Ornithorhynchus_anatinus Locus ENSOANG00000006440
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000006440
Ornithorhynchus_anatinus
ENSOANG00000006440
Ultra707
SNORA3, SNORA3
2145..2277, 3133..3267
4866
GGATGAATGGATGAAGGAACGAATGAATGAAGGAAGGAATGGATGCATGAGGGAAGGAA
GGAAGGAAGGAAGGAAGGAAGGAAGGAAGGTAAGGAAGGAAGGAAGGAAGGAAGGAAGGA
ATGGATGGATGAACGAATGAGGGAACGAATGAAGGAATGGATGGATGGATGAAGGAACGA
ATGAATGAATGAAGAAAGGAAGGAATGGGTGGATGGATGAAGGAACGAATGAATGAATGA
AGAAAGGAAGGAATGGATGAATGAAGGAATGGATGGANNNNNNNNNNGACTTCTGACTCC
CAAGCCTGAGCGCTTTCTGTGTGCCAAGGATTGCGCTGAGCGCCGAGGGAGATACAAGGT
GACCACTTTGGCCCACGTGGGGGCTCACCACCTTAATCCCCATTTTACAGATGAGGGAAC
CGAGGCCCAGAGAAGCAAAGGGGCCTGCCCAAGGCCACACTGCAGACAAGTGTCGGACCC
AGGATTAGAACCCACGTCCTCTGACTCCCCAGCCCGGGCTCTTGCCACTGAGCCACGCGG
CTTCTCATAATAATTGTGGTGCTTGCAAAGCAATTAGTATGTGCCAAACTCTGTTCTAAG
CACAAGGGTAGACGCTTGGTGATCAGGTTGTCCCACGTGGAGCTCACAGTCTTAACCTCC
ATTTTGCCAATGAGGTCACCGAAGCCCAGGGAGGTGAAGTGACCTGCCCGGGGTCACATG
GCAGACAGGTGGAGGGGTCGGGATTAGAACCCACCTCCTCTCGGGCTCTTTCCACTGAGC
CACGGGCTTCTCTGGGTGGACGAGGGAGCCCGAGGCCATCGTGGCCTAGCCGGGAGCATC
TCCTCCCGCGTCGGGTCCCCGAAGGAGGCAGAGTAGATCGAAAGTGAGCGATCGGAGTCG
GAAGGATCCGTTGCAGCCCAATTGAAAAGCGACCTAGGGGTGGGGGCTTAATTGAGTTCA
TTAAAGCACCTCTTTTCTCCAAGCACCCGGTTCTGGTTTTCCTAGGCAAACACAGGAAGC
ATCCCGGAGGTCGTGGGAATGCCGGAGGGTTGCACCACCACCGAATCAACTTCGACAAAT
AGTAAGTCCTTGATGTTGGAGGTTCTTTAGAGTGTTTCTTGCCCACGAGGCAGTCTACCA
AATGGGTGGCATTCTGTGTCACTGAGGGTGTTTGGGCTGCCACTAGCGACTCTTTTATTT
TGGTCCTTGGTAAAGCCCTTGGATTTGTGTGTGCCAAGCACTGGGGTAGATCAAAGATGA
TCAGGTGCCACCTGGGGCTCACAGACTCACGTAGGAGGGAGAACAGGGATTGGTTCTCCA
GTTTTGTCGGTGAGGGACTCTGAGGCACAGAGAAGTTAAGTGACTAACCCAAACTCGAAT
TAACAATACTAATAATAATGTTGGTATTTAAGCGCTTACTATGTGCAGAGCGCTGGGGGA
GATACAGGGTGATCGGGTTGTCCCACGAGGGGCTCACAGTCGTAATCCCCGTTTGACAGA
TGAGGTCAGTGAGGCACAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGACAAGT
GGCAGAGCAGAGATTCAAACCCATGACCTCTGGCTCCCGAGCCCGGGCTCTTTCCACCGA
GCCATGCTGCAGTAGTATTTATTGAGTGCTTACTGTGTGCAGAGCACTGTACTAAGCGCT
TGGGATGTACAGTTGGGCAGCAGATAGAGATCATCCTTGCCCACTGACGGGCTCTCAGTC
TAAACGAGGGAGACAGCAAAACAAGACAACATCAGGCTAAGTAGAATCAAGGAGCTATAC
AGCACATTAACAAAATTAATGGGGTAATAAATAATATAGACAAATGAAAAAATATATGGA
ACGCGTAGCAAGCGAATGGCAGAAGGCAGAATTAGAACCCAGCTCCCCTAGTTCACTTCG
GTTCTCAGGGTGAAAGGTAACGAGAAAGTTCCTTTCTTAGAGTTAGTTGCCCTGCCACCC
CCTTGGGAATGAATGGCTTGCTCCTGGGGTTCTGGAAGATTCCAGAACCATCTCTAGGTT
TTGCAGGGTCGGAGAGATTGCCGATCTGTAAATGTATCCGGTGACTTTAGGCGCTCCAGA
AAAGTGGTCGCGACAACAAAAAGTTTTGTGTGATTGGGGCTGAAACTCGAGACTTAGAGT
CACATCTGGATTACTTCCCGTTGCCGTGGTGTGCTAAAGTCCTCGAAGAGTAACTGCTCT
CTCTATTCACTGGCTGTTCGATCTCGTGGTGCAGTCAGTCACCGGGTTAGTAACATCGGC
TTACCTGGGAGGGCATTTTGTGGGAATTGAGTCATGCGCGTGTCTTTGTAGCCGCTGACT
GCGTGGTGGCTTCGGTGGAGCTGTGTCAACAAGGCGATAATTTTCCCTACTTTGTGTTGC
GCTTGGCAATGTTGTGACAGTGAATCAGAGCCGGCTCTGGGTTCATTCAGTCGTATTTAT
TGAGCGCTTACTATGTGCAGAGCACTGTACTGAGCGCTTGGAACGTACAATTCGGCAACA
GATAGTCAATCCCTGCCCAGTGACGGGCTCACCGTCTAATCGACCGTAGGCCTTCTGGAT
TGTGCCTTCGGTCTTGGAGTGAATTTTGATCCAGACCCTCCGCCCTACTGGCTTCATCTG
CTTTAGGGGATCATCACTATCATCCCGTGGTTTGCTGGGCAGCGTGGGTCCTGCCGGAAA
AAATGGCTTCCACACAGTGCTAGTCTGGAATTATTCATTCAAATATTTCTTTTTAACTTT
ATTTTCCATTCCATTAGGCGGTTTGGGCTGCATTTCCATCGGGAAGGCCTAAACTGCCCG
ACCCGTTGGCCAACACTGACCGTTGCCGGTTTTTCTCCCCCCTTCCCTCCCCCAGCCACC
CCGGTTACTTCGGGAAAGTTGGCATGAGGCATTACCACCTGAAGAAGAACCAGAGCTACT
GTCCCACGGTCAACCTCGATAAGCTGTGGACCCTGGTGAGCGAGCAGACGAGGGTCAGCG
CCGCCAAGAAGAAGCCGGGCGTCGCCCCCATCATCGACGTCGTGCGCTCGGTGAGCCGGA
GGGGCTGGGTTTTCCGCAACCCTTCCTTCCCGGGTCCGGGCGGGAGGCGGTCAACCTGGA
AATCGGTCTTCCCACCGAGACTAGAGTCACATCCTGACACCGTTGGTTGTCTTGGCGTGC
TAGAGTCCTCGCAGAGAATCCCCCTGCTCTTTATTCACCGGCCGAGGGCCGTCCCGTGCC
TCGGCCGGTCACCGGATCGGGAACATCGATTTGGATTTCTGGTGGATGATGGTGTTAATT
GAAAAATGGATTTCGAAATCAAATCACACTAATGCTTAACCAGTGGGTGCTAGTTAGTGA
GTGCCTAGTGTGCGTAGAGCACTACATTAAGCACCCGGGAGAGAACAGTAGAAGGCAGGT
GGATTAAAGGCGTGTCATTCGTTTTCCCTGCTGTCTTCCAGGGTTATTACAAAGTCCTGG
GTAAGGGAAAGCTTCCCAAGCAGCCCGTCATCGTGAAAGCCAAGTTCTTCAGCAGGAGAG
CCGAGGAGAAGATCAAAGGTGTCGGCGGTGCCTGTGTCCTGGTGGCCTAGTTGTTTTTGA
CCGGGAAATAAATGTTCTTTATTACGAGTCCAGAGATTCTGATGTCCTTCGTATTTTACT
GGAAGACTTTCTGAATATTGCCCGGTGGAAGTGTGGGACAAGGCGGGGTGGGGGGAGGTG
TTCTGAACTAGCTGTCGGCCACTGGGTTAAAAGCCCAGTGATGGTTTTTAGGGTCACACT
TCCTCACATGGGGTCAGGTTCTAATATTAGTGGGAGCTAGGTGGACTTGTTCTTTGTGGA
ATCCGCCCGATTTTTCAGCAGTAAAATGGGACCGTAAGTACAGTAGTCTAGCACCGTAGT
TTCATTTTTGAGCAACTGTGTATTGAGGCTCTGGGGGGTGGGTTTTTGTTCCACACTGGT
TTCCAAAAAGCCGAGAGAGGGGAGCGCTTCAGGCCACCTGGCAGTTCTGTCCTTCACAAC
CGACCTATTTACTTCACCCCAGGATTCATTCATTCAGTTGGATTTATTGAGGCCTTACCG
TACTTGGAAAGTACAATAAAGCTACAAAGAGAGACAATCCCTGCCTACAATGGGCTCACA
ATCTACGGGCCTGAGGGAGGGGGGATGATCCCCATCCCCACCAGCCAAGGACAGATAATT
TTTTAGTTAGCTCTTCAATACTTGTTCTTAAATGTGATATTCCTCCTCTTCAGCTTTCTA
TTTTCCCTTCCCTTAAGACTCGACGCTTGAAGACTACTCGATAAGAGCTTCGCTCACATC
AAAGTCCCGGTTCTAAATGTGGCACGCCGTCAGTCGTGTTACTGCGGAGTGTTCACGTCT
TATGCTATAAAGGGCCGGATGGGAGCTCGTCACAAGCCGTTGGTGTCCGTCGTAATGTTT
TGGCAAGTGATTTAGGGTATCGGACTGGAGCGATAATCCATAGTTTATCTGAATCTCGGT
ACGGTGGTAAGGATTCTGGAGTTGGAAGGGGCATCACTTCGGATGCCTGAACTCCCTGGG
AGAGTCTGGCTTCTCAAAATGGAGAGGGATCTTGGAGAAGACTTGGAAAAGGGATGAAGT
TAGATCGGCCGACTTGCAGTGACGGCGCAGAATGTCGGCCAAGTTTTCTCTAGGAAAGTC
ATTTGGCAATAACTGCCGTGGATTGGGTAGTCCAAGCGGGCGACTGGGAAAAGTGGAACA
CGCGATGCCTTCCGGGTGTGGAGAGCGTCTCACGGGCACCATGGGGCAAAGGATCGGACT
TGGGGCCTGTGGGACCGGGCCACCGTGGGCTGGCCAGCACCGGACCACGCAAACGCAACT
GCTGAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 2875..3049, 3461..3866
1001..1080, 2875..3049, 3461..3589
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved