Ornithorhynchus_anatinus Locus RPL18A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPL18A
Ornithorhynchus_anatinus
RPL18A
Ultra659
SNORA68, SNORA68
8713..8771, 11373..11511
13873
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCCCTTGTTGGTCCCAAATAGGCTGCTGGACCCCGGCAG
CCCCCACAGTCTCGTGGAGGGTCCTTAACCCCCGTCCCGGGCTGGGCAAGCCCTATTCCT
TTTTGGCGATGCCTCCCCACCCCCCAAAATGCGCGCTCCCCCGCTCTACCGGATGCGCAT
CTTCGCCCCCAACCACGTCGTCGCCAAGTCCCGTTTCTGGTACTTTGTCTCGCAGCTGAA
GAAGATGAAGAAATCGTCCGGGGAAATCGTCTACTGTGGACAGGTAGACTCCCACCAATA
ATATCCAGCCATTGCCTCTGTTGGGTCGGCGCTTACTCCGTGCCGAGCACTGTGCTAAGC
GCCGCGATGGATGGAACGTCACCAGGTGGTCCCCCTGTCTTAATCCCCATTTTATAGATG
AGGTCACTGAGGCCCAGAGAAGAAGAATATTGGTATTTAAGTGCTTTCCCCCGATTAGAC
TGTAAGCCCGTCAATCGGCAGGGACTATCTGTTGCCGACTTGTTCATTCCAAGCGCTTAG
TACAGTGATCTGTACATAGCGCTCAGTAAATACTATTGAAGTGCTTACTATGTGTCGAGC
ACTGTTCTAAGCGCTGGGGTGGATAGGAAAAAAAAGGTATTTGTTAAGCCCTTACTATGT
GCAAAGCACCTTTCTAATCGCTGCGGGGGGGAATATTAGGTGATCAGGTTGTCCCACGTG
GGGCTCACAGTCTTAACCCCCATTTTACAGATGAGGTAACCGAATTCCGGAGAAGTGAAG
TAATAATAATAATAATGTAGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTA
AGCGTTGGGGTAGACACAGGGGAATCTGGTTGTCCCACGTGGGGTCACAGTCTTAATCCC
CATTTTACAGATGAGGTAACCGAGGCCCAGAGAAGTGAAGTAATAATAATAATGATGTTG
GTATTTGTTAAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCAGGGGTAGACATGG
GAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCTATTTTACAGATGAGGGAAC
TGAGGCACAGAGAAGTGAAGTGACTTGCCCAAAGTCACACCGCTGACAAGTGGCAGAGCT
GGGAATCGAACCCAAGCCTGTGCTCTTTCCACTGAGCCACGCTGCTTCTCCAACCTTCTT
AGAAGGTCACCAGGTGGTGGTCCCCTGTGGGGCTCGCGGTCTTCTTAATCCCATTTTACA
GGTGAGGGAAACGAAGCCCAGAGAAGGTGAATAATGTGGGTATTTATTAAGCATTTGCTA
TGTGCCGAGCACTGTTCTAAGCACTGGGGTGGATAGGTCACCAGATGGTCCCCCGGGGGG
CTCACAGTCGTCTTAGTCCCCATTCTACAGATGAGGTCACTGAGGCCCAGAGAAGAAGAG
TAATGTTGGTATTTGTTAAGCGCTTATGTGCCAAGCACTGTTCTAAGCACTGCAGTAGTT
AATCATGTGGGTCACAGTTTCTGTCCCACATTGGGCTTACACTTTTAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGCCAGGCAGGCAGGGAGGCAGGCGGGCCC
GAGGAGGCCCGGCAGAGGCCGGGCTAGCAAGAGAGGCAGGGCGCCTGGAGGCCCTTCCCC
GGGCTTGTCGTTCTTGGCGGACAGAGGGGTCCATAGAGTGACGGAGCGACGGTCGGTCGG
TCGGACGGACGGACTGAGAGAGGCAGGCTGAACGAGACCGGCAGAAGGGGAGGTTCAGGC
AAACCGAGATGGAGGCGGGCGAGACGGGCAGCCCGAGAGGGTCAAGGGAGGCTGAGGGAG
AGAGGGAGAGGGCGAGAGCCAAGGCGAGTGCGTTAAGTCCCCAGCCAGGCGTGCATGCCG
GCGGGGAGAGGCCCGGCCAGGCCGAGAGGAAGAGGGCTTGGCGGCCCGGGCCGGGGTTAG
GACCCTCCGGGACTGTGGGGCGGCGGGTCCGGCGGCTGTTGGGCCAGAAGGGGGTTGTCG
GCGAGAGGACTGATGTTTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTC
GGAAGCTAAGCGGGGTCGGGCCCGGTTAGTACTTGGATGGGATTCCGCCTGGGAATACCG
GGTGCTGTAGGCTTTTGCTGCCGCCCCACCCGATCGGTTGCCCTTTTGCAGTGACCTCGG
AGGCCGGACGAGCTCCCTCCTGCCAGCAGGCCGCAGGCGGGCCCCGGCCGGAGCCACCGA
CACCTTCACTGCAGAGCCCAAGCCTCTCTAGGGGCAAGGCAGGCAGACCGAGCGGACAGA
CTGCCAGAGAGGGGCAGATCGAGGGAGACCGGCAGACTGAGGGAGACAGGCAGGCAGGCC
GACAGGGAGGCCCTTGCACGCAGAGATAGTTGCGTAGAGAACTACCGAGAGAGGCAGGCA
GGCAGTGGCAGGCAGGCAGGCAAGCAGGCCAACGCCCAAGAGGCAGAGGACTTGGCAGCA
TCTGCCGGCGTCCTCTGTAGACGTCAGCTCCCCCATCCACAACCCCCTTCTGCTGGTCAA
CACCCACAGGACCGGTGCTCCTTAACTCTCTTTCCCCCACCTCTGTAGCTCTCCGTCCCT
CTCTTGCTTTTTCTCCCTCTTCCCGGCCCTCTAATACGATTTGCCAGGCATTTTCCTTTT
CCCTCCTGAGGTTATACCTAAGTTGGCTTTTTATCAATACGTCTAAGGAAATGAAACAAT
TATCAATTCATTACTTATTAAAAGTTTTATACTTTGTAACGTCTATACTGTGTGATCTTT
TTGGGTAATTAGCATGATCGCCCATTCCTTTGTATTCTCTCCAAAGGTTTTGGTAGTGAG
GTCTGCACGCACTAATCGCTCTATGACAGATCCTAGTGAATTAATTCAGCTTTCCATGGA
GTGTTTTTTTTTACAGTTTCCATCACTTAGAACGTAATAATATTGGTGTTTTTTAAGCGC
TTACTATGTGCAGAGCACAGTTCTAAGCGCTGGGGTAGATACAGGGTAGTCAGGCCGTCC
CACGTGAGGCTCCCAGGCTTAATCCCTATTTTACAGATGAGGTAACTGAGGCACAGAGAA
TAATAATGTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCACCAAATACCACTGTCCTCACTTGCAAGAAGCCATCCCCTTTCCTCCAAATC
CCTATCCCTCCTGCCTCTCCTGTGCCCTTGGATCACTTGGATGCTGTGACCTTGGGCAAG
TCACTTCTGTGCCGCAGTCACTGGTAAAATGGGGGTTGCGACTGTGAGCCCCACTTGGAA
CAGGGACTGCGCTTAGTACCGTGTCAGGTGGCTCGTAGTAAGCGCTTAACGGATACTGTA
ATTATCACTGTTCTTACCCAACTGGGACCTTTGGGCACTCGGTATTCACTCCACCCTCAG
CCCCACACCATTTTATGTACCTGTCCAAAATGCATTCTAATGTTTGTTTACTCCTAGATT
GTAAAATCTTTTTTTTTTTTTTGCTATTTGTTAAATAATCGTTATGTGCCAGGCACTGTA
TAAAGAGCTGGGGTAACTACAAGGTTAAATCCCGTTGATTGATTGAATGAGTTTGTAAAT
TGGCCTTTCTTTAGGGAGAAACGTAGTAGTGATTAAAATGTCTTCTGGTGGGAAAATCCG
GTGTGTCTGGGCTTGGATTTGGTAGGCCTGATGAGCTTTTTGGTGTCTTATTGGAAAGAG
TATGGGACTTGTAGTCGGGATGTCTGAGTTGTAGTTCCATTGCGCTGTTGGCCTGCTGTG
GGCACTTGGGCCAGTCACTAAACTCCTCATTTTCTCAGCTGTAAAAGAGGGATAAGACCT
TTATGGCCCCTATCATTTTTCTAAGAGTGACCATTCCTCACCTCCCTACTCAAAAACTTT
CTATAATTGCCCACCCACCCCATCAAATTATCAGCTTTAAGGCACTCAGCTCGCCCCCTC
CTAACTTAGCTTGCTGGCTTCCTACTACCACTCAGCCCACACACTAATGCCAACCTAGTT
ACTGTACCATGATTTTTTATTGCCTCAAACCCCATGTCCTTGTCCTCTCTCTGGCCTGGA
ACTGTCACCCTTCATCCTTCAAAGCCCAATAAAAGAATATCTAGTAGCATTCCCTGACTA
GTCCCTCATATCCCCAGTTCACCATCTTTTTTATTGCCCACATGCTTACCTATGTATCCC
TTAAGCATTTGGTGTCAAACATACTCTGTAAGCATCGGTTATGCCATCCCACTTAGCTCT
CCGGCAGTGATGTTCCTTGTACTCTCCCATTTTCCTGTCAGTAGTTTATTTTAGTGTTTG
TCTCCCCTTTAGTGCAAGTTCTTTGGACAGGAACTTGCCTATTAACTCTACTTCATTGTT
CTCTCTCATGTTAAGAGAAGCAGTATGGTCTAATGGAGAGAACACGGGCCTGGGAGTCGG
AAGGACTCGGGTTTTAATCCTGGTCCTTCACTTGTCTGTGCCTCAGTTATCTCATCTTTA
GAATGGGGATTAAGACTGAGCTCCATGTGGGAAGTGGATTATCTGACCTGATTAGCTTGT
ATCCACCCCAGCCCTTAATAGGCACTTAACAAATAACTAAAAAGTGCTTAGTACAGTGCT
CAACACACACCAGTTAGTAAACAGTTAAAGGACAGTGAAGCACCAAAACACTCCATGTAT
GGGGAAGCAGCCTAGGTTGAAGATGTCCACAAGTGCTGCAGTGTTCTGGTGAAGAGTGTT
TTCAGTTCTCCCACTACTTTCTGCCCTGACTTGTTGCCTTTGCTCTCCCCGCCTACCAGC
CCCACAGCAGTTATATACATATCTATTTAAGACTAAGTTCATCGTGGGAAGGGAATGTGT
CTGTTTATCATTGTATTGTACTCTCCCAAGTGCTTAGTACAGGAATAGCTCAATAAATAC
GAATGAATGAAAATGGTATGCCGGGTGTGGCTCTGTCAGTGGTTGGAGGAATCTTCTCAG
GCTGGGCACGGCAACCCCGGGAAGCAGCCGAGTGAAGATTTTTCTATCACTGGGTGTTAA
AGCTGCATTTCTTTGGTTTTCCTCCTTTCCTAGGTCTATGAGAAGTCTCCTCTGCGAGTG
AAAAACTTTGGCATCTGGCTGCGTTACGATTCTCGCAGTGGAACCCACAACATGTACAGG
GAGTACCGGGACCTGACAACCGCCGGGGCTGTGACTCAGTGCTGTAAGCGATCCTGCTCA
ACGCCCAAAGGCCCCGCATCTTAGCTTCTCACTGCGCGCCACTGAGATCTTAACTTGGAA
GAAAATAGTGGGGCGCAGCGTGGTCTCGTGGAAAGGGCCCAGGCCCTGCAGTTAAAGGAC
CTGGGTGGTTTTTGTTTTTTTTATGGTATTTAATTGTGTACTGTGTTCCAAGTACTGTTC
AAAGCACCGATACAAGCTAGTTAGGATGGACCCAGTCCATGTCCTACATGGGGTTCACAG
CCTTAGTCCCCATTTTGCAGATGAGGGTACTGGGGCACAAAGAAGTACCTTGCCCAAGAT
CACCCAGAACTCAAGTGGTGGAGCCAGGATTAGAACCCAGCTCCCTCTGGCCAACAGCCT
TCACTGTTCTAATTCCTACTGTGCCACTTTTGTTGCGGGACCTTAGGCAAGTCTCTTAAA
TTCCCCATGCCTCACTTTCTGCTTTTGGGAAACGGGGTAGATACCTGTATTCCCTCCCAC
GTAGACTTCAGACTCTGTAAGGGAAAGAGGCATCTCACTTGATTAATCCAGTGCTTAGTT
TGGTGCTTAACAAATGACACCCTTATTATGGGAGTTAACTCAGTTTCTTAGCTTACCAAA
TGGTTCAGTCAATCAATATATGTGTGGTGTGTTTCAACATAAATGTTGCCTACTATGTTG
TGAAAATAGAACATCATTTGGTGCTGTTTGAGACTCCGAGGGATGGGCATTATTTTAGAG
GTAAAATGCAGAAGGCTACTTAGCGAGGGCAGGTCAGGTAATCGGACATGGAGGACTGAG
GGATGTTTGCCTTTAGAATTACAATTTAGAGTTAGACCCGGTTTCTAATCCCAGTTAGAA
ACCGCTTGCCTCCTGGGAGACCTTGGGCGAGTCACTTAAGTCAGTAAAATGGGAGTTCAG
TCCCTGTCCTTTCCTTTTTGGACTGTGAGCACTATTGCAGGGCAGGGGCTTTGTCCAATC
TGGTAAACGTGTATCTGCTCCGGTGTTTAGAACAGTGCTTGGCACGTAGTAAGCACATGC
CAAATACCATGTAATGGTCGTCTACTACGATTGTTATTATAAATGGGAATGAGGAGGGTT
GATTTTCCCTCACAGCACCCCGAGCCCCAAAGATCATCATTTTCCTTTAGTAATGATCTA
TCTTGGGGTGCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGGAAATTTGGAAAGGTGAAAGTAATTCTTAAACTCTCGCAACTTCAAAAGCAGCC
AGGAAAGATCAAGAGATTGCTCATAATATGCAGCTAGGATTTTGGCATTTAAGCCGTTAT
TCCAGTAGTAGTGATAGTATTAGTGATTATTGAACTACCACAAGTTCTCTGCTCTACTGA
GCACCTGGAAAGTACAGAACAAACAAATGACACGTTCTCTTTCCACACACAGCTTGGACT
AGTGGATCGAGGGAGGTAGAGATATTTAGTGCGGCCTAGTGGGAAAAGCGGCGACCCCGG
GGCCTGTGGATCTGGGCTCTAATCCCAGCTCTGCTACTTGCCGGCCTTGTGACTTTGGAC
AAGTCACTTTTCTTTGCCTCAGATCCCTGCATCAGCAAAATGGTGATTCCCTACTTAGAC
TGTGAGCCCCATATGGGACCTGATTATCTTGTATCTACCCAATTGCTTAGTGCGATCCTT
GGAAAATAGTAAGTGCTTAACAGATACAATTATTATACACAGGGTGATCAAATGAATTAA
TTTAGATGCACATAGGAAAGCACAGCCAAAGAGCCAAAAGACCTGGTTCTAATCCAGGAT
CTGGCAATTGCCTGCTACGTGATGGCAGAATCACTTATCTTTTGTGCCTTGGTTTCCTCA
CGCATACAGTGGAGATTAACTCTTCTCCTTTCTACTTATACTTTGAGCCCTGTGTGGGAC
AGGGACTATGTCCAATCTGATGAATTTGTACCTAACCCAGTGCTTAGAACAGTGCTTGAC
ACACAGAGTTTTACAGAGGCCTTGTTAAAAGAAGTCTTTAGAATGGGCACAAGTAAGTGG
CCAAGTGCTGAGGTTGCTGGTGAGTTCTTATGACTTCTAGGCATTTGTGTGAAAACAAAT
GTGCTCTGTATTAGATCACTGCTGTTGAATGGCTCTTCTGTACCCTGGGTGGAGATGCCA
AAGTAAGCGTGAAGCAGTTATTCGATGAAAGAAATGAATAATGCTAATTATGGTGGTCGT
TAAGTGCTTACTATGTGCCAAGCACTGTACTAAATGCTAGGTAGATTCAAGACAATCAGG
TTGGACATAGGCTCTGTCTCACACTCTTCAGGAGGAAGTTGGATTTAATCCCTGTTTTAC
AGATGAGGAAACTGAAGCTCAGAGCAGTCGATTGACTTATCCAAAGTCATATGGGAGCAG
GTGATGGAAATGGGGTTAGAACCAGATTTCTTGACCCCAGGCCTGGCTCTTTCTACTAGG
TTATGCTGCTTGTTGAAGCACTTGGATTCGACTGGATTCCAAATCTTTTGATTTCTGGCT
CAACTTCTGATATTTTGAGGAATATCAAAACCCATGGACCTTAGCTCTTCTATCCCTGGA
TATCTAAGTGGTCTTAATCCATCCCAAGCACTCCATATAGTACTTGGCATTGAGGCGCTC
CCTAAGTACTCCGGACTGAATCCCCTGTTCCGTGATGTAGTTCTCATCCGACTGGTTGCA
CATCTGGCAACAAGGTCAGAAATGAATCTATCTTGCCGCGAACCTCTTGCCCACGTCTTG
CCTCTGGCCTGGAATGCCCTCCCTCCTCATATCTGACCAACGAGTTGAGTTCAAAGCCAC
CTATAAAACTTCAAGGCGTGCCTCCAAGAGGCCCTCAATTCCTCTTTTCCCACTGCCTTC
TGCAAGTCACCCTGACTTGCTCCCTTTATTCACCACACCTCCCAGCGCTTAAGTACATAT
GCCTAATTAATTTATATTAACATCTGTTTCCCCCTCTGGACAGTAAGCTCATGGTGGGCA
GGGAATGTGTCTGTTGTGTTGCACTCTGCCAAGAGCTTAGAGTGCTCTGCACACAGAAAA
TGCCATTAAATATGATTGATCGAATACATCGTTCCCCCGCAGACCGCGATATGGGTGCCC
GCCACCGAGCCCGGGCCCACTCGATCCAAATCATGAAAGTCGAGGAGATCGCTGCCAGCA
AGTGCCGCCGTCCCGCAGTCAAGCAGTTCCACGTGAGTCACTTCCCCCTCGGGGGGCGTA
ACGTCGGGGTGCGGTTCTCCATTGGCAAAGTTCTCTTCAGACAGTCCTGGTTTGGGAAGA
GTAGAGCACCTTATGTTGTATACTTCCAACTTCAAAGATTTGGCCCCGGGAAGTGGAAAA
GGTCAAGAGTCAAGGCAAGGTAGGGATTTTCTCACTGCACCCCCAAGCCCCAAAGATCAT
TGTTTCCTTCTTCACAATGATCTTATCTGGGGTGCTGACATCAATTGTACCTCGTCGCCT
TTCAAGAGCTGTTCGAAGTGCTCCTGAAAGTGAAATGGAAGGTTCAACATATTAGGAAGC
TGCTTTGGTAGCCTGCTTGGGAGCTGTGAACGGTATCTGGCCGGGTTGTCTTCCAAGTCT
GTTGGCCACTTAATGACAAATGATGGGAGTCCTAGGAGGCCTTCGGGAAGTGAGGAACAC
TGAGGTAGTGGAAGTGCTAAATGGAGGCTTAGCATATCTGCTCCATTTGCATTTTCTACC
TTTGGAATAAAGCATCAATGCGATTTGCTACTTTGATGAGTTACTGTAGCTTTGCATACA
CAGCAGTTTCAAATGAACACCCAAAGTAAGAGGCAGGTTCTGATTGGAAATATTTTCTTT
GTTAAAGGACTCCAAGATCAAGTTCCCTCTGCCTCACAGAGTTCTGCGCCGCCAGCACAA
GCCACGTTTCACCACCAAGAGACCAAATACGTTCTTCTAAAGGCAGCGGAGGCGTGGTGT
CTGCTGGCAAAATAAACACTCATTTGAAAGGGTTGCTGGTGTTTGGCGTGACTTGGTTCA
CGAGAAGTCTTCCATAAGCCCGGTTCATTCAGAAACTTTCATTCCACGGGTTGGTGTATA
ATCGGACTGAACACGTAAAGTCAGTGGGGACATGGTAGAATTGAGGTTCTACCTTTGAGA
AATCAATCTATCGATAATCTAGACTATGAATTCCTCTTAATCCCTGTTTCACAGCTCACG
GTCTGAGGAGGGAAATCATGTGATTTAATCTGTTTACTCCGTTTTACAGATGGGGAAACT
GGCTCAGAGTGGTTAAATAACATGCCCGTGGTCACACGGAAGACAAGTGATAGCTGGGCA
GAGAATGTGCCTCGTTATATTTCATTCTCCCAAGCGCTTAGTGCAGTGTCTGGCACATTG
TAAGTGCTTAGCAAATAGAACGGTTATTATTATGACTGCCCTGATCCAAACTGCTACCAT
CTTTCCGGTATTCTAACTTATGCAGAGGATTCTAGTTAGGCAAATGGGTGCTTTACTATG
TGCTGAGCATTAATCAAGTCAGCCACATCCCCCGCCCCACATGATGCTTTTTAAGTAGGA
GGGAAAACAGGTTTTGAACCTCCTACTTTTACAGGTGAGGAAATGGAGACCAAGAGTTCA
GTGACTTGTTCAGGGTCCCAGAGTTCAAAGAGAAGAGCTGGGATTAATAATAATGTTGGT
ATTTGTTAAGCGCCTACTAGGTGCCAAGCACTGTTCTAAGCGCTGGGGGAGAGACAGGGT
CATCGGGTTGTAAACTCTGAAATGCAGCAATAACACATTTCGCCAGCAGGTGGTGCCGTT
CTCATGAAAGCCTTCATTCACTCAATCGTATTGAGCGCTTACTGTGTGCAGAGCACTGTA
ATAATAATGATATTTGCTAAGCGCTTACTATGTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGATCAATAAAAATCATAG
ATTCAATAATACATTTTGAATATAGCACAGGGCTGGAAGTCAGGAGACCTGAATTCATTC
ATATTTTTTGGGCACTTATTGTGTGCAGCGTCTCGTTATATAGAGCTTGGAAAGTACAAT
TGGGGGGGAGAGAGACAATACATACCCAACAATGAGCTCACACTCTAGAAAGGGGGAGAC
CAACAATAAAAGAAGACAGGCATCAATACCATCAAGATAGATAAATAGAATCATAGATAT
ATACACACATTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1182, 7473..7602, 11082..11191, 11827..12873
1048..1182, 7473..7602, 11082..11191, 11827..11919
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved