Ornithorhynchus_anatinus Locus NPY
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus NPY
Ornithorhynchus_anatinus
NPY
Ultra65
SNORA7
16310..16462
19774
TCCCGAGGCTCCTCTCACCGCTCCTCCTGAGGCTCCTCTCCCCCTAATCCCGATGCTCC
TCCCACCGCTCCTTCCGAGGCTCCTCACACCCCTCCTCCCGAGGCTCCTTTCTACCTCCT
CCCGAGGCTCCTCACCTCGCTCCTTCCGAGGCTCCTCACTCTCCTCCTTCCGAGGCTCCT
TTCACCCTCCTCTCGAGGCTCCTCGCACCCCTCCTCCCGACTTTCCAAGGCTTCTCGTAC
CCCTCCTTCCGAAGCTCCTCGCACCCCTTCTCACGACTTCCCGAGGCTCCTCTCACCCCT
CCTCCCGAGGCTCCTCTCACCCTCCTCCCGAGGCTCCTCGCACTCCTCTCCCGAGGCTCC
TCACACCCCCTTCTCCCAAGAAAAGAAGCTCTGTCGTCCCCGGGGAGGCGGACGTTTTGC
CTTCCGGGGCCAGTCCCCTCCTCCGGCGCAGAGCCCCGTTCCTCTCTCTGCCGGGCCCCG
GGCCCCCCTTCTTCCCCCGCACGTGTTGGGGGGCAGACGCGGGGGCAGCGATGGAGGGGG
GCGGGACGATGAGGGGGGGTGTGGCGGCGCTTGGGGCGCTGAAACAATCCTATATTTTGA
GCAATTACTGTGTGCAGAGCACTGTACTAAGCGCTTGGGAGAGTACCTTACAGCGATAAA
GAGTGACAATCCCTGCCTACAACGAGCTCACCGTTTAGAAAGGGGTCGGATAAAAGATGG
GATAGAGAAGCAGCGTGGCTCGGTGGAAAGAGCCCGGCCTTGGGAGTCAGAGGTCGTGGG
TTCTAATCCCGGTCCGCCACTCGTCAGCTGTTTGACTTTGGGTAAGTCGCTTAACTTCTC
TGGGCCTCAGTTACCTCATCTGGAAAATGGGGATGAAGACTGGGAGCCCCGCGTGGGACA
ACCTGATCACCTTGTATCTACCCCAGCGCTTAGAACAGTGTTGTAGGGGAGTGGTCGCCT
TCTAGGGAGAGGGGAAAAGAGGTGTGTGTGTCTTTTAGACTGTGAGCCCGTTGTTGGGCA
GAGATTGTCCCTATCTGTTGCCGAACTGTACATTCCAAGCGTTTAGCACGGTGGTCTGCC
CACAGTAAGCGCTCAATAAATACGATTGACTGAATGAATCCCTGCCTCTTGATTCCTTCC
TCCGGCTCGCCCTCCTCTTCCTTGGGGTGCAGATGCAGGGGAGTCTGCGGTTGTGGCCGT
CCGTGCTGACCTTCGCCCTGTCCTTGCTGATCTGCCTGGGGACGCTGGGCGAGGCTTACC
CTTCCAAACCGGACAACCCCGGAGAGGACGCTCCCGCCGAGGACATGGCCAGGTACTACT
CGGCCCTGAGGCACTACATCAACCTCATCACAAGGCAGAGGTAGGCCCGAGGCCCGGTGG
GTGGGGGTGGGGAGGGGGGGACAAAATCCCCCTTTCTTTTTTGAGTCCGCGCAGAACAAA
CTGGACTGTATTTTTTATGGAGGGGCGGTGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGGTATTTGGTAAGCGCTTACTATGGGCCAGGCACCGTCCTATGCGCTG
CGGCGGTTACAAGCGGATCGGGCTGGACTCAGCCCCTGTCCCGTGTTAGGCTCACAGTCT
CCATCCCCATTTCACAGATGAGGCAACTGAGGCCCAGAGAAGTGAAGCGACTTGCCCAAA
ATCACCTAGCAGACAAGACACTAGACTGTAAGCCCGTTGCGGGCAGGGATCGTCTCTATT
GCTGTATTGTGCTTTCCAAGCGCTTAGTACAGTGCTCTGCACCCAGTAAGCGCTCAATAA
ATGATTGAATGAAAGCGGCAGAGTCGGAATTAGAACTCAGGACCTTCCGACTCCCAGGCC
CCGAACTCTAGCCACCACGCCATGCTAGCAGGGCAGGGTGAGGAGCGCTAGAGCTTTGAA
CACCAGTGTGGAGCCCCTTTCCGGAGTTCAATTGCCCTTGCTCTGGCCCAAGCAAGACTC
AGGGAGAAAGAGAGAGACAGAGAGAGACACACACGGCTCTGGTCACACCTCGAGCCCCTC
CGGTGCAATGAGTGACTTGGTAAGACTGGCAAGAGGTCGGAGACTGGTGACCTCCAGAGC
CTGGAAAATGGGAGAGAGGGCAGGACTGGAAGACAGAGAGACAGGCAGGCAGAAAGACAG
AGACACAGAGATAGAGAAACACTGTAAGAGCCAGAGAGAAATTTTATAAGAGTTAGGGAG
AAACACTTGTAGGAGTCAGAGAGAAACTTTGTAAGAGTTAGACACATGGTAGGAGTCAGA
GAGAGAGATAGAGAAAGAGAGAGAGAGAGACTATGTGGATTTGTCTGTGGGCACAGCTGC
CATCTACAGAATCCCCAATTTTCCTGGCCCTGAAAAGAACTAGATTGGGAAAGACACATG
GAATTCTTTTCTTGTCTCCCAAGAATAAACCACATTTTCCCAGGTTTTAGCAAGCCCGCT
TGAGATCAGACAGTCGTTTGAAACTCAATTTAGCATGGATAGAACGATGGACTTTTGGTC
CAAACTGAACCGTAGGTTTTGATTAATTATTTAAATACTTTATTAAATAGTTATAGAGTA
AGAGATTATTCAGTTAATTTTATAGAAGTTGAAACTAACCCATGAATTATTTTAAAAAGT
TTGTCCAATCAAAATGGAATGTGAAACTTGATATCACACAGGCTCTCACAATTCATAAGT
AATTTTTGTCCTCCCTAATGTTCTGTATGACATCAAAAATTTTACTCTGATGTCTTTTTA
AAGCACCCCTTTCATCTAAATTCAAAATAAGAAACTGTGACTGCCGGAAACCAGATAACT
AAAATTATAGTTTACAAACTGAGATGATCAAATAGCCGTGATAAATTAGATAGACTGAGA
CCTTGAACATTTGTGGAGTACTTGGTATTTGCACGGTGTTTTATAATAATTTTTGTGTGT
GATTCCCCACTCAGTGAGGAGTAGAGGGGCTACCCTCTGATGGTACCCTCTAGATTACAA
GCTCATTGTGGGCAGGGAATGTGTCCGTTTATTGTTGGATTGTACTTTCCCAATTGCTTA
GTACAGTGCTCTGCACACACTAAAGCACTCAGTAAATACGATTGACTGACTGGAAATTAG
CCAAAATCAAGCTCTTCCACCACTGTTCAACTTAAAGCAAGGATATAGTCTAAGAAAAAC
TTTTGTTTATATCCTAGGTCATATAGGGTCAGAAAGAGATGTGGATGCCATAATTAAATA
GTAATTTATGTTCTCTTGAAATCTGAAGATTTAATTAGCATGAGGTCACTTTAGAGATGT
ACCAGAAAGATAATATATTCCAGGATAAGAACAACACAAAGCTAAGATTCTAAAAGGAGT
GTGAAGTTTCTTTTCTTTATAATCTCATTTCTTTATAAACACATTTTCCTTCCAGTAATC
ACTCTCAGACTAATGATACACACCCAGTTCTCCTTAAATTCAGGTTTTGCAGTTTTGCAG
AACTGCACATGAGGGGAATCTCATACTGTACCATTCAACCATTCTGATTTCTGACACTCC
TTTAAGGCCTAACCAAATGGGCTGCAGTGTATGAGCATTTCCTAATTCTCACAGTTCTGA
CCAAAATGTAGAGTGAAAACACATTTTAATGCATACTTGAGGGTATTTTGGTAGTTCATT
CATTCAATCATATTTATTGAGCACTTACTGTGTGCAGAGCACTGTCCTGAGCGCTTGGAA
GTACAATACAGCGTGGCTCAGTGGAAAGAGCACGGGCTTTGGAGTCAGAGGTCACGAGTT
CGAATCCCGGCTCTGCCACTTGTCAGCTGGGTGACTGTGGGCAAGTCACTTAACTTCTCT
GTGCCTCAGTTACCTCATCTGTAAAATGGGGATTAAGACTGTGAGCCCTACGTGGGGCAA
CCTGATTCCCCTGTATCTCCCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTT
AACAAATACCAACACTATTAATACAGCAATAAAGAGAGACAATCCTTACCCACAAAGGGC
TCACAGTCTAGAGGCGGGTGAGACAGACATTAATACAAGTAAACAGGCATCCATATAAAT
AAATAGAATTATACATGTATACATATATATAAGTGCTGTGGGGCAGAGAGAGGTGGGGAA
GAGCAAAGAGGGCGACACTGGTGACACTGAAAGGAGGGGGAGCTGAGGAAAAGTGGGGCT
TAGCCTGGGAAGGCCTCTTGGAGGAGGTATGCCTTCAGTAGGGCTTTAAAGGAGGGAAGA
ATGATTGTCTGGTGGATTTGAGGAGGGAGGGCATTCTAGGCCAGAGGTAGGATGTGGGCC
AGGGGTCGGCGGAGAGACAGGCGAGATCGAGACACAGTGAGAAACTTAACACCAGAGGAG
TGGAGTGTGTGGGCTGGGTTGTAGAAGGAGAGAAGGGAGGTGAGGTAGGAGAGGGCTAGG
TGATGGAGAGCTTTAAATCCAATAGTGAGAAGTTTTTCTTTGATATGGAGGTGGATAGGC
AACCACTGGAGATTTTTGAGGAGGAGGGTGATATGCCCCGATTATTTCTTTAGGAAGATA
ATCCCGGCAGCGGAGGGGAGAGGCAGGAGTTTGGGAGGTCAGAAAGGAGGCAGATGCGGT
AATCCAGAGGGGTTAGGATGAGTGGTAGTAATGTATACAGCACAGAGACCTTCCTTTGCA
AATGCTGTCCAGTTTGTTAAGCAGTCACTTGACTAAAATGTGTATTTTTAGAAGGATGGA
GTACATTTTCTTCAGTGAGGTATTAATGAAGGTGATGCCAAAGGCCAAAAGTTTAATTTA
CAAGCTTTCTTTTATCGTTAGAAAATTCTCCTCTTAATCAAAACCTTTGAACTAATCCCC
AAGGTTGACAAACACTGAAGTGGAATGTTCCATTTTCAGGGGTGTTACTGGTGGGTTCTT
CCACTGCCCCTTCTCTCGCCTGTGTGGTGTTATCTGTTCCAGGGACTTCTAACACCCTAA
GCAGGGGCGATATTGCTTTTTCTCAGTTGGCATGTTTAATCAGAAATTTTTACCTTAGTT
AAAAAAAATTCTATCATTTCAAAACTGAAAATGCCATGGAGAACAGTTGTAGGGTTAATG
GATATAGGAGAATAGGGGAAGAAATGTGGCCATTCTCCAAAAATGAAAGTCTAATGGTGA
ATTTCTCCATTCTCTTTGGGGTGCAGGCCTGGATTCCATTAGACACTGCCACTGTGTAAG
CAGGCGATCATGAAAACAAAGGTGGTTGAAAGGGATATAGAATCCATTTCCCAATCTCCA
AGCAAGCTTCCCTTAAACCATGAATAACTGTGAAAAACAGGTGGCTGGTTAACTAGCTCA
TTATTCAGTGACATTTAAAGAGCATTCATTCATTCAATCATATTTATTGAGCACTTAATG
TGTGCAGAGCACTGTGCTAAGAGCTTGGGAGAGTATAATACCACAATCAATGGACACGTT
CCCTGTCCACAGTGAGCTTACAGTCTAGATGTGGGGAGACAGACATCAATACAAATAAAT
AAATTACAGATATGTCCATAAGTGCTGTGCGGCTGGATGGAGGGAAGAGGAAAGGGAGCA
AGTCAGGGACAAACAGAAAGGAGTGGGAGATGAGAAAAGGGGGAGGGGGCTTAGTCTGGA
AATGCCTCTTGGAGGAGATGTGCCGTCAATAAGGCTTTGATGTGGGTGAGAGTAACTGTC
TGTTGGCTTTGATGAGAGAGGGTTTTCCAGGCCAGAGGCAGGTTGTGGGCTAGGGGTAGG
TGGCCAGATAGGCGAGATGGAGACTTACTGCTTGAGAGAGTATGATACAACAACAGACAT
ATTCCATGCCCACGATGAGCTCACAGTCTAGAGGGGATAGCATAAGTAGACCCATCGGCA
AGATCCCACGCTCAAGGAGTTTACATTCTCCTTATGAGTGCCACAGAGGTTGATTTTAAA
ACTCATCTTTGTGACTTAACTACCCCTGGAGCCAAGTTTTCCGTATTGAATATGAATCAA
TCAATGGTATTGAGTGCTTACTGGGTGCAGAGCCCTGTATTAAGTGCTTGGAAGAGTACA
ACAGAGTTGGTAGACACTCTCTAACCAGAATCTTTCTTGCTGCAGTTTAAACCCATTTCC
TCTTGTTTTGCCCTTACTGGAATTAAAAAACAGCTCAGGCTCATTAATCATCTTTTGTAT
CACCCCCTGCATAAGTCTTATGAGCAGATAGTCAACCGTCTGTCTCTTCTTTGGGTTCCA
CTTTTTTCCCTATCCCTTGAGGAGGGTTCTAGAGTTAAGAGCTGAACACCCAAAGGATGA
TTAAACTGTTCCCATCATTCTATGGTCCATACCATTTCTGTTCAAAAATAAGTGGGTTGT
TACTAAACTAAAAGTTAGGGATTTACACTTCTAGTCATTATAGTGGATGTTGAGGATGGC
ACACAACATAGAAAGTTCCTCAGCACACAGTTCCTCTAACTCCCACACTTGTGCTCTTTT
CAGTAGGCTAGGTTCTTTCTCAGTTTCTCTCCAATAGTATCTCCAATAAGAACGAGAAAA
GAGGGAACATTAGCCTTAGTTAGAGAAGGGATCATGGTGGTTAGATTCCACATAAGCAAA
ACTTCCTGGCAATTAAGTTAATAGGCAGGAGAATGGGTTGCTAAAGGAAATTATATGATC
ATTTCTCTCAGCAGTCCTTGAGGACTGGATACTTCACTGCCTTAGGTAGCTAAGGGGTTG
CCCTGTGGGGAAGCTCAGAATTAAACTAGATGGAAGGTTTGAGATCCCTTTCTGCCCTGT
AATTCTGTACGAAAAACAATAGCATGCAGTTGATTTAGTGGGGTTTGGAAATTAACATAG
ATTTTAATGACTTAGTTTCAAGTACAAAGTTGTAAAAAGCCCTGAATTCCTTTTTAAAAA
TAGAGAAAATATTTGCCATTTTACCTAAATCAGTAGGTACCATGAAGATGGATGAATAAG
GTTTGGAAAAGAGTTTCAAGCTTAGTTAAAGTTAACAGGTCAGTGAAGTGATCTGAATCA
AATATACCTTTACAAAGGAAAACAGTGTGGTGTCCTACTTCACATATCATGGCACCTGGA
TGAAAGTCCCTAATTTCAAAAATCAAAAACCAGTTGATTCTGCTTTCCTGAAAATCTTTC
TGTTGTATTGCACTCTCCCAAGCGCTTAGCATAGTTCTCAGCACATAGTAAATGCTCAAT
AAATACAATCGATTGATTGATTGATTGATTGGTGTCACTAGGGAAGCTTCTTGAAAAGTT
AAGCTTGAACTCTAACCAGCCATGTGAATAATGTGACTGACAAAAAAAAAAAGACAAGAG
TTTACTCATTTACTCCCCTTACTAGTTTAAAAAATCCAGTTAAAATGTCACTGGTCATGG
AAGGGGGTCTTTTAAGAAATATTACTTGGGGTTTTGTCTTTTCAGAAATATTACTTGGGG
TTTCATCTTCTTGCAAAGGACTTGGTCATAGCATCATGATTAAAATAAGGGCATAATTGC
CATCAGCATAGAAAATAGCCACTAGCCATTTCCTTGAGGTGAGTCATTCATGCCAGGCAA
GTGGAATAGAATGTGGATTTCATTCATTTTACTAACACTGAATCTCGGAGTGGGGAGGAT
AGATAATAGACACTTGTTTGTCATTGGAACGATTCAGTCCTCTAGACTGTGAGCTCACTG
TGGGCAGGGAACAAGTCTGCAAACTTATGGCTAGGGACCATAACAACGATAACAAAAGAA
TCACCAGAAAGGTTACGGATTATGGCAAAGAGGACGTTCAGAAGAAAAAAAATCCATAGA
GTCGCTATGAATGGAAACAACTGGATGGTACCTGATAATATATACAAGTTCATCAGGTTG
AACACAGTCCCTATCCCTCAATCTTTTATAAGCATCCATCTGGGCCAGATAGGGGTTCGA
TAGAGGTTGTCTGATTCCAGTATGATATGGGTGCAGCGTGGCTCAGTGGAAAGAGCATGG
GCTTTGGAGTCACAGGTCATGAGTTCGAATCCCGGCTCTGCCACTTGTCAGCTGTGTGAC
TGTGGGCAAATCACTTAACTTCTCTGGGCCTCAGTTCCCTCATCTGTAAAATGGGGATTA
AGACTGTGAGCCCCATGTGGGACAACCTGATTCCCCTGTGTCTCCCCCAGCGCTTAGAAC
AGTGTTCTGCACATAGTAAGTACTTAACAAATACCAACACCTCTAGACTGTAAGCTCCTG
TGGGCAGGGAATGTGTCTTTTTATTGTTGTACTCTCCCAAGCGCTTAATACAGTGTTTTG
CACACAGTAAGTAATAAATTCAATTGACTGACTATAATGGGACAGCCTTGCCTACAGCCC
CTTTGAATATTTAGCCACAAGATACCCATCCATTTCCTAGTCCAAGTGGACAGGTCACCT
GGTTGGATTTTCTTTTTTTAAAAAGCTTCAGAATGAACAAATTGTCAGCACTAAAGGAAT
TAATTCAGCAAAGTTGTGCTAACAGATGGTCTTCTTTCAATGTACTCATATTTCTTAAAT
GGTTCTTTAGAAACTCATCAAAAACATCTGGAACAGTTCACTAGCAGTAAAGAAACAAGC
AATGAAATGGTTCGTTTAAAGCTGCTGGTACATGATTACATTGTATTTACATTTGTGGCT
CTGAAACTCTATGATATGAGTGTATATTCTAGGCAACTATTTGTGACCCCTAGCATGATG
AGAACTTGATTGCAAAATGCTACTGTGCTGTCATAATTTCAAGAACCTTCCTAAGTAACT
CTTGGGTACATCCCCCGCTCTGTAATGTGAGCACACTGTGGGTAGGGAATATCACTGTTT
ATTGTTGTATTGTCCTTTTCCAAGTGCTTAGGTACAGTGATCTGCACAAGTGCTCAATAA
ATATTATTGAATGAATGAATGAATAAAATGAACTGAGAAATAATTCAGTTTCTGATGGAT
GGTTAAAATGGGGTTGCTGGCAAGGTTCACAGCATTTACAGATCCGTAATTTATTCATTT
TTATTAATGTCTGCCTCCCACTGTAGACTTTAAGCTTGTTGTGGGCAGGGAATGTGCCTG
TTATATTGTTCCATTGTACTCTCCCAAATGCTTAGTACATGCTCTGCACACAGTAAGCGC
TCAATATGTACGATTTATTGATTGATTGATCTGGAAAATGTTTTTAGAGGATAAGCATTC
ATCATATCAGCTAATTTGCTATTTAACAGGTGTGCAGAAGTGGACGATTTAGATTATACA
CACTGTATGTTTGCAACCAGGGACTGTGTTACTATTCCAAATTTGGTTTAAAGATTTTTT
TCTATTTTTCTAGATATGGAAAGCGGTCCAGCCCAGAGACACTGATTTCGGATCTCTTAC
TGAGAGAAAGCACAGAAAACATTCCCAGAACCAGGTAAATATATACTATTGTACAGAAAC
TTGATATTAGCTGCTTTAATTAATGTTATTTCTCATGAACAGAAAATCTGAACCTGAATT
TAGATTTCAATGAAAAACCCAAAATCCAGTTGTCATCTATTCAAAAAAGAACTGACTAAA
TTAGAAATTGTTTCTGCATACTGAATGTGAAATGAACCAATTTTTTAAGAATTTGTTAAG
TGCTTACTATGTTCTGGGCACCGTACTAATTGCTGGGATCAATATCAACTAATCAGATTA
AACACGGCCCATGTCCCACATGAGGCTCACAGTCCTAATTCCTAATTTGCAGATGAGATA
ATGGAGGCACAGAGAATTTAAGTGACTTGCCCAAAGTCACACAGCAAAGTGGCAGGGTCA
AGATTAGAACCCAGATCATTTTGACTCCCAGGCCAGTGTTCTATCCACTAGGCCATGCTG
AAATCTGTTCACCTCCAGAAGGCCACTTCTGACTTTAAATACTTCAAAGAATAGTGAATT
TTTATAGGAGAGAAAATGGGGACATTATTCTAAACTCTAACCATAGCATAGGTTTTGAGT
ACATGTAAAATTATCTTTCTACCCTTACTACCCCTATCCCCTGACTCATTATGGCCTAGC
TGGTCTATGAAAGACTTGAAGACTGAAATGTTGTTTGGGTTCTAGTTTTTATTCATTCAT
TCATTCATTCATTCATTCATTCATTCAATAGTATTTATTGAGCATTTACTATGTCCAGAG
CACTGTACTAAGCACTTGGAATGTACAAATCGGCAACAGATAGAGACAGTCTCTGCCCTT
CGACGGGCTTACGGTCTAATTGGGGGAGACAGGCAGACAAGAACGATGGCAATAAATAGA
GTCAAGGGGAAGAACATCTCATAAAAACAATGGCAAATAAATAGAATCAGGGTGATGTAC
ATCTCATTAAACAAAATAAATAGGGTGATGAAGATATATACAGTTGAGTGGACGAGTACA
GTGCTGAGGGGGTGGGACGGGAGAGGGGGAGGAGGAGAGGGAAAGGGGGGAGAAGAGGGT
TTAGCTGTGGAGAGGTGACGGGGGGGGTGGTAGAGGGAGCAGACGGAAAAGGGGGGGAGC
TCGATCTGGGAAGGCCTCTTGGAGGAGGTGAGCTTTAAGTAGGGATTTGATCATCGAGAG
TGGGAAGTGAGGATGGGGGGCAAGGTGGGGAGAGATGCTTTTGGAAAGTCGGATGGGATC
AAGAGAGCGGAGGTCTCTGTGGGGGAGTAGCAAAGATTTTAACCCTGACATGGGATCTAT
AGGGGTGTCAATCAATCAATAATATTTACTGAGCACTTACTATGTGCAGAGTGCTGTACT
AAGCACTTGAGGGAGTAAAATACAACTGAATTAGCAGACACATTCCCTGCCCATAATGAG
CTTTGAATTAATTAATCAATAGTATTTACTGAGCACTTACCTATGTGCAGAGCACTGTAC
TAAGCAGCTGGAAGAGGACTGTACAATAATGTTGGTAGATATAATTCCCTCCCACATCGG
TCTGGTCTGCAACAGGGTCCCGCAACCTCCCTAGACCCAGCCTCGGACTGTACGAGCTCC
TGGGATTCCTCTCCCTCCGGTCACTTGCTACTTCTAGTGGTAGGGAAGCATCATGGCCAA
GTGGATAGACCATGGGCCTGGCAGCCAGAGAACCTGGGTTCTAATCCTGACAGGGAGAGG
GTCCAACCTGATTAACTTCTATCTACCCTAGCGCTTAGAACAGTGCTTGGCACAGAATAA
GCGCTTAACAAGTACCATAACTATTATTATTATTGTTACAAGATCCTGGGTCAGTTATTT
GGGGGGACTCCCCAAGATCAAGATGAGACAGTGAGACCCAAGCTTTGAGCTGCCTCTAGC
TCAGGGAACAGAACAGCAAGGGACAACTGGGTCCCGACCCTGGATCAGAAAATGGGACGT
AGGTTTCTACTCGGGGAAGTAGCCGACTAAATTCAACCCCTGCCTCCCCTCTAGCTCAGA
GTATAGTGTTACAAGGGACAGATAGGAGGCAGAGCCAGGACAAAGGAGACCCCTGAGTAC
TCCAGGGTCAGAAAACAGGAGCTGAGCAGGCCTTGGGGAGTTCAGGGAATACACTCAAAT
CTACAACATACCTGGACTCAAGTAATATGGACTGATAGGATAAAAGATATTGCCTCACCC
TCCAAATGCAGAAGGTCAAAGCCTTATATTTCAAAGCAGTACTTCTCCTTTTTTGTTGGC
TGGGAATACACCAGCTGAAATAGCCTTCACCTGGGATTTTGCTGCTTATGTATTAGGCTT
ACTCCAACACATTGAAACCAAAAGAGGCAGTGCCCAGAATTCTGGGTTACCCTGCTATCT
CTCATTCCACTGGGCACCACAGATCACAAAGGATGAAAAGCTGTGCTGCGGAGTACAAGA
TGTGATGTAGGTTTCATTTTTACTTGTAATATAGTAACATTAGGATGAAGTTCTGCCAAA
GTGAATAATGAGAACCTGACTTAGATAACAATAGCGGTGTTTGTTAAGTGCTTACTATGT
GCCAGACACTGTTCTAAGCAGGTGGATACAAGCAAATCCGGTCGGACACATTCTCTGTCC
CACATGGGGTTTACAGTCTTAATCCCCATTTTACATTCGTTCATTCATTCATTCGTATTT
ATTGAGCACTTACTGTGCAACTCACTGTACTAAGTACTTGGGAGAGTACAATATAACTAA
GCAGACACATTCCCTGCCCACAGTGAGTTTACAGATGAGGTAACTGAGGCACAGAGAAGT
GATGTGACTTGCCCAAGGTCAGACTGCAGAGAAGTGGTAGAATCGGCATTAGAACCCAGA
TCCTTCTGACTCCCAGGCCTGTGTTCCATCCACTAGGCCATGAGCCAGATTTGTGGGACC
CTTGCTACAGACCCTGGTGAGATGCCTAGTAATGGAAGAGATATAGTGAGGCACAAAATT
GAAATTATGGCAGCTAAATTTCTTGCTGGCCATGTCCCTAAACTTGAGCAACTCCTTGTA
CCTTCACTCTGAATAGAAGGTCCTCCTGTCCCCTGTAGCTTTGGCCTTGGCCACGCTGGA
TGACACGGGAGGGAATGTTGGAGGAGAGGAGATTTTGCTAATTAACTCAAAACCAATAAT
AATAATAATTACGGTACTTGTTAAGCACTTACTGTGGGCTAAGCACTGTTCTAAGCACTG
GAATAGATACTAGTTATACAAGTTGTTATGGCTAGAGGCCATAACAACGATAACAAAAGA
ACCACCAGAAAGGTTACGGATTATGGCAAAGAGGACGTTCAGAAGAAAAAAAATCCATAG
AGTAGCTATGAATGGGAAACAACGGGATGGTACCTGATCATATATACAAGTTCATCAGGT
TGAACACAGTCCTTATCCCTCAATCTTTTATAAGCATCCATCTGGGCCAGATAGGGGTTC
GATAGAGGTTGTCTGATTCCAGTATGATACGGGTCGAGAAGTATGGCGGTAGATCACCAT
CAATAGTATTTATTGAGCACTTACTGTGTGCAGAGCACTGTAGTAAGCGATAGATCAGGG
ACAAGAGTTGGGAGACCTGAAACCCTCCAAATGAGAGGGCCCAGAAGTCAGGTGCTGATC
TTAAAGGAACCAAAGAAAAATGGTTCTACTTGATTTCTTAGTTTCTTAAGATTGCAAGTG
GAACTTTCAGATATGGAGGGTTATAAGCAAAAGGACCGGAAGTCACTTTAGGTTTAATCT
TTTAGAAATCTTTGAATCCAGATTAGATTTTGTTAATTAAACCAACTGAGGTAGGGGATC
AAGGGTACCCATCCTCTCTACCCCTAAATCGAATAGGTTGTACAACTTAATTCTTATGCA
TTATGTACCCCACCCTCACTGGCTCCTTTCCAGGATCCTAGATCCAAGCCTGACTCATAG
GCCTCATCACCATTCTGAAAGGAGAAGGGGCAAACTTGAACTGACATGGTGGGTGTGAGG
GTGAACAGAGGGATTTGTGGAAAGAGTACGGGCTTGGGAGTCAGTGGTTGTGGGTTCCAA
TCCCGGCCCTGCCACTTGTCATCTGTGTGACTTTGGGCAAGTCACAACTTCTCTGTACCC
AGTTACCTCATCTGTAAAATGGGGATGAAGACTGTGAGCCCACATGGGACAACCTGATTA
CCTTGTATCTACCCCAGTGCTTAGAACAGTGCTTGGCACATAGTAAGAAGCGCTTAACAA
ATACTAACATTATTATTATTATTATGAGCTACTAGAGTGCCCAGCATCTGAACATAGGGC
AGCTAGTAGTTCATTCTCTCTCTGTTAATGGGGTGAAACAGCTAACAGAAGCAGCGTGGC
TCAGTGGAAAGAGCCGGAGCTTGGGAATCAGAGATCATAGGTTCGTATCCCAGCTCCGTC
GCTTGTCAGCTGTGTGACCCTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTCCCTCA
TCTGTAAAATGGGGATGAAGACTGTGAGTCCTACTTGGGACAACCTGATTATCTTGATTC
CACCCCAGCACTTAGAACAGTGCTTGGCACATAGTAAGCGCTTAACAAATACCAACTGTT
GTATAATACTACCTAGGGGTCAGGATGTCACACTGCACTTTTTCTTTTACCTGAGTGAGC
CTGGAAATATTAATAATTTTGTGGCATTGAGCTCAGCTTACTAAGTGTAAAGCGGGGACT
AAAACCGAGGGGGCAATGTGGGTAGTATACTTTACCCTGTGGGGTATATTTTATCTACTC
TAGTACTTAGTAAAGTGTCTGGCACATATATACCATACGTTTGACAAATACCATTGTAGA
AAATCACTCAATAATATTTATTGATTATCTATTCATTCGATAGTAGTTATTGAGCGCTTA
CTATTTGCAGAGCACTGTACTAAGTGCTTGGAATGTACAATTCGGGCAAACAGATAAGAG
ACAATCCCTGCCCAAGTGACGGGCTCACAGTCTAATCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTATGTCCTTATTTTGGCAGTTTTACACCTGAATTGTATTCAGTAAATTA
GGAAACTGGGAATGAACAATCTGAAGGTAAAAATCAATAATCAATCAATCATATTTCCTG
AGTACTAACTGTGTGCAGAGCACTGTACTAAGCATTCTGTTAATCACCCTATGAGAACTG
GGGGTTTCAGGGAATCGTTCATATTAAATTTATTCAAGTCCTTGGCATTTGAATTATTAA
GTAATGATTTGGTCACTGGAAAGCATATTCTGTTGGAGGGGTAAATAGTGATGGTAACCG
GTAAGAAGCAGTCTGGCCTAGTGGAAAGGATGCAGATCTGGTACAGTGCTCTGCACATAG
TAAGTGCGCAATAAATACCATTGAATGAATGAATCTGGGAGTCAGAGGAACCAGGGCCTA
ATCCTGGTATGGAGGGGACAGAGTGGAACACACGAAACCTTGAGAAACACCCCAAACTAG
TCCCAAATGGGCCCCTGGCAATGGGGATCATAAACCATCTAGAGTTCATACAGAAACTTC
GGCTGGTTATATGTTAAGCAGAGCATGAAAAAGTGGATACAACGAAAGGTACAAGTTGGG
AGGCCTTGGACTTCCACGGTAAAGCTATGGCGAAAGAACAAATACCCTCTTCAGTTCTCT
CCGCCAAACATCCTCAGATTATTATCCATTTGGCAGCAATAGATCTCCCATTGATTGACT
GGCAGAGACTTAGGAGGGATAACCATGGCTCAGTGGAAAGAGCACGGGCTTGGGAGTCAG
AAGTCATGGGTTCGAATGCTGTCTCTGCAACTTGTCAGCTGTGTGACTTTGGGCAAGTCA
CTTAACCTCTCTGTGCCTGAGTTACCGCAGCGTGGCTGAGACGCAGCGTGGCTCAGTGGA
AAGAGTGCGGGCTTTGGAGTCAGAGGTCATGCGTTCAAATCCCGGCTCAGCCACTTGTCA
GCTGTGTGACTTTGGGCAAGTCACTTAACTTCTCGGTGCCTCAGTTCCCTCATCTGTAAA
ATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGGTTCCCGTGTCTACCCCAGCG
CTTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATATCAGCATTAAAATGGGGAT
TAAGACTATGAGCCTCATGTGGGACAACCTGATTACCCTGTATCTACCCCAGCGCTTAGA
ACAGTGCTCTGCAAATAGTAAGCGTTTAACAAATGCCAACATTATTATTATTATAAGAAT
GAGGGTTTCATTCTCAATTGAATTATTGATAATAATATTTATTGAGCATGGACTGCATAC
ACAGCACTGCCCTTAGGTTTTGGGAAAGTAAAATAGACCTAGAAGACGTGATCCTGCCCA
CACTGGCTCACTGTAATAATAATAATCACCTCTCAGGGTCAATAAAAATAATAATGTTGG
TATTTGTTAAGTGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGACACAGGG
GAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTCATCCCCATTTTACAGATGAGGGAAC
TGAGGCCCAGAGAAGTGAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGCAGAGCT
GGGATTCGAACCCATGACCTCTGACTCCAAAGCCCAGGCTCTTTCCACTGAGCCACGCTG
CTTCTCTACCTGGAGAGTTTCCAGTCCTCTACCAGTCTTGACTATGGGAGGGAGAGTCAA
GCAGAGGCATATCCATTCCATTCCCAGCTTGGGCAGTGGCTCTCTCTGCCGGCTGGAGGC
GGGCAGGGTGTCTGGCAACCCTGCACAGAGAAACACTGTGGACTGGCTTTACGGGCAGCC
CAGAGTGTGGAGGATGGCATCCTCTGTGAGGGTGGCACACTACTGTGGGCTTGACCAGTA
ATAATGGGCACACAGTCCTAAGCATTCTGCCAGGAACTCAACTGCTGCCATCTGACTTTC
CTTTGCCCCTGGGCCTGCCATCAGGAGGGGCTACCACCCTGCCAGTTCATCTTGACATTG
CTCCATTGGAACCAACCATAATCCTGGCTCCAGTGGAAATCAATCCATCAGTGGCATTTC
AGCGCTTGGCTCATTGTAAGTGCTTAGCAAATACCATCATTATTACTGAGTGCCTACTGT
GTGCAGAGCACAGTACTAAGTACTTGGGAAAGTATAATTCAACCGAGAAGCAGTTACCTC
ATCTGTAAAATAGAGATTAATACTGTGAGCTCCTTGTGGGACGTAGACTGCGTCCAACCT
GATTAGCTTGTATCTACCCCAGGGTTTAGTACTGTGCCTGTCACCTAGTAAGTGCTTAAC
AGATACCATTTGAAATCAATCAATCAATAAATAGAGTTGGTAGACATATTCCTTGTCCAT
GGTGAGCTTAGATTCTAGAGGAAACTGAAAGAGGATCAAAGGAAGCCTGAATCCCATTTT
AAATTTCATATCTCCTATCTCTTGGCCATCACAGATTCTAGAGTATAGATAATGAAGAGC
TAACTTCTTTCCAGGAAACAAAAGCTATAATAGATCATATAGCGAATCACTGAAGACCAA
ACACCTACTGTTTAACACAGATAGTCTCACGTTGTCTATTTAGTTACCACCAAAGCATTG
ACCAAAAATCATCTACCCTCTGACCCTAGCCTTTAACCTTAGATCTAATTATTTTATTAA
GTAAGTTGTCCTTCAGTTGATTTGGGTTTGGTGACAGCATTTATTTAGTTGTTTTACTGA
AAGCCACTTGTCACCAGCCCATCAAATAGACATTCAAATTTTAACTAGAAATTTGTACTT
ATATCCTGATAAGCAGCCACCTATATTGGTGAAATTGTGGAATAGACTAGAATTCTATGT
GAATAGAGGTTTTTCTTATTATTACCATTACTGTATTTGTTAAGCACTTACTCTGCACCA
AGCACTGTTCTAAACACTGAGATAGATATAGATTAATTAGGTTGGTCATAGTCACTGTCC
CACATGGGTCTCACAATCTAAGTCAGAGGGAGAGCAGACATTGAATCCCCATTATACAGA
TGAAAAACTGAGGCACAGAGAAGCTAAGTGATTTGCCCAAGGTCACACAGGAGGCAACTG
GCAAAGCTGGGATTAGAACCCAGATCCTTTGACACCCAGGCCCAGGTTCTTTCCACTAGG
CCACAGTGCTTCTGTGTCTTTACTAAATAGGATCGTAAACAAAAGAGTCTTTCAGAAGGT
CAGCAAGATGCATTGACTGAATTGAGTATCCCTTGCTTCCTTGTGTGAACTCTATGGTTT
CTGATCTCTAAAATATTAATAAGCACAAAGCTTTTTTCTCCCTCAAACTTTCATTCTGTA
CCATTCAGATTTAGCCTCAAACTCCCTCCTAACATGGTGAGGGTGTCACAGCTACGTTTT
TTCACACTGAAAATGCCTTCTTGGCTTGGTTCTTAGACTGTAAGCTCATTGTGGACAGGG
AATATGTCTCTTTATTGTTATATTGTACTCTCTTAAGCACTTAGTACAGTGCTTTGCACA
CGGTAAGCCCTCAATAATGACAGTTGAATGAATGAAATAATTAATTAGGTGTTTCCAGTG
GCAAATGAGCACAAATATGAACACAGTCTTCAATGCTTCTATTTTAATAGTAGTAATGCT
ATTTACTGTATACCTCCTGAGTGCATTGTCCTGTACTAAGTGCTTGGGAAGTATAATACC
AATTCCCTGCCTGCTCACAGGGAGCTATACTCTAATAGAGGAGCTGATACTCTGCTGATC
TCTCAGAAAGCTGTGATTTTTTTCATTAACATATTTCCGGTGTATATTTCCAATGTTTTA
CAGGTTTGAAGACCCTTCTATGTGGTGATGGAAAAATGAAACATCCTCAGTATTTTTTTT
CCTATTTTCAACCCATTTTTCATGCTGTAAAAGCAGAGTTTACCAGTCCTCCCAGTACAA
CCAGTGCATGAAACCATCATACTGAATTCTGTAGCATTTTCCTTCATTATATTTGTATAT
ATGTTTATTTAAATAAATGATTGTGCATTCAAAAATGTAACATACTAGATGAAAAAAATC
TATCATTGGAATAGTAAGAGTTGTTTTAAGCTATTAAAATTGAATTATAACCTCACTAAA
GTCTAAAGTACATGTACAGCAGTCATTTCCCCAGTGTCAATGTGATCGTGAAAGGTAAAA
TGGTGTTTTCATTTGGCAAGACCAAGCCCTGGATCCTCCCGCCTCCTTGGCCCAGCCTTG
GCCCAGCTTGGGTCTGACCTCGTCGGACCCCCGTATCTTCTCTCGGCCCTCCAGCTCAGC
CGTCAGCCTGGCAGCCCACACCTCAGCTCTGCACAGTTGCAGAGTGCCCTTCCGCCAGGC
CCAGCCCTTCGCAAACCTGCCAGACTTGACAGGGAGAGGGCAAACCCTCTTCCCAACCCA
GGGACCCTTACTGGAAGCTGAACCAGTAAGCAGTAACCACCCTCCCCATCCTCCTCTGTC
CTCCTCTGCTCTGAAGAAAATGAACTCTGCTTGTGGAGAAAACCCTCCTCTTCCAGCCTG
GGGGATGTGGAAACTCACTGCCATCACTTACACCCACCACACACACATAGAGTTTCACAC
ATACTTAATCGAGCACTTAGCACAGAGCTTTGCACACCGTAAGTGCTCAATAAATATGAC
TGAATGAATGACATTGACTCAAACAGAAAAAGACACAGGGAAATACTAGCACACCGGTAG
ACACACACACCCTTGAGTGATTACCTAGATATGTACAGAGGAATGTTGACACAACCATCC
AGACACATGATGACACAAACAGGGACACTCATACACAAGAGTATATACCCACACATACAT
GTGTTAGCCCACGCACAAACAAGCAAGAAGTAATGGCATTCATTAAGCATCAGCTTTGTG
TGATGCACTGTTCTAAGTTATTGGAAAAGTACAACAGAAATACAGCAGAGGCACCAGGCT
GATTATTTGATTATTTTATATCCATCCCAGCGCTTAGGACAGTGCTTGGCACAAAACAGG
CAGTTAACAAATCACCTGTCATCATTATGGCAACTATGGTATTTGTTAAGCACTTAGTGG
AGAAGCAGCATGAACTAGTAGTTAGAACAAGGACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1359, 9493..9573, 18483..18774
1172..1359, 9493..9573, 18483..18774
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved