Ornithorhynchus_anatinus Locus ENSOANG00000012198
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000012198
Ornithorhynchus_anatinus
ENSOANG00000012198
Ultra61
SNORA29, SNORA29
1001..1136, 4194..4329
11379
GTTGGTTAAGCGCTTACTGTGTGCAGAGCACTGTTCTAAGCACTGCGGGAGATAGAGGG
GAATAATAATCATGTTGGTATTGGTTAAGCGCTTACTAGGTGCAGAGCACTGTTCTAAGC
GCTGGGGGAGAGACAGGGCCATCGGGTTGTCCCACGTGAGGATCACAGTCTTCATCCCCC
TTTGACAGATAAAGTCACTGAGGCACAGAGAGGTTAAGTGACTGTATAATCATGTTGGTA
TCGGTTAAGCGCTTACTAGGTGCAGAGCACTGTTCTCAGCGCCGGGGGAGAGACAGGGCC
ATCGGGTTGTCCCAGGTGAGGCTCACAGTTAATCCCCATAGTACAGATGAGGTAACTGAG
GCCCAGAGAAGTGAAGTGACTTGCCCACGGCCACAGAGCTGACGAGTGGCAGAGCGGGGA
TTCGAACCCATGACCTCTGCTTCCCCAGCCCGGGCTCTTTCCACGGAGCCACGCCGCTTC
TCGTGGGACAGCCACCTGATGACCTTGTATTCCCCCCTCTCCAGGGCTTAGGACAGCGCT
TAGCACATAGTAAGCGTTTAACGGGTACCGTTATCATCATCAAGGTCCACGCGGGGCAGG
GACCGGGTCCAACCCGATTAGCGGGACGACCCCAGCGCTTAGTACAGTGCCGGGGACAGA
GGAAGCGGTGTCCATCTGTGGAAGCTCCGGGCCCGCCCCACTTGGTCCAGCCCGCCCGGA
GACGTGCCCAGGGTCTGGCCCGCTGCACGAGAGAGGAAGGAAGCCGTGGGCAGAATGGAG
CTTAGGTGACGCCTCGCACGTGTCGGCCGGAGCCTGCGGAGCCTCCCGGGCCGCGGTCCG
CTTCCCCGTGGTGCTTAGCCGCCTGGGGTCCAGGCCAAAGTCCGGGCTCTCCTGCCATCT
GGGGATACGTCACCCAGTCGGTGCTGTTGAGCACTTACTGTGTGCAGAGCACCGTGCCGA
GCCCTTGGGAGAGTAACAGCCATCACAGTAGGCGGGACAGTGGGTGGTGGTCGAGCGCTT
GGTGTGTGCCGAACCTCTGGGGGAGGACGACATAACCACCAGCTCAGAGCGCGGGAGACC
GTGTCCGAAGCTCGCCGGGGGCGGGGAATGCCACTTGATGGCTCTTTCCCGAGCGCTCAG
TACAGCGCTCTGCACGCGGGAAGCGCTCCGTAAATACGACAGAGCGAATGACAGTCGGCG
GCTTTGACGGAGCGGTCGACTGAACGCCCGGGTGAGTACAGGGCAGCAGAGTTGGTGGAA
ACGCGGGCTGCCCGCAGCCGGGGCAGGCGGTGAACTGCGTTGAGCGCTTAGGTGAGTACG
CTGCAGCCAAATGGGCAGACAAGATGCCCTGCCCGCGACAAGTTCACAGCCCGTACTCCC
TCCGTGCAACCTGATTCACTTGGACCCATCCCTCGGACCGGGGTCTGACAAATAGCGAGC
CCGTAAAGGAGTAGGGAGAAGATGGACGTGAATAGAAATGACAGATGAGTGCCGTGGGTG
GAATCGAAGGGTCCGGATTTAAACCGCAAGGGTGAGGCGGAAGGAAGCGGGAGAAGAGGT
AATGGCGGACGACGGCCTCGTCGCCCTTCCCATTTGACTACCTCTCTGTCGGTCCCACAG
ACGAAGAGGTTATGCTTATGGGATAGAGAAAACGTTGCCACGGTCTGAAGGGGAAGGTTT
CCCGTACCTTTTTTCTACATGAAGTGGCACAACAGACATCATGGTGATGATAGAGGGCCC
AGAGCGAAGCTTGAGGAGGACAGGTTTGACCGAGCGATGCAAATTGAGGATTTGTTCAGG
GAGAAGGTGCGTTTAGCCAGTTCTCCATTTTCCTGGGCCACCTAAAGGAAGAACCCTTGC
GAAGGATGTATTCGGATTTCTCGGCCATGATGGAATGTAGATTGGTTGCTCGATTGGGGA
GACGTATAGAAGGGCGTGGTCCATTTCAAGTCGGGCGTTGTTTTCTGATACGACCCGGTT
TTGCTCTTGAACTTCGCAGTTATGGCAGCGGCTTCCATCGCCAATATTGTCAAAAGCTCC
CTAGGACCGGTCGGCCTGGATAAAATGCTGGTGGATGATATCGGAGTAAGTAAAGGGGAT
TCCTTATTTATTATTAGATCCTTAAAAGACTGGGCCGGGGGAGGCGGGCGATTCCTAAGG
GTTTCCCCGGGAAGTTTTTTGCCGCCGTGTAGGAGCAGCAGAAGGCCAGCGAAAAGGCAT
TCTTCCCTTCGATCTAGCACTTCCTATAGGATGTTAAACACCCGAGATCATTCTCGAGTC
GCGGCAGGGGGCTTATTCAACATTCAAGTGCCAAGAGCGGGGTCTGGAGGCAGGAGAGTC
CTCTGGTCCCACCTGTGCCACTGGCTCGAAGATGTGTTCGTCGGCCCCTCCCTCTACCAG
TTTCCTTTCCTGTAAAGTGGCAGTGGGGATACCCGCCCCTCCCTCATAGGTATGTTCGGG
AAAAGAAACCGTTGGTAGGAAAGAAGTCTTCCAGTTAAGGGAGTTCGCGGGGAAACCGTA
TGACTACCGTAATGGTCTCCTCTTTAACAGAGATTAACTCCTGTCACTTTTTCTTTTTCA
AATAGGATGTGACCATCACCAACGATGGGGCCACTATCCTGAAGTTACTAGAAGTGGAGC
ATCCCGCAGCCAAAGTTCTCTGCGAGCTGGCCGATCTGCAGGACAAAGAAGTGGGGGATG
GAACCACCTCGGTGGTACGCAACTACTAGAATTCACCTCGGGTGGTTGGCCTGGGCAGTG
ATCATTTCTCTAAATTGACGGACCTCGTTTTCGGTTGGCAAGCTTATTCTTCTTTAAGGA
ATTGTGTAAGCGTTTACTGTGCGCTAGGCACTGTGCTGAACGCCGGGGTAGAGCCAAGCT
CGTCGGGTTGGATCCCATCCCTGCCCCGCTTGGAGCTCCCGCGGTCTTCGTCCCCATTTA
CGGATGAGGGAACTGAGGGCCAGAGAGGGGAAGTGACTCGCCCAGGGGCACCCGGCAGAC
AAGTGGCGGAGCTTGGGATTAGAACCCAGGACCTCAGGACTCCCAATAATTGCGCCTGAT
TGAACAAGAATTAGGATAGGCTGTGCTGTAACCCTTTGACCTCTTTATAGGATGGGCGTC
CCTGAAGAGGGTGCATTTGGAATTAAAAATATCTTTCTCCTTGCAACAGGTTATTATTGC
TGCGGAACTCTTAAAAAATGCAGATGAGCTAGTCAAACAGAAAATTCACCCCACTTCCAT
CATTGGTGGCTATCGCCTGGCTTGCAAGTAAGGCTGCCTTTACGTCAGATACTCACCGTA
ACTTGCATTGAAAACACTTGCTGGGGAATTTCACTGGCGTTTGGCTTGGCTAATCCGCTG
GTGCCATATGGGCATGTCTCCGAAGACCGCCTATGTTTTTGAAGGCCATCTGGGGTTCGG
CGCCAGCCGGGCGCGGCAAAAGAAGCCTCGCTTGGCAGCGTTTGAGGGGCTGAGACAAAA
AACATGGTCTGAGAGTTCTGTAAACCGGTGAGAGTGGGAACCCGAGGGCGGGGATTGCGC
CTTAGCGCTTAGAACAGGGTACTGCACACGGTACGTGCTCAAATACTATTGGTGGACTTG
ATTACACCTTTACTAGGTGCCTAAGAAGGGTGCTTAGCTCTGAAATACACTGGGCGGATC
AGTTCGGACACGGTCCCTGTTCCGTCGGAGGTCCCCAAGCTAAAAGAAAGGGAGCCCGGG
TAGGTTCTTCCCATTTAAGGTTCAAGTGGGGCCCAGGGAGGTTGGTGTCGTGGGCAGGGT
CACAAATACTGAGCACAGTGCTCGGCGGGCAGGAAGGGCCCCTCCAACACTCTTTAATTT
ACCGCCCGAGGTTATGCCTCAGGCTAGTAGGAGGAGACCTGGGTTCTCTGCCCTTCCTGA
AACCCCAGCCCCGAGGCGTCCTGATCCCCGGGGAGCTTGCTTCGGCTTCTTGTAGACTTT
CATTCAATAGTATTTATTGAGCGCTTACTATGTGCAGAGCACCGTACTAAGCGCTTGGAA
TGAACGAGTCGGCAACAGATAGTCCCCGCCGTTGGACGGGCTTCCGGTCTCATATTATCT
GTTGCGGTTAATTTTTATCAAAGGGTAAAGTGGGAGTTGACCCCCAACCTTTAAGCCCTG
ATTTCTTTCGCCAGGTGTCCGGTTTGAATCCGTCAGCGAGGCCGATGCTCTTCTCTTCCC
ATTTGACTACCACTTTTTTGAATCACAGATTGAGTGGTTATGCTTATGGGATAGACAAAA
AGCTGCCATGGTCTGAAGGAGAAGATGTTTGATATCTTTTTCCCTATATGAAATGGCAGA
ACAAAACCAGGTTCAGGAAATGACTGGACTCGATAGGACGTTTTTCCTTAGACCCATATA
AATGCTAAATTATAGCGATTAAATTTATAAAATAGTCGTCAAAACTGCCAGAACGTCTCT
CGGCGCACGGTACCGTTATGAATTTGAAATGGGTTTTTTTTTTTTTTTTTAAACAGGGAA
GCAGTCCGGTACATCAATGAAAATCTCATCATCAACACGGACGAGCTTGGTAGAGATTGT
CTGACTAATGCCGCCAAAACATCCATGTCTTCCAAAATCATCGGAATGTATCCTTGCCTA
ATAGTAAGATTCTGTTGAGGCAAGTGCCCTTTTCACCCAAGTTACCACCACATAAAAAAT
GAGAGGGGGCGGGGAGACGGCCTTATTGCCGTATCCTAGATCTGTAGCCTGTCGAAACCT
ACTGGATGGGGAGGGTGCTCACAGTTAAGGCTCTCTGGAATCGAAGGAGCTGGATGGCTG
AAAGGCAATGGCTTTTCAATTGGGAGATTTGAGGTGGACCAGGGTCGGCGAGGGATGTTT
CATGATATAGGGAAGGGTTTTTAAGAGAGGGGCAATATGGGCATCGTTCAGCATTCAAGC
AGCCCGGGAGCATTTGCTAAAAAATCAGCTTGTCCTTGCCCTCACCCCACCACATCGACT
TAGCTTGAAGTCAACGAGGAAGACCCGGGTCCAGTTGGGGGCCGAGGTGGGCCCGGAGGA
GCCAGTAAAGCGAAACTCAGGGTGATGGTTGCTGTGGATGGGTAACGGCGGGCCCGGGAT
GGGATGCGCGGGGCTTGTTCCGGGAACGTTTCATGGGGAGGTGGACCTGGAATGACGCAG
ATGAGCAGGTGCCCGCAGCCCGAGTTCCACGCAGGGGTAGAAACTGGGGTGGAGCAGACA
GAAGCAAAAGAAAAACACACTATCTGTCGTGTGAGGTGAAAGGCCTAGACGTTTTCCAAC
AGGGCCTAAGACCTTTGACACTCCGTACCCGAAATAAAATCCTTAAAAAAAACCGAGTAG
ATCCTCTTCGAAACAGGCCCCGGTTTCCTTACTTTGAGCCGTCGTTCCATTACCCGTTCG
TGGTTTTCCTTGACGGTTGCGTTAGAGACGGCGACTTCTTCGCTAACATGGTAGTGGATG
CAGTCCTTGCCGTTAAATACACAGACTCAAGAGGCCAGGCCCGGTACCCGATCAACTCCG
TCAACGTGCTGAAGGCCCACGGTCGAAGTCAGAAGGAGAGCATGCTGATCAATGGTTACG
CACTGAACTGTGTGGTGGGCTCACAAGGTGAGGGGGATTTCGTCTCGCTCTGCGTCCGCC
TTAGACTCGGGGGCCTTGGTTTTCTCACCTCGCTTCCCTTGGGTCCTGTGCGACTGAGAT
GTCAAATCTAAACGCGGGGAAATGCCGGTTTGGAGTTGTGCCTATTGTGAATGGAAGCCC
ACTGGCTCCATCAGAATGTAACCTTAACGGCACGTGGGTGACACCAGATGGAGTCTGAGA
CCTTCGATGCTATCTACCCCAGTGCTCCGAACAGTGCTCAGCACAAAATAAGCGCTTATC
GAGTACCGTAATAACTATTATAGCTTCCGGGAAGTTACCTCTAAACCACCCGAGAGAGTT
TTCCTCCCTCCCCGGAGATGATTTTTGACTTTTAGTTGAGATGAATCTCCTTGCTGTCTT
GCAAGGTCTTATGCTCTTTAGGGTAGAAAATTTCTCAGGGCCAGATTCTTCCTTCTGCAA
TTGAAGACACTGCGTAAGTTTTAATAGCAAATAAATTCTTAGGTTTTCAATGGGAGTGGG
TTAATTCCACCTCAGCGGTCTGTTGGATCTTGTTAAGCTGAACTATTAAACATTCTGGGA
ATCTACAAGCAACGCAGAGTGCTGCGGCACAAATGTTCTAGTCCTACTTGCGGATGGAGG
GCTGTCCAGCTAAGGCCCGAGTGTCGAGGCAGTCGAAAACAGTTCAGAAAGGAAAAAATG
AGCCGACGTGGAAATGTAAATTCCGGCACTCGGTTTACAAGCCTTGGAGAGAGAGCCGTT
TTTTCCGCCGTGGAAGTTCTGCTGCACGTATTTTGAATAGAGTAGTTGAATGGTCTTTGT
ATTTTATTGTAGGCATGCCCAAGAGAATAGTGAATGCAAAAATCGCTTGCCTTGACTTCA
GTCTGCAGAAGACCAAAATGAAGCTGGGTGTGCAGGTGGTCATTACAGACCCTGAAAAAT
TGGATCAAATTAGACAGAGGTATGTAGGATTTTCTATTTTCCCCACCGAAGACTGAGGCT
GGACTTTTTTAATCAAGGAGAAAAGACTGAGCTTCCTCCTCCTTAGTTCTGCTGTACGGT
ACTCTCCCAAGTGTACAGCGCAGTCCTCTGCATAGAGTAAGCACTCGGATACCCTTGAAT
GATGGCCCAGCAAAAAAATGTACAACCAGAAATCATTTTTCCAGGAGAGCAAAAGAATGA
ATGAAGGCGTGCAGCTGAGCAAAGAGCATTCAGTAGGTGGGGTTGAGCACTTCAGGTCGG
CAGAGCTCTAGCTAATAAGCACAGGGAAAGATCCTCCGGTGGATGGAGGTTAGGTCCAGG
ACTCCCATCTGGTAATGAAGCTGGGGAAGAGACAGCCAGTGGATGAAACCACAAGTGAAC
TTGTAGAAAGTCAACTGGTACCTGTAATCGAGAGTTTGCGTCCCGCCGGTGAAGAGGTCA
GAACCCCAAGCACAGAGCGTTTGGAACAGAACCTGCTGCCCTGCTAATCCAGACCAAGTG
GGGCTGCTGGTCCTGGGGTTACTCGGAGGCTTGTTGAACTGGGCACGTCGGGCAAGGGAA
TCATCTCCGCCCTGCCCAGGGTCAGGATCTCCACGGGGGCTAATCCGATACCTCCCTCCC
GCCCCGCGGAAAGCAGCCGCAGCGGTTTGCAGAAATAATTCCGCCTACTAATAGCGGCGT
GGCTTAGGGGATAGAGCACAGGCCCGGGAGTCAAAAAGACTTCATTTCCCACTCTGGCCC
CGCCCCACGTCCGCTGGGTCAACCTGTGCGATCACTTACCTTCTCTGTGCCTCAGTTACC
TCGTCTGTTAAATGGAGATTAAGGGCGTGAACCCCAAGCCCGGCCGTACCTACCCCGGCG
TTCAGAGCTAGTGCTCGGCCTGCAGCGAGAACTTAAAAGAATAGCGTTGGTTAGTACCGT
TCTCACCGGCCTGAGGAGTTTTGAAATGTGGATCCCCAACTTTTGTGGGTATTTGGGCGG
CATGGTCGAGAGACAGTTCGGTCGGCAACGATTTCGGACTAAAAGGTCTCGCGTTCCCCT
TGGCAGAGAGTCGGATATCACCAAGGAGAGGATCCAGAAGATTCTGGCCACCGGGGCCAA
CGTGATTCTCTCCACCGGCGGCATTGACGACATGTGTCTGAAATATTTTGTGGAAGCCGG
GGCCATGGCAGTGCGACGAGTTTTAAAGCGCGATCTCAAACGCATCGCCAAAGCATCTGG
AGGTACGTTTCCGGGCTGTCGAAAGCAGTTGCCGGTATCCTATCTCCCCTGGGTCTCTTT
GACCTCTGGCGGTTACTGTGGCGGTTGGTCTCCGCCGGGGCGACAGAACAGGAGCTTGCT
CTCTCACTACGGAGATGCACAGGAATAGCTGAGGTTTCAGTTGGACGGTGTATTCAACTC
AGGTTTCCCTGTGGGTTAAGAGTGGACCACGTCCCCAGACCCGCCCTCGGAGAAAGAGCG
TGGCTCGTAGAAAGCCTTGGCGAAGGCTTCAGAGAAGCTAGGCTGGAATAAGCTGATGCC
CTTGTTCCTCAAGGAAAGTAACAGGCGCTCTGCCGCACGTCTCTCGATGCCAGCTTGTTC
CTCACGAACACGTAGTTGGAGGACTTCGAGCAGTCCTCGGTATTTAGCCTCTGGGTCATT
CCTTGGAGTTACCAGACGGGATTTCCCACTCTCCCGCTCCTCGTGTCAATGACAAGTTGA
GGTGTGATAATACTGAGGTGGTTGGGACCTCTGAGTGAATTGGAGGTTCTCTTTTAGACA
GTAAAATACCTCCTTGCACAGGAAAGAGAAGGGCATCTAACCGGTCAGAGAGGCGAGCGA
CGTCGGGGCCGGGGCCCACCTCTGTTAAAATTCCCTCTTCGGTTTTAAAGCGACCATTCT
GTCGACCCTGGCTAATCTGGAAGGAGAAGAAAGTTTCGAATCGGCGATGCTGGGACAGGC
GGAAGAGGTGGTTCAGGAGAGAATCTGTGACGACGAGCTCATCCTGGTCAAAAAGTAAGG
ACTCGGTCAAGTGTACGTTTTTCACCGAAGCTTCTCTTTGGTCCGGCCGGGTGTGAGAAC
GGCTGCATCTGCGAGGGGGAGGGGAGGGAGCGAGACGGTTCCGCAGTAAACCGAGACGGA
ACCTTGGAGTTGGGTCTTCCGCGGGATGTAAACGTTGCCCTGGGAGCGCGGTGGACGGCA
GCGGCAAAATGTCTCCTCTTAAAGTCGACGGTTCCTGGAGAAGACCTCTAACCCGCACCC
GTTCCCCTCGCAGTACGAAAGCCCGGACGTCCGCGTCCGTCATCCTGCGCGGCGCCAATG
ACTTCATGTGCGATGAGATGGAGCGCTCCCTGCACGACGCGCTGTGCGTGGTGAAGCGAG
TCCTGGAGTCCAAGTCGGTGGTTCCAGGGGGCGGGGCGGTGGAGGCAGCCCTCTCCATCT
ACCTGGAAAACTACGCCACGAGCATGGTAAGGCCGGTTGGTGGGGTAGGCGACTCGGCTG
GGGTGTATCCCTCCCTCCCTAAACGGCCACGCGGTCATTTCCTCCACGCCTCCCTTTGTG
TGTCCGTCTTCAGGGATCGCGGGAGCAGCTTGCCATAGCGGAATTCGCCCGGTCTCTCCT
CGTCATCCCCAACACGTTGGCCGTCAACGCCGCCCAGGATTCCACCGACCTGGTGGCCAA
GCTGCGGGCCTTCCACAACGAGGCGCAGGTTAACCCGGAACGCAAGAACCTGAAGTGGTA
GGTGTAAGAGCAGAGGGATAGGCGGGTCCCGGGGGGCAAATGGACACGTAGCAGCCTCCT
GTCCGCTCGTAGTGGGAAAGGGACAGGGAAGGAGGATAAGCCAGCAGGGCCGTCCTCCAC
ACGGGGCTCTCGGGCCCGGCACCCTCTCGGTCCTGAGAAACAAAGGAGCCAGCCTCCGAC
ACGAAGCACCTAGAGTCCTGCCCGCTCTAGAGTCGGCACGCCGGAAAGCCCGAGGCACCC
GAACGCCATCTTGCCCCTGGGAAGGGTCCCAAGCGGGGAACGTGACAGAGCCGAACGCGT
CACGTAGGCACCGAAGAAGGTTAGGAAGAGAAACCTGGACCGGGTCCACAGATTAGGGGG
GCCCGAGTTCTCTACCGACCGCTCGCGGTCGAGCTTCGAGTCGGCTCCGTCCGGTCGCGG
GGCGGGCGCCGAATTCGGGGACTGGCGTCGCAAGCCCCTTGGCGTAGGGGAGCTGGCGTG
TCGGCAGCAGGGACGAGGCCGGGGGGAGCGCGGCGGCGGGGCTAAGATTGCTTTAATGGG
GCGTCGGGTGACAAGGCAGCCACCCACCGTCTTGAAGAACGAGGTGGGTAGCCATCTCCC
CCCCCCGCCCAAACCTAGGCGTCAGAGGCCGAGCCGCCCGAGGATTGGATTTCCCTCCAC
CTAGAGCGATTGAATTCAGGACTGAGTTGAAAAACCCTTAGCCCCACGTCTCTAATGAAA
AATCCCCGCGTCTCCCCCCCGCCCTTTTTCAAACGTAGGATCGGGCTTGATTTAGTGAAC
GGAAAACCACGTGACAACAAACAAGCCGGGGTGTTCGAACCTACCCTGGTCAAAGTCAAG
AGCTTGAAGTTCGCCACCGAAGCCGCCATTACCATCCTGCGAATCGACGACCTCATTAAA
TTGCACCCGGAGAGCAAAGACGAGAAGCGAGGAGGATGTTACGAAGACGCCGTACACTCG
GGAGCCATCGAAGACTGATGCGATTCCTTTTTATTTATAACAAGGCTACGGCTCAGTAGT
GCCCTCTCCCGCTTCCGTCTTACACCGAGCGGTTACGGGGTTAAAATAAAGCAAGCTGTT
AAAATCGGGTTCTTCACAATTATTGGGGGAGGTCCCCTGGAATGGCCGGGACCAAGCCCG
GAAGGTTACTTGAGGGAGGGGACGTCTCCTCACCCCCCCCCCCCCCCGTTCCGATTACCC
CGGAGACGAGGCCGTAACGGAAAAAGAGTCGTCGGCTCTATCTCTCCACACACATGGCTA
CGGCCATCCCTCCTCCGACGCACAGAGCTGCGACGCCGCGCTTTCCGCCCGTCCGCTCCA
GGGCGTAGAGGAGAGTGACCAGGATGCGGCAACCGGACGCTCCCAGCGGATGGCCCAGGG
CGATGGCGCCACCCTGGACGTTGACCTGGAAAAAAAGCAAGGAGCTGAGGGGCCCCGCGG
CAAATCCGCCGCGACGGGATGGGGGAGAGAGCAGACGGCTGCGGGTAGGCAGGCGTAGCT
CCGTACCTGGATCCGGTAAATCCTAAAACCCGTAAATAGGATTTCCCGAGCGCTTACTAG
GGGCAGGGTGGGAGGACGCGACGCGACAGCCGGCAGCGTACGCCCGCTGCGGGCAGGGAA
CGCGTCCGTCGAATCCTACTCTCGCGCCTTAGTACGCGGGGCCGTGCCCCCGGCGCTCCA
TCAATACGAACGAACGAGTTCACAACCTAGATGAGCAGATGGCGGCGGGTGCCCGAGGAG
CAGTCGGCGCGCGCGCGCGCTTACCTTCTCCGGGTTCAAGCCCAGGTCCTTGGTGATGGC
TGCTGCGACCGAAGCGAAGGCTTCGTTGATCTCAAACAAATCGACCTCGTCTAGGGTCCA
GCCGGCTTTAGCGACCTGAGGAAGGAAAAGGTGGGACGAAGGAAGGGCTGAGAAGGTCCC
TTCCCCGTTCCAAGCTGGCGGCGGGCATCCGTATGGAGCGTTGGACCCGTCCACAACCGA
GCCGAGCCCGGACGCCAGACGAGCGTTTCCAATCCACCAAGGATGCGTCCCTTGGTCTCG
GCCTGGGCCTGCCGATGGGTTCTGTGTGGAAAACGGGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
2001..2084, 2585..2713, 3169..3266, 4496..4606, 5425..5606, 6432..6558, 7626..7801, 8450..8573, 8833..9025, 9133..9296, 10058..10379
2001..2084, 2585..2713, 3169..3266, 4496..4606, 5425..5606, 6432..6558, 7626..7801, 8450..8573, 8833..9025, 9133..9296, 10058..10277
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved