Ornithorhynchus_anatinus Locus ENSOANG00000022703
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022703
Ornithorhynchus_anatinus
ENSOANG00000022703
Ultra84
SNORA13, SNORA13
2345..2476, 2816..2949
4502
TTTACTTTTTTTAAAAAAAAAAATCTATCGCCAAGTCCCTTAAAGGTGATTTCGAACTT
ATATATCATGAAAGTTGGGAGTCCCTGCTTCCCACTGAACCCTAATCAGGGGATAGTCTG
TGAGGAAAATCTTCCGGAGATGGATTTATCCTGACCGAAAAGTGAGAAAGGAGCAAAATT
AGCGCTGCTCTGACAAGAATCGTGTGGAAAACTTTCGCGGGAATGTTGAAAAGAAGGAAG
TCGGGCCGAAAGCCCACCTCGGGAAATTTTCCCTTGTTTCCGCCTAGCTTCAGAGTCCCT
GACTAGTAACTCTCGTCTTTTGAGAGTATTTGTTTTCTCTTACGGCGTTTCTGCCTCGCT
GTTTCCCCTCAGATTGCTCGGAAAACCTGTGTCCCGGCTCCCGTCCTATCCTGTCCCGAG
CCTCCCGCTCACAGCCCCGCAGGCTCCTCAGTGAATCGCCTCAGAGAGCAGAGGGGCGGG
GCCTGCGGGCAGCCACGTCCTCTGCTGGGAGCCCCACGTGGGACAGGGACTGTGTCCAAT
CCAATCAGCTGGTATCCACCTCAGCGTTTAGTACAGTGCCTGGTACAAAGTAAGCGCTCA
ACAAATGCCACTTGTCGGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCA
GATCCCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTC
CCCTATGTCTACCCCAGCGCTTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATA
CCAACATTATTAAATGCCATTATTATTGTTATTATTATTATTATTCGACAGTTCGGGTCC
TGCCCCAAGACGCCGCCGGTGCCGAGAGACTAAAGCGGCTGTGCTTCCCTCCAGCCACGA
GGGGGCAGCAGAGGAAGGTTCTTGGGGCTATAGGCATTGGTACGGTCCGACGGTGCACCT
CTCCCCGTATTGGAAAACAATGGATCGTCCCGGTGCGATAGAAAAGCATTGTGGGAGGCC
TTCATTCTCCTTTTTCGCCCGGCCGTTCTCGCTGCTGCTTCTACGCCGGTAGGCCTCCGG
GAATACGGGGACGCGGCGGAAGTCGCGACGATCGCGTAGTGTCGGTGTGGGGGCGAATCG
AGGCACGTGGGGAAGGTAGGATTAGAGCGGTGCCAGGCACTGTCCTAAGAGCCGGGGTGG
ATCCCAGCAAATGGGGTTGGACGCCGTCTCCGTCCCACGTGGAGCTCCCGCTCTCAATCC
CCGTTTTATAGATGAGGGAACCGAGGCCCAGTGCAGTGATTTGTCGGCAGAGTCGGGATT
AGAACGCAGTCCTTTTGACTCGCGGGCCCGGGCTCTAATAATAATGTTGGTATTTGTTAA
AAGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGTAATCAGGTCGTCCCACGTGAG
GCTCGCAGTTAATCCCCATTTTCCAGATGAGGTCACTGAGGCCCAGAGAAGTGAAGTGAC
TTGCCCACAGTCACACAGCTGACAAGTGGCAGAGCCGGGAGTCGAACCCGTGACCTCTGC
CTCCCAAGCCCAGGCTCTTTCCACTGAGCCACGCTGCTTCCCCTAGCCATAACCCCCTAC
TACTTCTCGCTACTACTGTGGGGTAGCTAGCTAGGCGTCCAATTACGGTCAATCTTAGAC
TTGCGGAAGTCAGCCGAGTTTCCGAGAAGTTGCAGCTGCAGCTCTGAGAAGCAGCGTGGT
CTGGAGAGAAGAGCACGGGCCTGGGGGTTAGAGGACCTAGGCCCTGCCAGTGTCTACTGT
GTGACCTTGGGCAAGTCGCATGACTTCTCTGTGCCGCAGTTACCACATCTGTAAAGTGGG
GATTAAATGCTGCTCCCTCCTACTTAAACTGTGATCCCCGTGCGGGGTAGAGACACTGTC
CAACGCGATTACCTTCTGTCTACCCCAGCGTTTGGCTGGATTATTTAGTTGTTTTACTTC
CATTCCTGTTATTACATCTGTAACAGGGGGCTTAAAACGGGGCCCCACGTGGGACAGGAT
CTCTGTCCAACTTAACTTGGATATACCCAGCGCTCAGTACTGTTCCCCACACATAGTAAA
CGCTTAACTAATGCCCTTAAATCCCTGGGACTTCTCCGTGTTTTATGGCATTCATTAAGC
GCTTATTACGTGGTAGGCACTGTACAGACCAATCAGGTCGGACTCGGTGGAAACAGAACG
GGCACTGAATCCCCCTTTTGCGGTCGAGGAAACTGAGGCACAGAGGAGTCATTTCTCTCT
CCCGAGTGGCAGCCCCCGATGCGATTCGTAACCTGTGCCAACCCACCTAGCACCCGCGCG
TTATTTGCCTTTTGTGTTGCCCGTTCACTTTTGGCTGCTAGTGAATGTGGTGTCAAAAAA
GGCGCAAATCAAATCCGTGGCAGCCCTATTTTCACTGGATTCTATTCCTGTGGTGTACTT
GCTGCACAGGAACATGGCATGGCAGGTGTGGGGCGCTGGACACAAAGCTGCCCCACGTGG
CTATGGTTAGATTTGATTAGCAAAATAAGGCTTACTCATTTATCTTTCTAGTTATGGAAG
ATGGACAGAATGGTGAAGGCGTACTTAAGGTAGGTGCTGTGGTTTTTTCTCCAGGGACGT
CGTTCTGGGTGGGATTTGTGCAGGCTCTGGGTGTACAAGGGGAAAAATAGCCTTTATTTA
CGTGGGTGCTTTGTCGGTTTGGTTGAAAAGCCACAGAGCCTTTGGGATTTCATTGTGTAA
AGTGCTTAGTACTGTACTCGATGCATTATCAACCATTGATAGATTGGTTATTAATCTGCC
TTTGTGTTGCCCATTCATTTGTTACGGTAATGACTGGGGTGTCAAAAGAGGCATAAATTA
TACACTCTGCAGCATGTTGGGTTTTTAGGAGTTACTTCCTTTCTTCTTTTGCTGCTTTTG
AGGGACATCCTGCTGCTTGTGTAGATAGTTTATCGCTGAAATAGTTATCCAGAGTCCCCA
AGGGAACTCTGAAAATGGCTCCTCCCTGTGGCTATGCATTTCCACTATCATCTAGATTTG
GTCCAGCCCCCTGCTGATTCCCAAAGGCTGGGCTTATTTGTGTCATGGGACCCCAGCTTT
GGAGTGCAAAGAGGGGGGGGGAAGAATGGAGGAGGTGGAGGGCTGTTTCCCTTAGCACAA
CTGGATAATTCAGGAAATGGTTAGGAATGCTAAACTGCTCAAACTGAATATCTGCTTTTC
TCTCTAGGATCTGATCAACTCCTGTGAAGAGATCTGCAAGAACTTATAGCCACATTGGTA
GGTGTGTTATGCTTCCCCCCAGTAGAGTATGGGGAAAGAGTGAGGTATCTTTTAGGACTT
GGTGGCCTTTGTAGGTAGGGGTGGTTTTCTGGAAGGGGTAGTGCTTTAAGTGAAGGGTCT
GTTTCCCTTTCTATGCATTGGATTTTTTCCTGCCATCAGTGACCACTGACCTTGCCATAT
CCAACTGCCTCTGCCACCCTAATCCTTGACTTCTCAGCTGCTTTCAACACAAGACCACCC
CCTTTTTGAAACATCCAACTGATACTAACTGCTTCTCAGTCTCTTTAACTAGCTCCTGCC
TCCCTCTACCAATGGGAGTCTCTCAAGGCTCAGTTCTGGGTCACCTTTCCTACTTCATCT
ACACCCACTCCCTTAGAGAACTCATTTGCCCCTGTGGTTTCAACTGCCATCTGTCTTTAT
GCAGATGATTCCCATGTCCTGATCTCCTCTCTCCTGTAGTCTCACATTTCATCCCATGTC
CAAAACAACCTAACTTTCCCACATAACTGTAGACAGCACCCACCATCCTTCCCGTTTCAG
CATTATCCTTGACTCATCTCTCCTTTAACCCACATATTCAATGTCACCAAATCCTGTTGG
TTTTACCTTTACAGCATTGCTTTAAATCTGTCCTTTCCTCTAAACTGCTACCATGTTAAT
CCAAATTCTTAATCCAATCCTGTCTTGACCTCCCTGCCTTTTCTCTGGTCCATGCTTCAC
TCTACTTACATGGATTATTCTAAAAAGTTGTCCCTATTAAAATCACATCTAGTTCCAAAG
GCTTTCCCCATGCTTTTCCCTCCCCCTTCTATCACTCATGCAACTTGGCTCTGCGCCTTT
TTACCCTTGATAGTCACCCCACACTACATAGTGTCTCCCTTGTACAGTGCTGTGCACATT
GTAAGCACTCAATAAACTTTTTTCTTTCAAAACGAAGCTATTTAGAGCATTATTGGTCCC
TTTTGCTTTTTCAGTAGAAGCTGAATGCCCAACAGTCCCACAGATTCCGAGGTGGGGATG
GGGGGAAAAAGCCAAGCAGCAACCAGCTGTGAGTCATTTTTACCTTTATCAAACACAAGA
CAAGGGCACTTGAAATTAAAAGGCAACACATTTAAAAAAACTTTCTTTACGACATTTGTA
AATGATCTGCAGAATGCACTGCCATAAGGTAGATTTTTTTAAGAGAATTTTTTAACATTT
ATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1067, 2571..2608, 3247..3502
1001..1067, 2571..2608, 3247..3288
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved