Ornithorhynchus_anatinus Locus Mono:SNORA57
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA57
Ornithorhynchus_anatinus
Mono:SNORA57
Ultra719
SNORA57
1001..1149
2149
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAATCAGAGCTC
GGGAAGGGGGGGCGAGAAACAAATGAAAAAAAGCCCCTCTCGGACCGGCGGGCGGAGGGG
GACCAATCAGAGTCATGCAGTTGGGGCAACGGCGGCTATAGGAAAGCCGAACATCCCGCC
CTAGGGAGGGATGGACCAATCAGAGCGGGGGGGCGGGGAATAAGACCAATCAGAGCGGAG
GGCGGAGCCTAGGACCAATCAGAGCGGGGGGCGTGGCCTGGGACCACTATATAAGGTGTC
GTTGCGGCTACACTCCGTCTTTTCCCCTCCGTGCGCGCTGGAGGGGGGCTGTGCGGGCGG
TGAGTGACGGGCGAGGCAGGGCTGCGGGGGTGTTTGTCGATCCTCTATTTCTTGGCGGGG
TCCGGGTGCGCAGTCCCGCTCCCTGTGATGTTCGGAGGTAGAGGGAAGGGGCTCCGGCCT
CCCCGGCGTTATGTCTTCGGTCCCGGTGGCTGCCCGTCCGCCGGTTCTATCCTCACTCGC
CGGGACAAGCGGCTCCCCGGGTCTTGGCGCGGGGCAGACCGCCTTTCTCGCGGCCCTCAC
GCCTTCTTCTTATCTTTGCAGGCTGCCGGGAGGCCGAAGAGTTGGACCTAGGCGACAGCC
CGCACTCTTCCCGTCCCATCTCAAATAAAATATCCACGTTCTGGACTTTTCTTGTGTCTT
TTCTTTAGGGGTCGGGTTTTGGGGGGGCGGGGATGGAAGAGGGAGCACGGGCCCGCGCTG
CCAGTTGTGACGTTGGGCCAGTTCGCTCCTGAGCCTCGGGTTTCCTGCGCTGTAAAATCG
GGATTAAATACATTCAGTCGCGTTCATCGAGCTCTTCATGTGTGCAGAACACCGGACTAA
GCGCTTCGAATGTACAGTTGAGCAACAGACCATCCCTGCCCAACAGCGGGCTCAGTCTTC
CTCCCTAAACTGTAAGTCCCACATAGGACAGGGCGTGTGTCCAATTTGTACCTTCTGAAG
CACAGGGAACAGTGTGGGACACGTAGTGCGCCCTTAGCAAATGCCATCAAAAGGACTGGA
CAACTAACTATAGTTATTAAGCGTTTACTGTGCCTAGCGCTGGGTAGATAATAAGGAAAT
CACATTGTTCCTCGTGAGGCTCGCAGGCTTAGTCCCTATTTTGCAGATGAGATAGGCCCC
GAAAGGTGAATTGGCCTGCCCAAGGTCATGCAGCGGACAAGTGGCAGAGCCGGGATGAAA
GCGAACGTCCAGTGACCTTGTGCTCTTGCTACTAGGTCATGCTGCTTCGCTAGGCGCGTT
GTTATCGCCTCAACGTGCCAGGCACTGTACTAAACGCTCGGGTGGATGCAAGCAAATCGG
GTTGGGCACAGTCCCTGTCCCACCTAGGGCTCCCAGTCTCAGTCCCCATTTTCCAGTTGA
GATAACTGAAGCACAGAGAAGTGAAGCGACTGGCCCGACGTCCCACAAGTGGCCGAGTAG
GCATTAGAACCCATGACCCCCCCCCGAATCCCGGGCCCGCTATTTACTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved