGGTAAAAATCCAAAAGTGGTTTACCACTGCCTCTTTCTGCACAGGAAAC
TTAAGTCTCCACCCTAGATTCTCTCCTGTGCTGCTGCTGCCCAGCACGAGGAAGTTTTGA
CTTGGAGCATATGGCCTTCCACTCGCTAGCCACTGCCCAAGCTAGGAATGGAATGGGTAG
ACCTCTGTTTGAATCTCCCTCTGTTTGAATCTCCCTCCCATAGTTGAGACTGGTAGAGGA
ATGGAAACTCACCTGATGGTGGAAGTGATTGCCCAAGGTCAAACAGCAGACATGTGGCGG
AGCCAGGATGAGAACCCAGATCTTTCTAACTCCCAGGCCCGTCCTCTATCCACTGAGCCA
CGCTGCTTCTCGGTGCATGGTTGAACCTGGAGCTGACAACTATTTGTCAGCCCAGAGAGG
GGAAAGCAGGAGGACATCTACAATTCCCCAGCTCCAGGGAAGACAGAGGAGTCAGAACAA
GAAGACTTGTCTTTATTTTCCTTTTATTTTAAAAACTGACAAAAACTCAAACCCTGGGTC
CAGCAGCCATCCAAGACAGGAAGGACACCAGAACCAGGAAAGGCTGCCATTAAGGGGGAG
CGGTCATGAGACTACCATCAGATTGCATTTATGAATGGCGAGGGAGTCAGCACCATATTG
TGTCACTGTTCAACCTCTTCTACTAAGGAGTGGTACCTCTGATAGGGTGCCCATATAAAT
TTGTCTACTGACCACTGCCATTAAATAAATCATGCCTTGCCTCCCAATCACAGACCCATG
CAGCCAGTCAATTGTATTTATTGAGCACTTACCTGGTGCAGAGCTCTGTACTAAGTGGTT
GGGAGAGTACAATATAAGAATGAACACACTGCCTGCATACAACGAACTTACATTATGTAG
TTGTATCAATCCCGTCGGGGTGGGATAGATGAGCTATCCCAGTTAAGACTTCCTCCTGCA
TTTCTCAACCAAAGGTTAAACTCCCATATAACCTACCAACAGGTTTCAGGTGATAGGATG
GGATGGTAAAAAGCATCTGAGTCTGGCCTTGAGCAAGACGTACAGTCTCACGGCACAATG
GTCTCAAGCTCCGCACATAGTAAGCGCTTTACAAATACTATTATGGTTATTATGTGCCAG
TGCATCCATAACTACAACCCACTATGGGCTGGGACAACTCAGGGCTGTTTCTGGGACAGG
CTCATCTAGATGACCACCCAACACATCCTAGGCTTTAGACCAACTGTATTCTTTGGGCCT
TTGCTATTCATCCCACCCTCAACCCCACAGCAGTTATGTTCAGATCTGTAATTTATTTCA
CTCTCTCAGAATGGCACCCGGAGAGTTTCCAGTCCACTACCGGTCTCGGCTACGGGGTGG
GTGCGGGGAGGCGTCAAGAAGAGGTCTGTCCATTCCATTCCTAGCTGGAGCAGTGGCTAG
CGAGTGGAAGGCCATCTGCTACAAGTCAAAACTCACCCGTGCTGGACGGCAGCGGCATGG
GAGAGAGTTGAGGGTAGAGACTCAAATTAGCGCAGAGGGAGGAAAGGTAAACCACTTCCA
CATATTTTGACCAAGAAAACTCTATGGATGAACAGCCGGAACGATTACAGATGGAGGTAG
GACATTCTGAGAGAGATGTGTCCAGGGAGTCGCTGTGGGTCGGAGACACCTTGACAGCAT
AAGACAAGTAACTTGTTTATTAATTGTTATTAATTTCTATCTCTTCTTTTCAAACCTAAG
CTCACTGGGGACAGGGAATGTGTCTAACCACTCTGCTTTATTGCCCTTTCCTAAGTGCTT
AGTATAGGGCTCTGCACATAGTAAGTCCTAATTAAATACCACTGAGTGATGGGTTCGCTG
ATCGAGGGCCAACTTCAGAAGGCCATGGGTAAGGTAAGAATCTTATGTGTTACCAAGATG
GGTCTGCTATAGAAGACAGCTTGGTAGAGGGGCATCGTATGCGGTGATGGGAACAGGGCA
GCTACATTAGAATAGACAGCAGCGTTGCCTAATGGAGAGAGTATGGGCCTCGGTGTCCAA
AGGACCTGGGCTCTATAAGCTCTACCACTTGTCTGCTGTGTGACCTTGGTCAAGTCACAA
CTTTTCTGTGCCTCAGCAACCTCATCTCTAAAATGAGGATTAAGACTGTGAGCCCCATGT
GGGATGTGGACAGTGTCCAACCTGATTAGCTCATATAATAATAATGATAGCATTTGTTAA
GGGCTTACTATGTGCCAAGCACTGTTCTAAGTGCTGGGGGCGGATGCAGGGTGTGGGGCT
CAACTAACCCAGTGCTTATTACAGTGCCTGTCACATAGTTGTGAGCTCTTAATGAATATT
ATTAAAAACAAAAAAGAGAGAGTGGTTGAGGAGCACTTTTTGGGGCGAGATGGAGCAAGA
GGCCTGGGCACAACAACAATCGTTATAGCTAAAAAGACCCCAAGCCAAGTCCTAAGTGAT
GCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved