Ornithorhynchus_anatinus Locus RC3H2
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RC3H2
Ornithorhynchus_anatinus
RC3H2
Ultra707
SNORD90
9567..9678
26051
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCTGTGGTGGATTCATTCTGAACTGGATGCTATTTTGTTATATTTATTTCCC
CGAAAGGCAGTTAAACGATAATCTGGGCCATTTGTAGTACGGGGACCAGTGGCATTCAAA
AAAGAGGACAACGAGGCTGGCACGGGGCTCCCTGTCAGTAGGGGAAAGGCAGGGATAGTT
AAAGACAGTGGTTCTTCCTTTAGACCCCCAATTCCCTCCTCCCCCCCAATCCCCTGAGTG
ATATGCAGGAGTAAGGTTTTACTGCCTTTGCCTCCCCGCCCTTTCCTGATGCAGTCTGCA
GAGCCTAGGACTTAAAACTCTAGTCATCCCTCCCTCCCACCCTCTCTTGCTTCCTCCTCC
CACCTCTGTCCTGTGCAGCTGTCCTGAGGCAGGGGCGGCGTGGCGGGGGGGAGCCCTTCC
GTGACCTCTCTGCCCCTCTCGGAGATGACTCCAAAGAGCTGCTGCTGGATGGGATGGGAT
TGGAGGGCCGGGCAAGGAGAGAGGCAAGAAGACTCCAGGGGCTTAGAGAGGTGATCACTT
CCACCCTCCCAATGCCATTCTGCCCAGAGGTTGATGCCCAGATATGCTGCCTTCTGGGGG
ACCACTCATTCTATGGCATGGACAGATGACTAAATTTTACAAAGTTGTCTGTGAACTAAA
CGGTCTCTGCCCTTTTTCTTCAAATCAAATATACAATATCCTACACATTCAGGCAAAGGG
AACTGTAAAGGCCAAAGAAAGAGTTAACTTTTAGGACATTAATTTTGGTTGGTCAGTAGT
TTAAGCTTTGAATTTATGCATTGGATTAATTTAGAAGACTTTTTGACTTTTTCAGGCTCA
ATTTTACTCTAGTACAAAGTATGTATAGTTTACCGGGCAAAAAATGTCAGCTTAGCTATT
TTAGCTACCAAAGTCATTAAAATTGATTTTCACATCTTGTTAATTATGAGGGTATGGAAG
TAATTTTTGTTGTTGTTCATTTCCAGCTTACAAAACACTACACAGTGAAATAATGGTCTG
CTAGACTACTACCCAAGCGTCCAGCTTCCATAATGCCCGTGCAGGCAGCTCAGTGGACAG
AGTTTCTGTCCTGCCCAATCTGCTACAATGAATTTGATGAGAACGTACACAAGCCCATCA
GTTTAGGATGCTCGCACACCGTCTGTAAGACCTGCCTGAATAAACTTCATCGCAAGGCAT
GCCCTTTTGACCAAACTGCCATCAACACAGACATTGATGTGCTTCCTGTAAACTTTGCAC
TTCTTCAGTTAGTTGGAGCCCAGGTAAGACTTGACCCTGAGTTTATCTTCTCAAAATGTA
TAAGCATCGCTCCCTTTCTCTTCATTTCTGTACAATCATAAGGTTCCGTGTTTATTTTTT
TTTTTAAAAAAAAAGTCCTCAGGGCTTCACAACACACTCCATTCTTTATCGTGAGTTTTG
GGTAGCGCTCAGTGGCTGAGTAAGGGAATGGTCTTCTGACGGTGCACATCTGTTTGGAAA
GAACATGATGTGCAGTCGGAATGGCTGTGCACTGGTCAAGCCTCGTGTACCATGGCGCAG
GCTTTCTTTAATGCGGAGTTTGTTGAGAGTGTAACCTCGGTGTTCTGGGAGAAATCGAGT
GTATATTGAACCCTTTTCATATCAAATTTGCTTCCAAAAATCAGATTGTACCTTCAGAAG
TAGGCCTTGCAGTAAGAGCTAAGAGTGTTTGTCATCTTATCTAACATGCCGATATTTCCT
CTGATGCGATTTTCACTGTGTGGACCAAAGCTGGCCTGCACAGCTGGTTCCTCTCTTTGA
ACAGAGCACAATTTGCAAGGAAAGGGAAAGGGGGATGGTAGAATTGCTGAAACTCCTCTA
TTTCAGGATTGCTAGCGGGTGTCTTGCGAACTCCCTGGACATCCGTGCAGCTTGGCAGGA
AAATGGTTTGGAATTTTTAGGCATACCAGCATTAGCAATTTCACTAGCTGGAAAACTAGT
GTGATCTCACTTTTAATGTGAGAGGCCTTAAAATGCTTGGAAACAATAGATCCCATATCT
GGTATTAACTTCTGTAAAACCACTACAGCTTCTCGGCTCAAAATTCAAAGGGCAGTAGTA
TTGTTGGGGATGCTCAGATTAAGATACTGTACAGAAAAACTGACCTCTGCTTTTCCTGTG
ACTTCCTTTTTAGGTACCAGATCATCAAACAGTAAAATTAAGTAACCTGGGAGAGAATAA
ACACTATGAGGTGGCAAAGAAATGTGTTGAGGATTTGGCACTCTACTTAAAACCACTAAG
TGGCGGAAAGGGTGAGTATTTTAAAAAGCCATGATTGTTTTATTGAGTAATCCTTGAATG
GAATGTGTTCCTTGTGGAAAGACATCGTAAAGAGAGAGGGATGTGAATTTATTTGAGATT
AAAATGCCTGGTAAACTCTTCAAACTTTCTGATTATCCATTTAAAAACTAGTTGGCTTTT
TTTTTTTTTAAGAATAACCAATATCTTTGTTAACCAAGGAGAAACTCACCCTTCAAGTTA
TATGAAGTTGACTAACTAGTCATCTAATTGTTTGATTTAGCTTCTTGTGTAGCCAATTTT
CAGTTTTCCATTTACAGTTGCTGGAATAGAAGACATGTTATTAAATCAGTGCCGGGCAGA
TTTGTATTAGTTATTGGTGTAGATTATTCCTGACGTTTACTATGTGCTTACTATGCCAAA
GGCAATATACTACATCCTGGGATAGGGAAGCTCACATTGACTCGTCGCATGGCTCACAGG
GGGCTCAAAGTCCAAGTTGGAGTAGACAGCTCATATAAGGGAAGGATGTTATAGTACCCC
ATTTCAGACAGGTTCCTGTAAAAGAATGAAAACTATAAATGGTAATCATTCTGTGAACTA
AGCAGAACTCGGAGGGGCCTTCCATGAGTACATCCTTGGTTGCCACAACCTTCCCCGTGT
CCCGAGAGGTTAGAGGACGAATTTCTATCCGTACCTCGGTCCTATATGGGTGGGAGAGCT
TCACTCCCACGATGATCAGCGGGAGTGGGGAGACTGGTCTGGGTCTTGTGGCTGTGGGAC
TCCAGGCTTCTGCTCACCCTGCTTCTGCAGGGTGGTGGGCCTTCATGCTCAGGGTGGTTT
TTGGTTTTTGTGGTATTTGTTAAGCACTTACTGTGTGCCAGGCACTGTTCTAAGCACTGG
GGAAGATACAAGCTAATGAGGTTGGATCCAATCCGTGTCCCACATGAGCCTCACAGTCTT
AACCCCATTTTACAGAGGAGCCTGGCAGGGAGAGGAAGACTGATCCAAACAGTGTGCGTC
TCCCAAGCTTCAGTGGCTCCCCAGTTTAGACTGTGAGCCCATTATTGGGCAGGGATCGTC
TCTGTTGCCGAATTGTACATTCCAAATACTTAGTACAGTGCTCTGCACATAGTAAGCGCT
CAATAAATAGTATTGAATGAATGAATGAATACTGTTCTCATTGCTCTGGGTTTCTCTGGG
TATCTGAGCTTGGGTAGTTCATATTGCTATAATTGGGACGATACTTAATAGGTCATTTTT
TTAATGGTACTTGTTAAGTGCTTACTATGTGCCAAGCACAGAACTAAGCACGGGAGCAGA
TATAAGGTAATCAGATCGGACACAGTTCTTGTCCCATAGTAGGAGGGAGTAGGGGTTAAT
CCCCATTTTACAGATGAGGGAACTGAGGGACAGAGAAATTAAGTGACATGCCCAAGGTCA
CACAGTCAAGTAAAAGAAACAGCATTTGAACTCAGTCCCACTTGACGCCCAAGCACTTTC
CACTGACCTGGCTCCTTCCCTAGTAGATTGATGGATGTCTTATTTAGCTTTATGCAATCT
TCCCAGGTCCAGGCGTGTCCTGGAGGCCACCAAGATTGATTGACTGGGCTCTTGCTGGGC
CCAAATGGCCTGGTCCTCCCACCCTCAATTTTGATAAAGCAGCCTCTCCTGAACAGTAAA
ACTGTCTTTCCTGCAGTCAGCAGGTGCCTCACCTGCAGACTGCAAAGGATCCCTTAGTGG
AATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTTCTCAATCCCAAATCTTTGCCTTTTCATTTTAAGCCCATCTCTGCCTAA
TTTGTAATTTATGATATGAAGAACATCCTCCTTGGAATAATAATAATAATAATAGCATAA
CCACCTACTATTTGCCAGCACTGTAAAGCACTGGGGTAAATGACAAGATAGAACACTGTC
CCTGTCCTGCATAGGGCTCACAGCCTAAGAAGATAAGGAGCTCTGAGATCTTATCCCCAT
TTTGCAAATAAGGAAACTGAGGAACAAAGGGGTTAAGGGATTTGGTGGGAGCAGAAGTAG
GAGCCATGACTCCTGACTCCCAGACCTTTCCTTTTTCACCATAAATGGTGATAGCTCCTG
AAAGCTACATGCTTCCTTGGAAGCAAGTTGACCAGGTAAACTCTGGAATGGAATGGGAGT
GTTGATCGTCAGAGTTCATTTGGAATTTTCCAAGGAGAGTGTTTATGAAAGGGCCATTAA
ACAATAATGTCTCAAAGGATATTTCCTTGAGATGCTGATAAATTTTCCAAGCTGGCATAG
TTAAACATTCACAGGGAAAACCTCTTGTATTCAACTTTTCCTAAAAGGCTTGGTTTCTCT
TTTTTCCCCCTCCCTCTCCCTAAAGGTGTTGCCAGTTTGAATCAGAGCGCACTGAGCCGT
CCGATGCAGAGGAAACTGGTGACCCTGGTGAACTGTCAGTTGGTAGAGGAAGAAGGTCGC
GTAAGAGCCATGCGAGCAGCACGCTCCCTCGGAGAGAGAACTGTAACAGAACTGATTTTA
CAGCACCAGAACCCTCAGCAGCTGTCTGCCAATCTGTGGGCTGCCGTTAGGGCTCGAGGA
TGCCAGTTTCTAGGGCCAGGTAGGAGTCCTCAAACTCAACCGGTTTTATCCCTTTCTTAG
GGAACACAATTCCTATCGGAGGCAAGGGAAACATTTTCCAAGGAGGGCAGAGGAGTTCTC
TCTCTCATAGGATTATAGTGAAGTGATTTTCCTTGTGCTCTTTTTGAGCAAATCGGCTAA
GCCCCTATTACGGCTACATGAGTTGTCTAATTAGTTTGCTCAAGCACATGGGGAACGTAA
TGTACTGTATTCATTTGCAGTCTTTTTAGAGAGCAGCTAAACCCAAGCAGTGTTTAGGTG
AAGGTTGCTATATCTTTGAGTTTTTCTCCTCTTTTCTCACTTTCCCTCACACTCTCGCTT
GGCAAACACTCTCCAAAACCTGATGGATTTTTCAGTAATTGTGTTGGAGAAGAAAATTGA
GGGTTTCATAATAGTAACTGGAGGGTATGGATGATGGGAAAAGTTTCTCAATGAGTAATG
CTTCCTTAGTCCTTACCGAGAACCTAAAGGATGGAATGAAGACACAGAAGGCAGGTAGTG
AGGAATCAGAAATGCATAGGTGCAAGGGAAACTGAGGCCTGCAGCTATCAGGGCAGAGCA
AACCAGCAGCCTTACAGTGTGCCGGGCACTTTAGTAGCCCTCTCTGCCCCTGCAGCCCAG
ATGGGACTGGAAGTGGAACAAAATATTGGTTCCTCCTATTGCCAAACTTTGCCCAGCAGA
GGGTCATTGGCACCATGGCTTGCCTCACCCTCACTGGGCTATGAGGCCGGGCCAGGGAGG
CCCCTCCCATCCTTAGCCCCGAATCCCACGAGGATGAGTCAAGAACTGAGGCTCTGAAGC
CATCGTGATGGTGTGAGCCTTTTAGGGCCACAGACTCTCCGTACCACTACCCGGCTTTTA
GTCATCACCTACTTCCACTTCAGCCTAAGCTGGGGAGTGAGGCAGAAACCATGCAGCTGC
TGTGGGGCAGCGAATGAGTAGCAGGGAAAGATTATATCTTTACATTCCTCTCCTTTCCCC
TCACCTTTCCCTTTTCTTCTATCTCCCTCTGACTCCTTTTCCCTTCTCTCCTTTGGCTCC
TTCCCCTTCATTTCTCTTCTCTTTCCGCTCTCTTCCCCACCTTCCCCTCTTTTTTTCCTC
CCTCCCCATCCTAGTAATAATAGTAATCGTGGCGTTTGCAAAGTGCTTACTGTGTGCCAG
GCACTGTGCTAAGTGCTGGGGGTAGATAAAAAAGCAAATTTGGTTGGTCACAGACCCTGA
CCCACTTGGGGCCCCCAGACTTAATACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTGTGGTGGATTCGCAAGGCAAATGGCAGAGCTGGAATTAGAACCAGG
TCCTCCTGCATCCTGGGCCCGTGCTCTAAGCTCTTGGCCCTCATATCTTCCTTGATTTTC
TTCCCTTTCCTTCCCTTCCTCTCTCTCACTCCCCTTTATCTCAGGGCCCGACCCCTTTGT
TAGTCTGCCTCTCTGCTCATAATGAAAAATTGGCCTCCCATTGACATAATTAGCTCCAGC
TTCTGTTTAATGACAGCCAGGGCCTCAAGATTTTGATTAAATATATTCTCTATATCACAT
GTAACACTCGGATCGTTGCCCAATTATTAGATAATAATAAATGAACCCTTATGGAGTGCT
AGTCAGTTTAGCTTCTGGATTTTCTTCTGTCTGCATACATCTTGAAATTTCAGCGTGTGC
TGCCCTATCGTGGTAATTAATTCCTAAGTATTGTGGCTATTTCCAGCTATGCAAGAAGAG
GCCTTGAAGCTGGTGCTACTAGCACTGGAAGATGGTTCTGCTCTCTCACGGAAAGTTTTG
GTACTTTTTGTTGTGCAAAGGCTAGAACCAAGATTTCCACAGGCATCAAAAACAAGCATT
GGTCATGTTGTGCAACTACTGTATCGTGCTTCATGTTTTAAGGTAAAATGCTTAGATTTA
AAACTAAGACTTTGTTTAGTTTAAGACTGAAAGCTTTGTTCCCCACACATCTCCCCTATC
CTCAAGTCATCCACTAGTTGCCCATCCCGCTCCACTTCGAGGAAAAACCTCCTCACTGTC
GGCATTAAGGCGCACTCGTTCACCTCTCTCCCCGCTCCTTCTCTTCTCTCCACTCATAAT
ACAACCCAGCCTGTACAGTTCACTCCTCTAGTAGCAGCTTACTCACTGTACCTCTCTTCT
CTCTCTCTAATCGTCGACTAAAATCACATCTCCAGGAAGCCTTCCCTACAGTCTCTCATC
TCCTCTCCCTGTTTCCCTCTTACCGCATCCCTATGCACCTGAGTCCTTACCTCCTACGCA
CTTAGGAACTCACCCCGCCCCATCGCCCCACAGCACTGCCAAATAGATCTTTATATTCAG
TTACTTCCCCTAATTGTAATTTCTTTGTGTCTGATTCCCCCATTAGATTCTAAGCTCCCC
GATCAAGTCTCATATTTCTGTTGCACTCCCTCAAGTGTTGAATACGGTGGTCTGCCCAGA
ATAAGCATTCAGTAAATGCAATTGATTGAAAATGATATGTTAAATTAGGGAAAAATTAAG
GGAAGTATGAATTCTTCCCGCAAGATGCTATCCAGTTCATGGATATTTGAAAATGGAAAG
CTACATTAGAAGCTAATTCACAAAAAGCAACCAACTGGCCAGTCTCTGACACAGGAGGGT
GGTCACCATTTAGTTCTTCCATTTAGGTCTTCTAACACTTCTCATTTCCAAAATATTGTC
CAAGAATATTGACCCTATTTGCTAGCTGAGGAATTAAAGTACAAGATTCTGGTATTTCTG
ATGTCACTGATTTTGATATGCCAATTTCAGTAACATTAAAGTCAGAACCATCATAATGGC
TGTATAGCATAGTGTTTCTAAAGCATGGAATCGTCTGAAATTTGCATTCTGATCTTTGCC
ACCAATTGTGAAGCAAATCATTTTGGGTCTTTGACCCCTATTATGTAAAAAAAAAAAAAG
TTCATATGTGGTGATCCCTTGTTTTCTTAAAGTTGGGGCACTTAGAACTTACCTTCACAA
TGATTGTAAAGTGTGTGCCGAAATTCGAACCCAGGTCCTCTGACTCCCAGACCTATACTC
TTTTCACTGGTACGCTCTGCTCCTTGAGCACATGACGGGCCTGTGCTTTTTTCAGAAAAG
AACCAAACTTCTCTATCATTACATTTCATGGAAAAGAACCATGTGACATAGACATTTTTT
GTCCTGGGGTAGATCTTTTGGTTTCTTTAGCTTGTTGTTTAATTACTGTCATATGAGAAG
GGAGGGTATCCTAGGGGAGAACTCGTCATAACTTTCTACTTGCAGCCCAAAACTGACCAA
GTTAATGCTATTCATGGATTTTTTTTTTCATTTATTTTTTTGTTGGCTGTACCCATAGCC
ACTTCCATGGCAGTGACAGCCAGCCTTAGCAAAGCAGCAGCCACAACCCCACCTCTTCAG
TGTCTGGCTGGCCACCTTGCCCGCCGCCAACACCAGAAAGCCTGAATAATCCGGAGTTCA
AAATAAACTTTCCCATGCCTTAAATGCAGCCTCCATTGGGTGCAGATGGGTAATGATAAT
AATAATAATAATTCAGGTATTTAAGCACTTACTGTGTGCCAGACACGGGATTTTCTCTAA
CCAGTTCCCCTTGAAGATTAAGGGATTCCTGTACTTGAAACATCAGCATTTGGGAGTGTC
TTGATGTTTCAAATTGCAAATTAATTTATCTCCTTTTATTAGGTTACCAAAAGGGATGAA
GACTCTTCTCTGATGCAGCTGAAAGAGGAATTTCGTAGTTACGAGGCTTTGCGCAGAGAG
CATGATGCACAAATTGTTCACATTGCTATGGAAGCAGGACTTCGTATATCACCTGAGCAA
TGGTCTTCCCTTCTTTATGGTGATTTGGCCCATAAGTCACACATGCAATCCATCATTGAC
AAGGTTGGTGAAGTCAGAGGCTGTTCTTTTCCGGAGATATGACCCACCTTGCAAATGGAT
AATTAGGTTGGCCAATAGTTAACTAGACCCAGTTCTTTTGTAAGACACATTTTACTACAA
TTTTGAGTAGAGGGCAATTCGGGAATTAGGGAATGTTCTTCCCATCACAAGCATCTGTCT
GGATAGCAGGTGATTGTGGTTTTGGAAAAAAAGGACATGTGCTTGTGTGCAGTGCTAATT
AAGGAGCTGGTACTCTGGCAGTGTTCACCTGAGAGTTTATCAAAAATATGCCCTCATTTA
TATAATGAGGATATTAAATATCCCTTCAGTGCATGATTCAATACTTTGAAAGATGGCAAT
ATTTTATAGAAGCATCAGACTAGAATGAATTAAAGTGCTAAAGTGTCTAATGATGAGGAC
TCATAGGGCAGATTCTGAGGTGAGCACTGAACTCATCACTGATAATTGTTTGATGCGATC
TGAAGACACTTGAAAGTCTGTGTTGAGGAAAAATGCGCAGAAGAATTTTGAAAATTGGCA
GACCCCAGGTAAAAGAGCAGTTCTTTGATTTTGATTTTTCAGCTCCAGTCTCCAGAATCA
TTTGCAAAGAGTGTCCAGGAGTTGACAATTGTCTTGCAGCGTACAGGCGATCCAGCTAAT
CTGAATAGACTGAGGCCTCATCTAGAGCTTCTTGCAAACATAGATCCCAATCCAGGTAAG
GGATGAAAGCCTTGATTTTCCCCCCCCCCCCCATTTTTTTGTTCTTGCTCTTCGAAAAAT
TCTGTGTTAACGATATACTTGAGCTATTTCTAATGTTGATTGCACTTCTTATGGTTGTTC
TTAGACGCTGTCTCTCCAACCTGGGAACAGCTAGAAAATGCAATGGTAGCTGTCAAAACA
GTTGTGCATGGGCTAGTAGATTTTATACAGAATTACAGTAGAAAAGGCCACGAAGCACCA
CAGGTATGCGTATTGTTTATTACTTATATAAATGCTAACAAAAGCTTCTTTATTACTGTA
TTCAAAAGTATGTCTCAAGAGCTTCTCGGCATATGGTGCTGGTCTTAGGGGCTTCTCAAA
GCAAATTATATAGATGTGGTTCCTGGCTTCTTTAGGAGCTTTGAATCCAAAGCAGACTGA
ATTGCTGGATTACAAGGCAACTGGACAGACACGGGCCATTTATCTAGACTAAATAAAAGT
ATTGATGCTGTAATCCTGCAGAGAGGCGAGTGAGTTTTGTGGATACTAAATGAATTGGGG
GGTTTTAGAAGTTGCATATTTAGTCAGGATAGCTCACTTAGTGACTAGAACAGCAAAGCG
AGTCCCTGGTGAAGTACTCATCCCTGATGGTCTCCTGTTGGAAACGAGAACAGCGTGGGA
GCCCTCAATTCGGTATCCCTGGCCCTCAATTTCATAGCTCAGTGAGAGTTCAGTGAGGAT
CTCAGTTGCTCTTTTGCAGAACACTTATGAACCATTGTAGATCATTGACCTGATCTCAGA
GGAGTTCCATTTTAGTAGCCCTGTAGTGTTGCGGGGAGAGTGGTAGGAGTAAAAAATATT
CTGAAGAGCAGCATGGCCTGGGAATTTGAAGATTGGGGTTACAATCCTGGATCTGTCCAT
TACCTGCTATGATCTTGGGCAAGTCATTTCACTTCTTTGTGCCTCAGTTTCCTCATCTGT
AAAATGGGAATTCTACCTCCTTCTTTGACTGAGAGCCCATGTGGAACAGTGACTGTGTCT
GACCTGATTAACGTGTACCTACCGTAGATCATAGAACAGTGGTTGACACATATTAAGTAC
TTAAATACCATAATAATAATAGTTGATTTTTTCCTAGTACCAAGTGGTTTCTTGTTTGTC
CCGAAAACTGAAATGATACCCATTCTGTGTACTCATTTTCTTTTTCAAAGCAATGTTCTA
GAGTGTTGTTTCATTTGAGTTGAAAAGGTGAAACGTCTGAATTGTTTCATCGGTTCCCTC
TTGGAAGGCATTTTAAAGTTCAAATGGTAACTGAAAAATATGTGGTTGGATTATTTAGTA
CTTGATCAAGGTGATAACCAAAGTAGTTATTTTGTATCTACTCCAATACAAGAGATGGAG
CCTTGTCAAGCAGAGTTAATTCATAGTATAAGTGTGTTTTAAGTATGCTTTTTCAACTGA
TACCATTCCAAATAATAGTAATTAGGGTTCAGCAAATACAGTACACTTATCTACACGTCA
GTGACAAACGAAATACCAAGGTTATGAGTGGGCTGCTTCCTTAAATCCAATTGGTATCAG
CAAATTCGGTAGCTGGAGGCAGGTGCATTGAATGGAGACATCAGACCGAAGCCATGAACA
GATAAATCAAGCAGAGGCAGAGAACATCTGAGAAGTAGTAATTTTGTTTGGCTGGAGACC
TGAGCCAACATTTGTGGAGCCTTGATGATAGTAATAGTTATGATTATAATAATCTCAGCA
GTTGAAAGGGATTAGCCCCACCTTAATTACAGAAAAATGGAAGAAAACATTGAGTGTATG
AGGTGGGAAAATATTGAAAGCATCTTGATGAAGATAACTCCAGAGGAATACACAATTGAC
AAAAATTAATACCAGTTTTAACAGATCCATTTGGTGTTCTAGAATGGCCCGGCACAGAAC
TAAAGACCTCAGATATATCAGTGTTAAAGAGAAAGCATAATATGCATCACCTCAAAGCTG
CACTCGAGAGGCTTACCATACTGTTTGAACCGGTGGAAGAGGAGTTTGTTTTTTTTTTAA
ATTCTCATTCACATCAGTGAAAATTTGGGGTCTGTTCATACTTTTATTGGATTCACATCA
GTCAGTCTTATTTACTGAGCTCTTACTATGTGCAGAGCACTGTACTAAGCACTTGGGAGA
GCATGCTATAACAGAGTCGGTAGACATATTCCTTGTCCGCAAAGAGCTTAGAGCCTAGAG
GGGGAGATAACCATTAAAATAAATTAGAGACGTGTACACAAGTGCTGTAGGGCTGAGGGT
GAGATGAATAAAGGGTGCAAATGCAAGAAAAAGGGGATGCAGAAGGGAGAGGGAGTAGGG
GAAATGAGGGCTGAGTTGGGGGTTGTCTCTTGGAGGAGATAAAGTGATTTCAATAAGGTT
CTGAAGGGCAGAGTGGTCTGTTGGGTATGAATAATAATAATAATAATAATGATTCTATCT
GTTTAGCGAGCGTTTCTAACTTCCAAACCTAGTTACTTTAGGTTAGCTTCATATTTGCTA
ATTACCTTATGGAACGGAGATTTATATTATGTAAGCGTCTAGTCAAAAGATCACACTACT
GGATGTCAGTCAAATAAGTAGAACATTTAAAAATAACTGTGATTGTAGTTGACCAGTGCC
CCGTTTCTGTGATGTGTAAGAGTAAGATTAATCTGAAAAGTAAAAATTGTGCCTTTTCAC
ACAATTAAAATTAAATTAAATTCAAATCATTTTAAATGCTGTTCCTAATTTCGTGGTTCA
TGTGGATTTCAGCAGAGGGAGTGAAAAGTAGCAAGTGAATTTGTGGGTTGCTGCCCCTCT
AACTTTGCTATTTAAGAGAAAATTGTGTGCTGTCTTTCTCTTTTTTTATGGCATTTGCTA
ACCACTTTCTATGTCAAGAAATGTTAATTGAACATTACAATCTTTTTTTAGACTGAAGGA
CTGTTTAAGGAGAACTCAGTTGATGAAATAAAATTCATAAGACTTTTGGATTTGAGGGAC
ATCTTTGAATTGTTGCTTAAAAATACATATTCATAACATTTCATCCAGACAATCCACTAT
GGACTGGTAGAGTGCCAAATTTAGTGCCGTTACCAAGTGCCCAGTAGAAAATCTAGGATA
ATTTAATAGTGATGGCATTTGCTAAGCACTTACTATGTGCTAAGCACTGTTCCAAGCGCG
GGATAGATACAAGGTTATCAGGTTGTCCCACTTTGGGCTCACAGTCTTAATCCCCATTTC
ACAGATGAGGGATCTGAGACACAGAGAAGTGAAGTGACTTGCCCAAAGTCACACAGCTGA
CAAGTGGAGGAGTTGGGATTAGAACCCAAGACCTCTGACTACCAAGCCCGGGATCTTTCC
ACTAAGCCATGCAAATTTAATGCTAGCCAACATTGAAGTGAGAGGTTTTCTCATCTCATG
AAATGGGGAGAAAAATTTAAATGGCGTAGCAAAGTCAAAGCTGGCATGAGTGAATTATGT
TTAAAACTTTTTGTAAAAAGTCCATAATGCATTGGCATTTTAAGTGTAATGATTTTTCTC
TTTTCCATTTTAGCCTCAGCCAAATAGCAAATACAAAACGAGTATGTGCCGAGATCTACG
CCAGCAGGGAGGGTGTCCTCGCGGAACAAATTGTACATTTGCTCATTCTCAGGAAGAGCT
TGAAAAGTATGTATTATCATTTAATTTCCTTTGGGGTATACCGCCTGAGCTTTTACAAGT
GTGTAGCGTACATGCTGTTGTGTTATCACCATGGGTTTTGACTGGAACGGTGTTAGGGAA
ATAAACCCTACAATGTGAGCCTTTGTGGATACAGCATGCCATGCTGGTGCAGGAATGTGG
CTTTGGAGCCAGTAGGTAAGTAGTACAGTGCAAGCTTCACACACGCAGGGTTTTGCCAAG
GACACAACCTCTGCATTATAGAACAGCCGGATGCATTGTGTTTTTAGATTTTATAATTAA
CGTAAAGCGGGCGTAACTTCATTTTAGGTCCCAGGAGTCGCTAAACAGCTATTTGGTTTT
CCAGCCCTCTTTTGCTCATCCAAACTCAAAGGGCACACGATGATCCAAGTTCGCCCTCCG
TTGAAATCTCTTAAGGGTGGCGGCGAAGTCATTTTGTTGACTCGTCGCTCTGCTTTAAGG
TGTAGGCCCTTTAAAAATGATTGGCGGAACTTTGCATGCACATACATTTAATCAAAAATC
TTTATTCTCGCCCAGTAGATTAAAACTTTCTTGAGAGCAGGGCTCGGGCCTGCTGTCTCA
GTTTTACTTCCCCACTGCTCTGCAGTGCTCTGTACCGTGTAAACACTAAAAAAGTACCAT
TGATTGACTGGCCATTTCAGAGTGGAGAAAATCTGACATCCGATATTTTGTATTTGTGGT
TTTGTATGTCATATTTATTGAGTGTTTACTGTATGTGGTGCACTGAATTTAGCACTTGGG
AGAGTACAGTATAGCAGAGTTGGTAGGCACATTCTCTGCCCACAGCAAGGTTACAGTCTA
CAGGGTCATAGGTAGGATACAGGGCTCTGTTGTAACAGTCCTGTTTTCAGTTTGTTTTAT
CGTGCTTTACCACCACACTTTGGTAGGGGCCCCCTCAGAATCTTTAGAGTAGGGGATTCT
GCCACTGAGGGATAAAGATTGACTGAACTTAATGATAGCAACATTTTTAGCACTTTTCTC
CTAAATAGCTTTCTCTGAGGCTTGAGTTCAGGTAAAGTTTTATGACAAGGGGTTGAATTT
TTGCCCAAAAAATTTGTACTGTAGTATTCACTCTGTGTGGTAATAATAATAATAGTATTT
GTTAAAGCGCTTACTATGTGCCAAGCACTGTTCTAAGCACTGGGGAGATAGAAGGTCATT
GGGTTGTCCCTCATGGGGCTCACAGTCTTAATCCCCCTTTTACAGATGAAGGAACTGAGG
CCCAGAGAAGTCAAGTGTCTTGCCCAGTGTCACACAGCTGACAAGAGGTGGAGCTGAGAT
TAGAACCCATGACCTCTGACTCCTGAGCCTGTGCTCTTTCCACTGAGCCACTGTGTGTGG
GGTTGTGTGCATGTGCACAACTGTTTCTTCCAGCACTATGCTGTGCCATGTCCAAGCGGG
CATGTGTTGTCAGAAAACTGTTTCCTAAATCTGCCGTCACATTCTAGCCATATCGTGCGT
TCTGGCAAAACTGAGTGCATTTCCTTCATTGCATTCCTTTTCCCACAAGATGAAGCGAGT
ATGTAGAAGTTTAGTTTAGTTTTACATGCAGCATATGCTGCTGTTTGATTAGAGAGAGTA
GCAATTATTGTATTCCTTTTAATGCACTTTCCTCCCTTTTTAAAATCTTCTGTCACAGTA
ACATTTGATCAAGTGTTTATTGCATTTTTCTTATTCAGATATCGATTAAGGAACAAAAAG
ATCAGTGCGACTGTGAGAACATTTCCTCTCTTAAATAAAGTTGGTGTGAACAGCACCGTC
ACCACAACAGCTGCAAATGTCATCCCTGTCATAGGAAGTACAGAAACCTCGGGGAAAATC
GTCCCAAGTACAAATGGAATTTCAAGTACCGAGAGTGGCGTCTCCCAGTTAATCCCCCGT
GGCACTGACACCACCCTGAGAGCTTTGGAGAATGTGAAGAAAGTAGGAAAAGTTGGAGCA
AATGGTCAGGGTGTCTCTGGGTCTCCTACAGAATCTGTTCCTGAAAAGTGGGTATTCGAT
GAGACTAAAATACCTGTTTGTGTATTCATATTCTTACGGGGGGCAGGGGTTTGCTAGATA
TGTTAAGCGCACATATTCCTTTGGATGCATATATCTGAGGTAGAACTTTAGTTCAAAGAT
TTATGGAGTCAGTTCTCCAGTCTAACAGGCGTTATGTTGTTGAAGAGCCAGTAGGTCACA
TAATTTTGCTATGTTCGTTTTTTTTTTGTTTGAGATGCTGAAACCAACATTGCATTGCCT
TCTGTTCAGACAGGTGTGTTGTCAGAAAAATGTTCCCTGATGCCCCAAAAGCATTCTGTG
TAAAATGTATAATGAAAGAACACGTTTTGGGAAAGCTGACATGCACTAAATTTCACTTTA
TACTCCACTTTCCCGGAGCTTAATGCACTATATATAAGACCTTCCTGTGAGGTAGATGAA
GACAGATTGGAAAACTACACTACTAAAAGGAGAAGTCGGTTTCCTAAGAGGCTTTTCTTA
ATTAATCTCTCCTCTGTTTAGTACCCCTCTTCTCCCCTCCCTGCAACGACTACATGAGCC
ACTCAACCACTCGTGTATTTTACGTATCCCCTTTATCCTCTTTCTCCTCTCCATAAATTA
TTCTTATGTCTGTCTTCCCCACTGCATAGTAAACATGTCTTTTTACTCTGTTGTTTCTCC
CAAGTGCTTAGGCCAGGGCTCTTCACACTGAAGGCACTGAGTAAATTATCTCAGTTGATT
GACTGTTAATTTTACTAAGATCGTACACTCACTTATTAGTGGAACCCCCCAAGAGCTGTA
AATCTCAGATTGCTTTATCTCGGCTGCTGTTTTGGCCATATAACCTTTTTGGCCGCTCCT
TTTTGAAAATTAGGCAAATGACATTGTGGTTTTAAATTGACGGTCTTTAGGCAGATGACA
CTGTGGTTGTAAATTGAAGGCCTTAGGCAAACAAGAACTTAATTATATGTGTGAAAATTG
AGACTTTCCATAGGAAAATCCAGTATTTTGTTGGTGGCCATAGGAGATGATTCGATTTGT
AACCTTAGTCTGATACCTGGGATAATGCCCTTGCTAATAATAGATTTGCTTGTACTTCTT
CTAATTCTTCAGTCCTCAATCCAATCTTGTAATATCTCACACGTTCTCTGACCTTATTCA
GCTCCTAGAAGAATTGTCTTCACTGAGCATTACCTTCTATATTAATGCATGTTAGAAATT
GGGTGCTCCACGTGGGTTTCTTTGTGAAGAGAGGTTTCCTAGCAGGGGAATGCAAAACAT
TAGATCCCTTTATGAATAACAATGGGGTTGTTTGGGGCTGTGAGTTTATTTAGCCATTTT
GAGTTTCAATTAAATTAACCTTTTCCAAGTTATGTGCAGAGCAGCACTGCTTTAAAAATC
AAAAATAAAGGGGATTAATGAGAGGGATTTTTTTAATGCAATGAATTTGGCATCCTGAAT
TAAACAAAAGGAAGGGTTAATCGACTTCCTTATGGCCTTCACATACATTCTGTAGATCAA
CACGCTCCTCAAATATAAATTGCAAGCAGGAAGCACAATCTTGAATTTATTAGCCCCTAC
CCCACTTCATATTTGGTTTTTTGAAGTCTGCACAGAGCTGCTCCAAGAAGGAAGAATTTG
TTTGCCCAAATTACATGCTATAAATGGAATCCTCATTTTTGCATCCTCAGGTTTAGTAGA
GCTAGATATGGAACCCTCTAATCCAGTTGATTCTTATTCCTGGAATCACTGTTCTCGTTC
TTAGACGGACAGGCTTGGTTGGGCTGGTAACTGCCCTCATATGCGATCTTTCTGATTTAG
ATGAGCCACTTTATGCAGTTCTAATTTCAGGAGACTTTAACACCGTGCTACCAAATGATG
GTTTTGACCAAGATAGGTATATTGATAGACTAATGTGGAAGAAAGACACTGTGTGCAGAG
CACTGTACTAAGCATCTGGGAAAATACAACACAGTGTACTTTCTTTTCTCTGCCCCAAAG
AAGCTTTGCTTTCAGGAGCACAGTCTTCCATCCTGCTGGTTTCGGTGAGCTTTTCAACAA
AGATTTCCTGCTCAGAGGGCCTGCTTCTCAGTAGAGAATCAGAGGAAGGTAGAACATTTG
GGGAAACTAATTGTTCTCTGGCTGGGACTGTTGGCTGTGGCTTGCACTGTGAGTCTTCAC
ATTGGCCCATTGGTGTGCAGATCTGGAACCCAGGGCCTGTTTTGCCCAAGTAGAATGGTC
CTTGATGGGGTTTTTATGAATGGCTTCATAACTGAAATTATGCAAAGATTCCTCCTAAGA
GATTCAAGGACTGATTGTCTTCCTTTGTGATGTTTTTTCTCCCCACCAGTAAAATTGGTT
CTCCCCCCAAGACTCCTGTAAGTAATGTAGCAGCTACCTCAGCCGGGCCCCCGAGTGTTG
GAACAGAGATGAGTTCTGTACCTCCAAAGTCGAGCCCTTTTATAACCAGACTACCAGTGT
ATCCTCAACATTCTGAAAACATTCATTATTTTCAAGATCCAAGGACCCAGATATCCTTTG
AAGTCCCCCAGTACCCCCAGACAGGTGAGTGACTTTAGCTGACTTAATGTTAAGCCCAAA
ATTTGCTTTGGAATGTGTCAAATATGTAGTTCTTTTCTGAGTGCAGTATCTATTTTTAAA
AGTAGCTACTAAGTTATTAGCCTAAATTGTTTATGGGTTGCCAGTTGAGTTATCCATCCA
TCCATCCCATGTGCTATGGGAATTATACTGGGGAAAATTTGAGGTCTTTGAAGCCTCAAG
CAACATTTGTGTCTTCCTTGTAGTCCCCAATCTGGGTATAGAGATGAATTCCTTTTGCAA
CCGTTTGAATATGAAATAGGAAAAGCACTATTAGTTTTTCAGAGGGATTTTTTGGCCTAA
TTTGAGTAAATTACTGGGATTTAAAAGTCATGTATTTGAGCTTCTCAAAAAAAAAAAACC
TGAATCCAGAATGCACCTGAAAATTAGGCGTGAAAGTAGAATATATTTAGCAATTTAGGT
CGTCGGTATTTATAGTGAATTTTTCTTATTTAAAGCCGTCTACGAAGGTCACAGATTTCT
AACCAGCCGTCTAACACACGTGGTCTCAGAGACCATAGAGAATAAATTGGCCCGCAGGCT
GAAAAACCGGAAGATGCTAGTAAATCTGGTTCACGTCTTGAAGTAGTGATTTGGCAAGGG
ATAGAATGTCAGCTATTTCCATGTGGGGGTGTGATGATGTGAGCATGTAGCTGCTGTGCT
GAACAGGGGAGGTATGAGGTTAGCGTTCAGATGGAGGAAACCATGCCTGTTATACTCTTT
CGAATTGACTGAGTGCTGCTTACAACTTAAACCATTACAATTCTGGCTAGTACTGAGCCC
ACATTAAATATACCTCTTTCCGATTTTCAAGGATACTACCCACCACCTCCAACGGTACCA
GCTGGTGTGGCTCCCTGTGTTCCTCGCTTTGTGAGGTCCAATAATGTTCCAGAATCCTCC
CTCCCACCTGCTTCCGTGCCATATGCCGATCATTACAGTACATTTCCCCCTCGAGATCGA
GTGAATTCTTCTCCTTACCAACCTCCTCCTCCGCAGCCGTATGGACCGGTTCCCCCAGTA
CCTTCTGGAATGTACGCTCCCGTGTACGACAGCAGACGCATCTGGCGTCCACCGATGTAT
CAACGCGATGACATTATTAGGAGCAATTCTTTACCACCAATGGATGTGATGCATTCGTCT
GTCTATCAGACGTCATTGCGGGAGAGATATAACTCTTTGGATGGATATTATTCCGTGGCT
TGTCAGCCACCAAGCGAGCCGAGGACAGCTGTGCCTTTGCCGAGGGTAAGTAATAACGGG
AACGTGGAGTGAACCCCCCGGACTCTGGTGGAATGCTGACAGGGAACAAGAGCCTCTGCA
TTTACATCGGGTACTTATGACAGTTTTAGGTGTGTGGAACATAGGTTGAGGCCCCATCCA
CTTTTTTTGTTCTACAAGTTAGTGTGCTTTCTTTGTCTTAATATAGGCGGTAATAGTATC
TTGATCTTGTATCTGCCCCAGTGCTTAGTGTAATGCTTGGCACAGGATAAGCGCTTAACG
AATACCATCATCACTAATATGTTAGTCCTTCTACTGTTCATTAGAAACTAAGCAGTGTGG
CCTAGTGTGACAGCATGGGCCTGGGAGTAAAAGGACCTGGGTTCTTATCCTGGCTCTGCC
ACTTGTCCCTAGTGTGACCCTGGGCAAGTCACTGAATTTTCCTGTGCCTCAATTGTAAAA
TGGGGATTTAACCCTACACCCTCCTACTTGGGCTGTGAGCCCCATGTGGGGCGGGGGACA
GAGTCCAACCTGATTATCTCATATTGACCCCAGCACTTAGTACAGTGCCTGGCTTGTAGA
AAAGCACTTAACGAGTGTCATTTAAAAAAAAAAAGTGTAGTCCTTAATTTTTAAGATATT
AAGAGTGGCTTCTTTTTGCCCTCCAGGAATCCTGTAGCCACTTAAAGACCGGTTATGATG
AGCAGTTAAGACGGAAACCAGAGCAGTGGACCCAGTACCACACTCAGAAAGCACCTCTTG
TTTCATCGGCTCTCCCTATGGCCACTCAGTCTCCAACACCACCTTCTCCTCTCTTCAGTG
TAGACTTTCGCACAGAGGTAAGATGCTTCATCACTGGCTCATGGGGCGTGAATTTAAATG
AGGACAATCTAGAACAGAAATTTCCGGCCTAGCTTTCTTGGTTGTACTCCAAGGTGGTCA
TGAAGGCCCGGACCACAGCTTTTCAGGCCGGAAGGCAAGCATACGTAGCCTGTCTTACCT
TTGGATTTGTAAAAAGAATCGGAGGAAGAAACAAGATGGTGGCTTCACCTCTTGCCATCC
GGGCCGGGAGTCCTCGGGGGAACTGGGGTTCCCACGGCGCCAACAGGGCCTAGGGTCTCC
ATGGCATGAACGGGGACTGGACGTGGGCTGGGATCAATGCAGTGCAGATAGGGAGCGGGG
TCTCCACAGTAGGAGCTGGGCTCTCCGTGGCAGAAGCCAGACATGGCGTAGAGTCTCTGC
AGGAGAACTGCAGGCTGGGTCCCTGGCGATGGGAGTCAGAACTCTGGGGTTCCGGCAGCA
TTGTGGCTGCCCCATTGTGAGACTTGTGTGGTCCTGGACGTGAGGCGCGTGTTAGGGTCG
GGGGTGAGGGAAGCAGTCAGGTGAATGTGGAACGAGGGTAAAGGGAGCTGCTGGCATCTA
ACCCCACTGCCTGAGGTGAGGTGATGGAGAAGAATGTGCTTCCTTTTGCACCTTTAATTT
CCTCTTCCTTCCCCTTTTCCTCTCTCCTTCCCTTCTCTTCCTCCCTCTTCCATTCCCGCC
ATCACTTTCCCTCCACTTCTTCCTCTGTCACCTCAGAGCTCCACCTCCAAAGCCTCACCC
CTCAAAACTCCATTCCCAAGCTCAAGATGAAAAGCTGGCACCACTATTTGTATGTAGCAC
CAGAAGTTGTGTTCCTTCCCAGGAACATAACTGTCACATATGAAGCTCAGCAATGTCATT
TCCGTAGCTAGAGGAGCTATAAAAATTGCCGTTTGAAGAATTTATTTTTAGTCACTTCTA
AGTTTCTAGCTCTTGATTTTTAGAGCAAATCCACCAATCGGTTAATTTAAGATCTGGAAT
GGAGAGTTTTGTATCATAATTAGAAACAGCAGTATGGCTCAGAGGAAAGAGTAAGAGACT
TGGAGTCAGGAAACCTGAGTTCTCATCCCAATTCTGCCAGCATCCTTTTGTTTGATCTTG
GGCAAGTCACCTCACCCCTCGGGGCCTCAGTTTCTTCAGCTGTAAAATAGGGACGATACC
TGCTCTCCCTGCCTCTTTAACAGCGAACCCCGGGTGAATGGGAACACGATCCGCTATGAT
CATCTCGTCTCTGTCCTCAACATTTAGCCCAGTGCTTTGGAATATGGAAATCAATCAATT
GTATTTATCGATTGTTTACTGAGTGCAGAGCACTCTACCAAGCTCTTGGGAGAGTACAAT
GTCGCAGAGTTGGTGGGCACGTTCCCTGCCCACAAAGAGCTTACAGTGTAGTAAGCACTT
AATAATCAATTACTAGTATCTATTGAGCAGTTATGGTTTGCAAGCACTGACCTAAACACT
TGGGAGAGTGCAGTGGTTTGAGTGATCGGCTCCCTGCCGTCCAAGAGCTTACACTCTAGC
TGGTTGGAGAGACACAAAATAATATATAAATAGAGCAGAGAAAGGAAGAATTATATACGT
AGGTGAGTAAATGTTCATATCAGTTGTATCAAAAGGTATTTTTTGGCATCAGAAATGGCA
CTTGCCCTAAGGAAAATATTTCCGTTCAGGAGGGCTGTGTTAGGAAGGTAAATTGTACGA
TTTTTAAATCAGATTATCTCTTGACAAAGTGTAAGACCAGTTTTACGTTGAGTCTCGGCG
GGGGGAAAAAGAATTTGGTGAAGAAAGAAGAGAACCTTTTTTTCTAGTCATAAACGATAC
ATTAAGTTGCTCAAGAACTGTTTATGGCCACTTCCATTTTCTGGAAAAAAATGATGGTTA
ATTACTAAAATTCACTGAACTGAAGCCCACATTACTGCTTGTGAAGTATGACTTTCTTAA
GGGTCGACTCTGCTCTTGTTTTTTTAACTAGTTCTCTGAGAACGTAAGTGATTTGCGTGG
TACTAAATTTGAGGAAGATCATCTTTCCCATTATTCACCCTGGTCCTGTGGAACTATCGG
CTCCTGTATGAATGCCATTGATTCAGAGCCCAAGGATGTAATTGCCAATTCAAATGCTGT
GCTAATGGTATGATTTGGGGGAGGTAGTGCATGCTGACTCTCATTTAAGAACATGCTTTC
TTTTCCTTTTATTTCTGAGTAAACCCGTCTATTAAAAACCCAGGCTTCTATTCACTGAGG
CTTGGAATACCAGTCAATCAACCAGTAATATTTATCGACTGCTTACTCTGTGCATAGCAC
TGTATTAAGCCCATGGGAGAGTTCAATAGAGTTAGTGGTCGTGATCCTTGCTCTAAAGGA
GCTTACAATCTAGCCGGGGAGACAAACAGCAGAATAAATGATTGGTAGGGGTGAGCAACA
TTATTTAAGGATATATTACATAAGTGCTATGAAAGTGGCGGGGGAATACACTGGGTATAG
GACCTCGGTTCATTTAACTTGTATTGAGGCATCGAGAAGATGTGGACTCGTCCACATAAG
CTGAAGCTAACGATCACTTGCCTTTTTGGGAAGTGTTCGATGACTGAAGGAATTTGCGAG
AACCTTTTGTTTTAGTGTTTTTGTGTGTTTGTTTTTTTTCTTTTTTCGTTTTGTTTTGTT
TTCCCCCCTGGAATGGTCAGGACCTGGACAGTGGAGATATGAAGAGAAGAGTGCATTTAT
TTGAAACTCAGAGAAGGGCAAAAGAGGAAGACCCTATTATCCCCTTCAGTGACGGGCCCA
TCATCTCTAAATGGGGTGCCATTTCCAGGTCATCCCGCACAGGTTACCACACCACAGACC
CTATTCAGGCCACTGCTTCCCAAGGAAGTACAACTAAGCCCATCAGTGTCTCAGGTAATA
CTGAAAACTGCCAGCAGCTTTATGGTTCTACACCCACCTTGTTCTGATCCTTTCAGTTAA
TTACAGATGATTGAATTGCTTGCCCTATTAAATTGCTCCACGTTTCTGCAGATTATGTCC
CGTATGTCAATGCTGTTGATTCAAGGTGGAGTTCTTATGGAGCCGATTCCACTTCGTCAG
CCCACTATATTGAACGGTATGACTACTTTTCTACTTTATTTTTTGTTTCTATGTTCTAGA
ACTTAAAGGGTGTGTATGTGTATGTTTTCACACTACAGATTCCAACAGAATACTTGGAGC
TAGTTTCCCCAAAAGATGCTTTCTGGATATATGATTTTTTTTTTTTAACTAGGTACAGTG
AATAAAAAATTGAATTCATTTCTCCCATTGAAGCTCTAAAGAGGTTGGGGAGAAAAGTCC
CTTCCAGATCCTTTCCCTGAGCCAAGCTTTTAATCTGATTGCCATTGGTGAATTGCTTCC
CAGCACCAACAGCCTCCCAGGTCTTCTGCTGCCTCCGGGATAGGGGCACCCAAGCACATC
CCTCTGTAGTCTGTAGCAGTTCTTTCTCCTCCACATTTTGGATTGGAATTCCGATTTTTG
AATTATATTTTTGAGTTATTATTATTGAATAATTTTTGATTTATTTTTGAATTAGATCAC
CGTTCTTAAATCCAGAGTAGTTTGTTCTGTAGTTTCATTTTCCCCTGAAAATGTCTGTAA
GTTAAACATATGATTTCTCTTTAAAGGGAAAGATTTATAATTACTGATTTATCTGGTCAG
AGAAAGCATTCCAGTACTGGAGATCTGCTGAGCGTTGAACTTCAGCAGGTAAGATTAATT
ATACTGCCTACCAACGTGCCTACAAGCTCTTGATGTTTCCCAAGCGCCTAGTACAGTGCT
TTGAACAAAGTAAGCACTCGATTCCATTGATGCTACACACCTAGATAAGTAAAGACAAAG
CCCTTGTTGACACTTTGGATTATTCATATTAGCGTCTACTTCCCCCACTGGACTGTAAGG
TCGTTATGGGCAGGGAACATTTCTGCTTATTCTTTCGTGTCGCTGTCTCCCAAGCATTTA
GTACATGGTTCTGCACATAGTAAGTGCTCAGTAAATACCGCTGATTGTTTTGGAGCCATA
GCTCAAAATGAGCCGAGAGAGGTGCCAGAGCAGTCAGGTAGACTAAGAAGGGGCCTGTGA
AGCTTCTACTGCTGTTAGCCCGAGAAAAGCCAAACAGAGATCAAGAAGCAGAGAGGAGCA
GGTGGGTGGGTAGAGAGATGGCGGGAACCTGGACTTCTAGTTCTTTGCAGTATTCAACTG
GTTTGTCAGTATGCAATTTGGATTCCTTGAGGCATATTTAAATGCTGAAATTATCTTAAT
TTTTTGTTTTGTCCAGGCAAAGAGTAATTCACTGCTACTTCAGAGGGAGGCCAATGCATT
AGCTATGCAGCAGAAGTGGAATTCCTTGGATGAAGGTGGACACCTTGCTTTAAATCTCCT
AAACAAGGAAATCGAATTGAGAAATGGCGAGGTAAAAAAAAAAATACATTTTGTAATTTA
ATGAGACGATTTCAGGGCATAATGGGAAACGCTCAGTGGGGAAGGTCCTTCCTCTTATTT
TTTGGGGGGGGTAGCTGTTGCGACATTCTCCAGTGACTAAAATCAATACGAAATGCCTTT
CCTCCAGCCTTTTTCTCATTCTGTATTTATTGGCCTGTGTGTACATGAGAAAAAAGGAAA
GTACGGGTGCTTGTGGGCATAGACAGTATTTGTTTGGCTTACAGGCTGACTATTCAGAAG
ATGCCACCGATACTAAACCTGATCGAGATATTGAATTAGAACTCTCAGCACTTGATACCG
ATGAACCTGATGGACAAGGTGAACAAATAGAAGTAAGTACAGCCATTAGAAAGTCTGGAC
AGTTGAGGCATTCTTCTTTATCTAAAAAGTTGTTCCTCTTCATTTGTATGTTTAGATTGG
AGACCTTTATAACTAAAGGGTTTTTTTTATATATTAGCCTTCAAGGGGTTGCCTTAACTC
CACCTTACACTCTTATATCCTCAGTGCTTCATTTCCTAACTTTCTTCATCTTTGTACCCA
AATGTAGATTTTACATGTGCTCTCACTTTTTGATGGCTTCCTTTTAATTGTCTTAGTATT
GATCACAGTATGTTGTTTAAAAACAATTTCCAAGCAAATGATAAAAATTTAAAATTGTTT
TATTCAATATTCTCCCAGTTTCCTTTTCCTTTGGAAACTTTTCCAGTGATCTTAAATTTT
AGATCACTTTAATATTGTGATTCTTGAAAATTAAAATAGACTATGGAACTTTTCCTTTGG
GCATTAAATGCAATATATTCTGGGGTTGGGGTGGGGGTAAGTTTTCCTTTCTCCTCCCTT
CCTTCCTCTTCTCTTTGCCTGTCTCTACTGTAGCCTAGCCATTTCTTTGGAAAAGAGTTC
CGTAGTGGATTATTAGATGGTAAAACTAGGTATGTTCGGGGGTAAAATTGGGAATGGTAG
AAAGCTCAGGATGGATAAGCTAGGTTTGTGAATTGTGGATCAGTGCTGGGTTACAAGAGA
GGAAAGCTAACGGTGTTACGTGATCTAGCCTCAGCCAGGAGGGTGGCTGTCAATAAATAA
TGTTGAAGCAGGGACTTGTGGTCCTCTTTCTCCTTGATCCCTCTCCTTGGGGGACACAGT
ACAGGAGTCATGCGTCCCCTAGAGTGTACAGGTATATCCCCATGTGTCTTGAAAATGGAG
TTGTTAGATGGAGTACTTTTTCTTATAGATTGACTACCTGTTAAATTAGGGTCCATTCCA
GGACCAAGTCGAATATCACAAGGTCATTACAAGTCATTCTTTGTGTCCCCAATCCCCCCT
GCACTCTTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1342, 2233..2350, 5005..5238, 7006..7181, 8982..9182, 9762..9894, 10024..10142, 13453..13565, 15278..15586, 17929..18143, 18991..19424, 20066..20236, 22231..22386, 22940..23153, 23271..23355, 23906..23987, 24556..24690, 24938..25051
1112..1342, 2233..2350, 5005..5238, 7006..7181, 8982..9182, 9762..9894, 10024..10142, 13453..13565, 15278..15586, 17929..18143, 18991..19424, 20066..20236, 22231..22386, 22940..23153, 23271..23355, 23906..23987, 24556..24690, 24938..25051
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved