Ornithorhynchus_anatinus Locus EIF3L
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus EIF3L
Ornithorhynchus_anatinus
EIF3L
Ultra727
SNORA14
9362..9499
14415
ggagagtacaatataaccataaacttacattcataaagatcccagagtagtgtgtgtaa
ggtgcttgtgctggctctgtttatctataaagccagagtttaaaagcttttttgatctaa
agtaaatacttttgagttaaactcattgcaagcttcgaggaaacctttatttgttaaaat
ccacaggttgctcttaatcttaaatcctagccttccaaattttccttgcctcatagcttc
actttgattatatgctgatcaatatctcgacatctcataatcagtaatgggaatcacttc
gaggacaaacattgatttttctaacccgcccttcatccttttgaagggatttgactatta
gctaaaatattcttctccaggctacaatcagtaaccaatgcataaaaagtcggaattttt
tggtcttaaaaaggagaatgttttactgtaaatctgattttcattaacgtgtggtgcttg
agtgggaatttcaaaactcagcttgcgttacttccttcttctttcccaaaagcttcgcgg
tttatgaaccaaacccttgtcttcccacagccgggaattatggacgacgagcttcaagat
gggctgtccctgtctactgcccgttctaaatgaagtgactcagaaaaagacacagttttt
tcctccttcgcaaaatacggcaaaggagtcccataaaagcagtccagatgtatttatggg
ttcgttgcgttttaagttaattcaggcgccgatctggcccctaaacttgaattccccctt
catccgggtctttcacgacctgaatggggacggaggggaaggggcgggagcgccgccatt
ttgtatgtggccgatccttcagtttccaccatctgtgcggccgtccactcttccagactc
gcagttctttccaaatccctgaaatacatatttttattgatttcttctaggtggtggtaa
tcgttaaagctaaagggaggggggatttttccgatttgagaGGGGGCCACATCCATCATG
GCGGCGGGGGAGCGCTTCCGGTTTCTTCCGGAAGTGCGCTGGAGTCGCAGGCCGGGCGGG
TGCGAGGAGGCCAATCTTTTTCCCCGCGGTGTCGGCCTGTCGCCGCCATGTCTTACCCGA
CCGAGGAGTATGACACGGAGgtaatgcggcgcctcggggcctgagggcaggcctcctgcg
agccttgggagagcagaggcttcacggggagcggggagggggggaccggccacccgcatc
ctccatgaggaggccgaggcggcggtcggacgaagccccgaggaacgcagagaactgtgt
gctaagcgcttggccgagattagtagagagaagcagcgtggctctcaggggacttgggag
tcctccccttgtcagccgggtgacctggcgcaagccacttctctgggcctcagttccctc
atctggaaaatgggggttacacgtgggagccgcacgtgggacaagctgattagccaggac
ccaccccagcgcttaataataataatgttggtatttgttaagcgcttactctgtgcagag
cgctgttctaagtgctgggacacatccagggtcatcaggtggtcccacttgtaggctccc
gttcttcatccccattttacagatgagggaactgaggcccagagaagtgacttgcccaca
gtcacccagctgacaagcggtagagccgggattcgaacccctgacctcggactcccaagc
ccggcttcttgccactgagccacgctgcttctcactgatggtatttgttaagaccttgct
atgtgccaagcactcttctaagcgctggggtaaataccaggtcatcaggttctattgatt
ctatttattgattctgtttattgctattgtttttgtctgtctcccccgattggactgtaa
acccgacaaggggcagagactgtatctgttaccgatttgtccattctaagcgcttagtcc
actgctctgcacatagtaagcgctcaataaatactattgaatgaatgaatgtttccgaat
tgtccattccaagcgcttagtccagtgctctgcacatagtaagcgctcaataaatactat
tgaatgaatgaatgtttccgaattgtccattccaagcgcttagtccagtgctctgcacat
agtaagcgctcaataaatactattgaatgaatgaatcaggttgtcgcacgtggggctcac
agtgtcagtccccattttaataatagtaatgttggtattggttaagcgcttactgtgtgc
agagcactgttctaagcgcttgggagatacaaggtcatcagcttgtcccacatggggctt
gcagtcctcatccccattttacagaggagggaactgaggcacagagaataatagtagtta
taatgttggtatttgttgagcgcttactatgtgcagagcactgttctaagcgcttgggag
ataaaaggtcatcagcttgccccacatggggcttgtagtcttcatccccattttacagag
gagagaactgaggcacagagaataataatagtaataatgttggtgtttgttaagcgctta
ctatttgcagagcactgttctaagtgcttgggagatacaaggtcatcagcttgtcccaca
tggggcttgtagtcttcatccccattttacagcggaaggaactgaggcacagagaataat
catagtaataatgttggtatttgttaagcgcttactttgtgcagagcattgttctaagcg
ctggggtagatacaaggtaatcaggttgtcccacgtgaagttcacagtcctaatccccgt
tttacagatgaggtaactgaggcacagagaagttgagtgacttgcccttagtcacacagc
aggcaaggagcggaggcaggattagaacccaggacctgtaactcccaagcccgggctctt
gccactaggtcaggctgctcctccacaatgatggcatctgttaagcacttaatatgtgcc
aagcactgtactaggcgctgggggagttacaaggtcatcaggttgtccacatggggctcg
cagtcttcatctccattttacagatgagggaactgaggcacagagaagtgaagtgacttg
cccaaagtcacacagcagacaactggtggagcgagattagaacccaagcccatgttcttt
ccactaagccatgctgcttttaagtgctcaacaaattgttactattattagacaggacct
cggttcaaggagaagccgcgtggcctagtgggaagagcctgggggggtcagaggagctgg
gttctaattctggcactgtcacatacctgatgtgtgacttgggacaggtagcttaactta
tttgagcctcagttccctcattagcaaaatgaggctccagtaccccccccaacattaatt
tattcattcagttgtatttattgagcacttactgtgcagagcactgtactgagcgcttgg
aatgttcagttaggcaacagaatgtacgctgtaagctcattgtgggcagagattgtgtgt
ctctttattgcagtattgtactttccatgtgatcagtgctctgcgcacagtaaaccctca
gtaattacagttgaaagaatgaattaatatatatctcagcacttggcacatagtaagcac
tctatagctatcgcaattagtgttgttaaggagtttgggttctagccgattttccggggg
ttgcaacctgccctaagtcttttaaatccataactctcgtggttggtgtctctcgttcca
gGCCGCCTACGATCCGTACACTTACCCCGGCGACTATGATATGCACACAGgtgagccacc
tctgtccccaagtcccaccccgagtgagcgacaccttacgtagagaagcagcgtggctca
gcggaaagagcccgggcttgggagtcagaggtcgtgggttctaatcccagctccgccact
tatcagctgtgcgtctttgggcaagtcacttaacttctctgtgcctcagttctctcatct
gtaaaatagggattaagattgggagccccaagtgggacaacctgattacctcgtatcctc
cccagtacttagaacggtgcttgagaaataccatcgtcatcctagagaagcagtaaggct
tagtggaaagagccagggcttgggagtcggaggtcatgggttctaatcctgactccacta
cttgtcagccgagtgattttgggcaagtcacttcacttctctgtgcctcagttccctcat
ctgtaaaacggggattaagactgtgagccccaagtgggagaacctgataacctcgtatct
gtcccagtgcttagaacagtgcttgggatgtagtaagcatttaacaaataccgtcgtcat
tattaggctcagagaagatgtgccattcccaagttagactgtgtaaaatggcttgaaggg
taagaaggcccgcctaaatcgctcctgttccaacctgattagcacgtgcctaccccagtg
tccggcacgtaataagtgctaaataaactctatataggaagtgttgctcctatatagttt
ggaggattttaacaagtaacccattaggggtagagtttatctttttgattctggacaaag
tggacttgccttcctgtggtccgagtagccctcaccctccccgtgtcacccatctctagG
AGACCCGAAGCAGGACCTGGCTTATGAACGCCAGTATGAGCAACAGACCTACCAGGTGAT
CCCAGAAGTGATCAAGAACTTCATCCAGTATTTCCACAAGACCGTCTCAGATCTGATCGA
TCAGAAGGTGTATGAGCTGCAAGCCAGCCGGGTCTCCAGTGATGTCATTGACCAGAAGGT
GTATGAAATCCAGGACATCTACGAGAACAGgtgcggaccccggacggagcccacagccct
ccaagggggtcagtgtggggccgtgctgcctcttgactggatttgccgtgctcctgagat
taccgggccggcaggacaggcaaccagctcccaatctcctcacttatccctctaggaaag
ggaatggcagcatccctcaaaaggaaatggactcactggagaaggccaggaaccattaat
tcccacctgtgtaacccggtgtttagtacagtcctgtgtacatagtgtttagtaaatgtc
agtaccaccagaaggaatggaaattgagtcctttgaaggatggttaaagaaattggggtt
gtttttacagacaactaaataaaaagaaatgggcataaattcagtcgggtgaaatttggg
ttgtatttaagaagggcttcttttcaataaggttccgttgccagagatctttaggaaaca
aaaatagactattatgcttttcaggtggttcagctattcacaggcctggaagcaggggtc
ttggccagatgacgccatctcctctagatctggactcgaatgtatttatcaagagttact
ttgtacagagcagtcagtgtgctaagcacttgggagagttcagtataacggctggaagac
accatccttgtcctcaaggagcttacagtgagaagctgtgaaccccatgtttcttctctg
gtgtctccccaaaacttagtatattgttatgctaaccgtgacttttggccgcatcccatc
ttgtttttagCTGGACCAAGCTAACAGAAAGATTCTTCAAGAACACCCCGTGGCCTGAGG
CCGAAGCCATCGCCCCACAAGTTGGCAATGgtgagttgtagatcaattggtagtagcgtg
gcacagtggaaagagcacgggctttggagtcagggctcgtgagttcgaatcccagctctg
ccacttgtcagctgtgtgactgtgggcaagtcacttaacttctctgtgcctcagttccct
catctgtaaaatggggattaagactgtgagccccatgtgggacaacctgattcccctgtg
cctaccccagcgcttagaacagtgcttggcacatagtaagcgcttaacaaataccaacat
tattattggtagtatttattgagctcttactctgcagaccactgtactgagtgcttggga
gaggttggaacaatagggttggtagacacgaacgatctttgcccacaggaatcttcgttt
catgcacctgcaataaaacggtatttggagggatgatcttagtaccccggctgctgctga
agccccaggcagaccagttctctggagacccagagtggatgaggtgttttcttccagttg
tggtggttttgcttgcgattcccactgatctgggggcctgggaagaatcagttccagagt
cgcacaccaccctaagcttggtgcttagtacagtgctctgcacgcagtaagcgctcaatg
gatacacctgattgattgattgattgattggtctggggtgggagtggtttcaggagcgga
aagtagtcctactcttgaacctgccccgctttcccaccctcctttcccaccctcttcacc
cctcccccgcaaaaccaaggactgggaatgccacttttgtttgaggttggcaagagccca
agtgtatgtatccagacagtgcatttcagagaggagttaggcacttgttagttgggtttg
cccacattctggttgtcccttgttttggggaccaaagagctagcataggtttgggaggtc
aggttgggcccttgagtcctgctgaggcaactgtctccattgctcaaactcaggaggatg
aggccctcgtaagaagaccaaccattcccaccccccatttattttttgtttttgtcaatc
atccaaactaaactcttttttggggggggggggggcggggtttaagaggattgaggtttt
tggtccctggttagctgttgaactttgatgtagtggaagccccagtggctcactttgaag
taggtcgtgagcgttcccctgtagaattccctcaaagccacgtgagtcactaaggttctg
gtctgcactccttttcagATGCCGTCTTCCTGATTCTGTATAAGGAGCTGTATTATAGGC
ACATATACGCCAAAGTCAGCgtgagtatctgccctgctaatagccacttatttgccctat
tattctctgcgtagtgtttttgggggctgactctggggaatccaggctcatggtgaactt
tgacctagttgactttttttttaaatggtatttgttaagcccttactacgtgccaggcac
tgtactgtacagtactgtactgtacaatgcactgtacaggcattgaggttgataccaaga
taatcaggttggacacggtccatgtctcacatggggcacacagtcttaatcctcatttta
ccggtaactgagtcacagagaagtgaggcgatttacccaaagtcacacagcaggcaggtg
atggagccgggattagaacccaggtcctctgactcccagacccgtgcgttagccattagg
ctatgcaggtttcttgagattcctacataaacgcggttctggaaggccagcggcaaagat
atttctgccccgggcagtcagtggacatgcgtaacttctgttctaactcccaccttcttg
ttctcttgacagGGTGGTCCGTCTTTGGAGCAGAGGTTCGAATCGTATTACAATTACTGC
AATCTCTTCAACTACATCCTCAgtaagtctgggaaggaaagatgggggcgggcactgacc
ctttccagggcattggtccaaaaatgatgagcttaagaatagccagtagctgctgtggat
ttggggacctccagtacctctttcctagcatctcccaccccggaggctctgggtgccgag
gggggataatgtgacatccctggcttttttttttcctcttcgcacttgacctggtctctt
ctgaacagATGCTGATGGCCCTGCTCCCTTAGAACTGCCCAACCAGTGGCTGTGGGATAT
CATCGATGAGTTCATCTACCAGgtatcttccttcctgccactcgaacccactaggctcag
ccaaggcccagtagattccttatccactttaggctgatggtagtccccagggtttggctt
agtgattttctcctgaggtgtagggggacagggaaaccacgtgactgctcaaaacactgg
gagaacatataggcaggggacacttttcccgctcatttatatcgatctggcatattccta
atgggcaaccttttcaaaaatttaccaaggtttgctacccaagttgaacatcatcccaaa
atgtacaagtagattaaaaaaaacactagcaaagnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnacacgggtgggggcatttgcacacactgcaga
actgggctgagcatctgctctggcactccaaggggtgactccagcccacaaaagtgtttc
tggcatgggttgaatgaagggaccctttgcttgcaccccttgttaaacctattagcacct
ttagtcaaactcgttttccagcagtaacttttgtggttaaacagtgtatttgggtgctga
cctgttgttttctgttccagatcagctggctttaataggaaggccagtaattaccaacat
aagcatagaaagtagctaaaagcacttgtaaacctcctgtgaataaccttcctgagtttg
gaggcagctccagtcaagaggttatggtcacgtcctgggctctggccactgggcccatag
gtgacccttggaccacctcgttgtggctatttctgactcttcacatcctctgcctttatt
tcttcccttctctgtccgtctccctccgtctctctagTTTCAGTCTTTCAGTCAGTATCG
CTGCAAGACGGCCAAGAAGTCCGAAGAAGAGATTGACTTCCTACGTTCCAACCCGAAGAT
CTGGAACGTCCACAGCGTCCTCAACGTGCTGCATTCACTGGTGGACAAATCCAACATCAA
CCGGCAGCTGGAGGTCTATACCAGCGGAGgtgaggtcaggccgggccagggaatggggac
tgattgccgctcgttggggagggtcctgttgagcagaaaggacacttgactggcgagcgc
tatcgagacggcagttttccggggtcgctcagaaggcgggttcgggaggacgggacggga
tgggacggggcaggccggctacctttgcatcctgctgagattggtcatcgtcgattaagc
gcctgcattcttaaaccctcttggtagcgtcgccagaagctgccaagatacgagtgaatg
cgacaggaaactgcagatcaatccagaatgccgggcttggcttctgtggcctggcattct
ttcactaatctgaaacagctggttccgagacggccaccgcgggtagcaggggccgacccg
gttctgggaatttggagactgtggcagtagctgctcaaagaggggtggcatagtttagtg
gagaaagcccgagcgcggaagtcaggaggtctgggttttaatcccccccctgctacttgc
ctgccttgtgaacttgggccggtcactcagaacatccgtgtgcctcagtttcttcatctg
tgaaatggggatttagtacctgttctctctcccacgtagactgtgagtcccacgggggac
gggccgtgtccaacctgtttctcttgggtctatcccggccctcagttcagtgcttggcgc
ttagcaaacagttgagagatatcacgatgattgaagacattgtcccctttctgtctcacc
ctgtagaccgtaagctctttgtaggcagggaatgtctaccagttctgttgttttatattc
ttccaagctctgcacacagagctcaataaatatgattgattgatttatgggtaggagggg
ttccggctttgtccccttatcccccagccccccctgcggaaaacacccctgcatttctgc
ttctgtctgtgcagGGGATCCCGAGAGCGTGGCCGGGGAGTACGGTAGACACTCCCTGTA
CAAGATGCTTGGCTACTTCAGTCTGGTCGGCTTGTTGAGGCTCCATTCCCTGCTGGGGGA
TTACTACCAGGCCATCAAAGTGCTGGAGAATATTGAACTCAACAAGAAGgtaatccaccg
atcccctccttccgagtcgggcttaagggtcggagctgagtagccacaagggcccttaga
gggagtccggttcgtggattttctggaccccttggatctgtgtttagcaggtgtttcatc
agtaattcctccctgggaagtggactggtattatccccatttggtattatcccctatttt
aaggattctcctgtggcgttgccctgggcattatggagagtcagattgaaaggggatccc
tgtccttcaggaatttgtaatcaaagcaggttgaggtgaaagagaactgacgtggatgat
ggtttttcttggagaggagaagaaagattggattttttttattttttttcccctcacaga
ggatacagggtatttttgtgttcttttcatgggtttgtggttgtgggggtggttgggttg
gaacagactgaagtaagcctcagtgacccggagtgacttgaccagaggaagggagagtga
agctgtcgtctactgagggactccaaaaagttcaatctcaccgagccccgttgccttgat
ctggtaccggggctcccaagctcacttttcctggcgggttctccccctacctccctcctc
agAGCATGTACTCCCGAGTACCTGAGTGCCAGGTCACCACCTACTACTATGTAGGTTTCG
CCTACCTGATGATGCGCCGGTACCAGGATGCCATCCGGGTGTTTGCCAACATCCTCCTCT
ATATCCAGAGGACCAAGAGCATGTTCCAGAGGACCACGTACAAGTATGAGATGgtaaggg
gcagctcggggccctactgaccgctcccctcctggtgtttccctgggggccaccctgacc
gcgtctctttctcccgcctcccccccttcacagATCAATAAGCAGAACGAGCAGATGCAC
GCCCTCCTGGCCATCGCGCTGACCATGTACCCCATGCGAATCGACGAGAGCATCCACCTG
CAGCTGCGGGAGAAGTACGGCGACAAGATGCTACGCATGCAGAAGGGCGACCCGCAGGTG
TACGAGGAGCTCTTCAGCTACTCCTGCCCCAAGTTCCTGTCGCCGGTGGTGCCCAACTAC
GACAACGTCCACCCCAATTACCACAAGGAGCCCTTCCTACAGCAGCTGAAGGTGTTCGCG
GACGAGGTGCAGCAGCAGGCCCAGCTGTCCACCATCCGCAGCTTCCTGAAGCTGTACACC
ACCATGCCCGTGGCCAAGCTGGCCGGCTTCCTGGACCTGACGGAGCAGGAGTTCCGCATC
CAGCTGCTGGTCTTCAAGCACAAGATGAAGAACCTGGTGTGGACCAGCGGAATCTCCGCC
CTGGACGGCGAGTTCCAGTCGGCCTCCGAGGTCGACTTCTACATCGACAAGgtgcgtgcg
ccgggccttcccggcggagggggaggcgggggcaccggcttcccgtctctcgcaccagtg
acccgggtggccgaccggagagcgtcgggtcggtcctcagcgttggcagcggcactaatg
cccgccagggcccgagcctggaatttagtagccgtgacagagggagttcacatcttgggg
acccggcctgcttcagtcaatcgcatttatcgagcgcttattgagtgaagtgcactgttc
taaacacttgggagagtacagtacagcagtatgacagacacattttctgcccacaacaag
attccagtccagaggtttctctttcaggtcctctattggccgagttgggttagccccagg
ccctgaaagaggggaaattcccagtacggtctttcagagtctgctctccaaacccaggcc
tttgaatactctgacgcagtttcttttccttcacttgaagctggtagattccttgccccc
gcctgtccagtcccagggcagagcgattgactgtggcaggatggtagaggggtcgagagg
agggggctagccaagtcatgaagcgggatccagattccaggctaaaatggcaccttcttc
aagggacctctcttgtcttcaccccttccctcccaccccggcctgtctgacctggacttc
tttcctcaccggctcctctctctggcagGATATGATCCATATTGCCGACACCAAAGTTGC
CCGGCGCTACGGGGACTTCTTCATTCGCCAGATCCATAAGTTTGAGGAGgtgaggcatcc
cgagggggggatcgatcagcggagggggacaaatccctgtaccagcctggctgccttcct
ggaggagatggaggggggtggcttcggaagtgtttcagctccaggctcctctgtatctct
ggtgatggcctcccgtgggttaccctctcactttcaaagtgtttcccgatgttggctctc
tttttttttttttttaaatggcatttaagtgcttactatgttccagtcactattctaagt
gctggggtagatacaagccaatggggttggacacagtccatgccccacgtggagctcaca
gtcttcatcctcagtttacagatgaggtaactgaggcccagagaagtgaagtgacctgcc
caaggtcacaaagacaaagtggcagaactggaattaaaacccaattcctcctgacccatg
ttcattccactaggccacacttcctctccttctacacttccagctggcagccattctcca
ccagaatctagctggccagttcccatgaggatcagggctcttcacggcacggagaacaga
aagctgttcccgggctccacaggaagctgttgtcgagttccgggctcaccccggcactga
gcaggggcaggatgaagcgagggtcccaactggttttggggggaagcgcttttgggtgtc
tgatagaagtcagcaccccactgtgatcctctcctgcccctgaaacaggccaggccaaca
gcctctcttccctctctaactaaccatctcctttcctcccctctgccctccagCTCAATC
GGACACTGAAGAAGATGGGCCAGAGACCCTGAGTGGGCCACCAGCCATGTCTTCGAGCCC
CACCCGAGTTCAGTGGACACCCGGCCTGTGCTCTGAAATTCCAGCCCCGGACAGTTGCGG
GGCCACTGAACTGGGCTCTGGTTGAGACAAGGACTTGGATATTTTAATAAATCCCAATGT
GAGAGTTCTCTGTTTGGAATTCCATCTGTGTGGCCGgggaagtgagggaacctgctcgtt
ttccccccgacttgtgctgtccacattctgttggtttccaaggcgttctcgggcaggtgc
ccagttgttctaaaacctcagcaccccctttttggctctgacgttcctatgatcctcttc
ctgaccaccttggccagaaatgagagctcctgggccgtggccctatctcctcctcccacc
acccccagcctcctttcctagatcccagccagctctcgctcttttccctttttaatacca
acctccctttcagcagcgcacgatggccagcacttggcaggataagtggatttctcttgt
ctcctcccttggctagccaggggacattgattttggctgatgatttcagcctctcaccct
aacaactctttgaccagagctgctggcaaggggcagagtggctcggggactgccagggaa
ggtaatgctctgcctgggacttgggggtttatctctccctgcaggattggcgtcctagag
aacttgaccccgttcctgctcctctcgtctccagagtacctgtttagctggggtctgtcc
ttagaaagcgggagtgaccagtttcaagttgaagttcaaagatccggtgtgtctgattac
tcaggctcatgcgtttgtgtgtggctggcctggggctcactggccaaagggccagtaaaa
acgtaaccgcccactcggaagcgagcggtggtgcagctttggcatcggggggagggaggc
gggcgggcagacggggctcacctctccctggcactgccggaggaatgtgggcccagcggc
gaccaggactgacttgggatttctctccaggtggtctcgaacggaggttgcaggtttata
atcctcccacgctgtggaaagggaggggaaggctagaaggatccggtagggaagacgggg
gaatcgggctgtagcatttggggttcctgccgagagaaagagaacgggccagttggatcc
tggcaccgggttggtg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1159, 3781..3829, 4679..4889, 5650..5729, 6978..7039, 7572..7641, 7868..7941, 8977..9148, 10094..10248, 10862..11032, 11133..11630, 12328..12408, 13193..13415
1127..1159, 3781..3829, 4679..4889, 5650..5729, 6978..7039, 7572..7641, 7868..7941, 8977..9148, 10094..10248, 10862..11032, 11133..11630, 12328..12408, 13193..13231
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved