Ornithorhynchus_anatinus Locus Mono:SNORA4
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA4
Ornithorhynchus_anatinus
Mono:SNORA4
Ultra647
SNORA4
16..152
1152
TGCTCTGGCCCGTGGGTTCCAAAAGCCAACGTTGCGGGGAAGGCCGTGACCAGCCTTCG
CCGGGTCGGGCTCTTTGGAAGAGAAAAAAAGACCGCACTCCACGGTGGACTATATATCCG
GTTGTAGTTCATTACTGTAAGGTGGCCAACAGAACAGACTCGGGCGCTCGTAATTTCCGC
GGCCTAATCGGCACCTCCTTGTTGGGATTCTAGGCTCGTGGGATCGACGTGCAACAAGTT
TCTCTGGTAATAAACTACGACTTGCCTACCAATCGTGAAAACTACATTCACAGGTGAGTC
GGCCCCCCGACCCCCACTCAAACCCGACGGACCTAACGTCGCTCTTGTTTACAGCGCGGT
CAGTCACTGGCCTCGGTCTTCGGTGGGATGCTCTGGTCAACCCAAGCCAGTCTTAAATGT
GAACCGGCTTTCCGGGTGCGCGTTTCCTGTGGGCTTCTCGGGTTAGCCTTTGGGGAATTA
AGGCCCCCAAAGTCCCCCCTCTCTCATCCCCCAACCGTGCGTGGTGGTGGGTCGTGGCTC
GAGCAACGTGCCGAGGTGCTTGGTGTTTGCTTCGCCTGTTAACTTGAAGGAGAAACGAAG
ACTTAGCCACAAATTTGCTGCCGGAAGAGACTTGTCGTGCGGTCCGACTTCCCGACTTTT
TTAAAGAGTCGTGCGCTCGTGTTGCTTGTCTCGTGCCTTCTCGGCGGTTCTCCGGTGTTC
TTCGTAGCGCTTAGTTCGTTCCCTGGCCTAGCTGTAGCGGCTTTATCCCCGAATAGATTC
GACTGTGCTTTTGTTACTTGATGTAAAAGAGACTTTTTAAAAAATACAGGAGTCGATAAC
AGCAGTTGATGACGTGAGATGGTGCTCAGAAACGGCGTTGGCGTAATTTAGGACGTGGAT
TCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATCTGTTTTT
CTTTTGTCATGATTCTTTGATGTACTTGATCGCCCTAGCCAGGCCTCTCTGTGTATTCTT
AGCTTTTGTATTTAGGTGCTTCTTGTCTCGCTTGTTGTGAAAGGAAGGAAGTCAGAACTT
TTGGGGGGGGGGGGGGAACAAAACGCACGATGCGGCTGTAAGGGGACCGAGAGAGCAAAA
GAGCAGTGGATGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved