Ornithorhynchus_anatinus Locus CNOT1
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus CNOT1
Ornithorhynchus_anatinus
CNOT1
Ultra55
SNORA50, SNORA46
39913..40048, 53127..53262
78061
AATTTAACACAAGCCCATTTTGTTTTACAGAATTTTTTTTTTTTGGCCTAGCAGGTGGC
AAGAATGAAATGGATTAATATTACATCACTTTAGCTGTGACACTTCTTCAGTCCCTTCTT
GCTAAATTCCCTCACTGAACAATTCCAACCATGTAAAAAGGAAATGTAAAATTCAGTCCT
ACCCTCTCTTTAAGCCAGGCTTGCAAATAACTTGAAAAAAGGACCCGCCCAAAACACTTT
TGTCCTTATCTGAGAATGCAATCAACCTTATTCTTTGGGGATTAAGAAGATGAGGAATAT
AATTGTATCTTTCCTTCGTTGGAAAGAAAACATTGCCCTTTCTAGAGAGTTGTGAACTAA
ACAACTCAAGTTGAGAAACCTATGAACTGCTTCATTTCGGTATGATGATTCTATTAATCA
TCCTAAGGCAGGAGTCCTTGCTGGAGAGACATGGTAAAGTGAAGCTTACGAAGCCTTTGA
AAGTATTCTAAACCATCTTGTCTCGCCCACTATGTAGGAGGCCTGTCCATTTGGTCCCCA
CGTGTGTATGGATCCGCCGTTGACGGTTAATCGGTTCCGCCCTCCACTAGTTTGAAGTAC
CAATTCTCTTGCCATTGGTTCATGATGTCAGTTTGAATGCCGCCTCCATTGTGCCCCTTC
TCTTTACTTATGCATATGTTTAATAAAAATTTTGGTTGAACTAAAATCAGCACTAGAAAT
GCCTTACGGAAATAGCAAAATAGGAAGGAAGAACAGCGAAGTAATTTTCAAAGAGACTTT
CTCCGTGTCACAGAGAACAACTTGTAATTCTGGATTACTTTTTCAGGTGCCATGTTTCAG
AAGGTAATTGGACCCCTGGAAAAGAACTGAAGAAACGGCACAGAAAACCAGTTCAACGCT
ACCTTGAAACAAAAAAGAATTAGCCTGTCTCTGAGGTGACTAAAGGGGAATAATGGTGAT
TTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCT
CGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAG
CCAGCCAGCAGGAAATACAGCATGTAAGTAAAGTGGCAGAAGAAAGTTTTCTATTTGAAG
CAAAACAAATAACTAAAAGTGGAGTTTGGAAGCTCTTTGGCGTGATGGTTTGCCTTATCC
AGAAGAGTACAGCCGCTGCCTATTTACTGTTTCAGAGAATCTTAATTTTGGGTTGTTTTA
GCCGTATGCCCACCAGAAGCAACTTGGGAATCTGTCTTTGCTGTCCTTTTCTCCTCTAAT
TTGAACAGGCACGCTAACCTTTTTCTAGTTTATTTCTAATTCTGATTTTTTTTCTTCTAA
TTATTAATTGCCTGGCCTGGAAATCCTTCAAGATGTTTGAGTAATTACCTAAATTAATAT
TTAGCTAGTTATTATCCTAGCATTTAAGCATAAATAAACTTAGCTTCTATCCTGTTTGGG
TTTTGTTTATGTAATTCCTTGAATAGTGGGTTTTTTTTTTTCTTGGTGGTGGTGGTGGTT
AAGCCTTAATTAAAAAATCCTTTAGAATAGAATTGTATCTGTTCTTCTCATCTGGATTTG
GTTTTGTTTGTTTGGGGAGGTCTCCAACTCAGCAGTAGAAGTAACAGAGATGTCTCCAGC
CCAGCAACAAGAGGAATAATAAAAACGTTTAGCTATCTAACTGGATTAGTCTCCATTGTA
AAGATTGAGGTATCTAATTACTAAGTAAATTATTATATTTGGATCACTTGGATTGACAAA
TTTATATTCAAAACAGTTCCCCTTTGGAACGTTTAGGCTTCAGAGCCTTTGTAGAACCCC
ATCGGGGAGGAAGCCGAGAGGACCCGGTGGATTTGGTGCAAATGGGCTAGTTTAGTCTGG
GTCAGAGGTGCCCACAGTACCTGTGGACCCTCTCCCCTCTTATTAGGACTTTGCTAGCCA
CGGTGCCTACTCGACGGTCGCTTTAGTTCTTTCTGGGGGTGTTGCATTGGGACCCGAGAG
TGACCCCGCGCCTAACAATGAAGGAACACCTCATCTTCCTCCCACTATTCCTGATTGGAG
TGCTGAAGCAGCAGCTGAGCTTGTCCGGCTGGTTATTAAACTTAAGTGTATTAAACTTAT
ATTAAAAGTATTAAACTTATATTAAACGTATTAAACTTAAAAAAAAAAAGTTGGACCAAT
GAAGGTATGGGACTTGGAGGTGATGCATTTTGGTGATAAACTCTTGGGATGTTTATTTTT
TTTTTAAATCTGGTTAAAACCTATTAATCTGGTGTGCAAATAATGCAGATGGCCAAGCAT
GCCCAATATCAGAGTCACCTATTGCAAAAATAGGAATACTAGGCTTAAGGGGGTCAGCGT
CTGTTAATACAAAACTTAAAATATCCAAAATTTGGTTTGTGTTGTACTGGAGAGAATAGA
AAGATGACACCAGCCCAAAAGATAAAAACTGAACAGAGATGCCAGTTAACTGTGGAAACT
CGAGACTCGTGGAGAGGCAGCGTGGCCTAGTGGATAGAGTCCGAAGGACCTGGGTTCCAG
TCACGGCTCTGCCACTTACTTGCCGTGAGACCTCGAGCAGTGTAGGCTAGTGGTTAAAAA
GTACCAGCCTGGGAGTCAGAGAACCTACATTCTAGACTTGGCTCCTCCACGTTTTTGCTG
TGTGACCATCAGCAAGTTACTTCACTTCTCTGTGTCTCAGTTAACATCCGTAAAATGGGA
ATTAACGTTGTGAGGCCCATGTGGGACATGGACTGTTCCATCCTGATTAGCTTGTATCTA
CCCCAGCGCATGACACATAGTAAGTGTTAAATACACCATTAAAAAAATTCCTTCTTCCAA
CTATCTAAAGGGAGAACACATTAAGGCCATGCCATACCTCTTAAATATCACATTGCAAAA
CTCTCTTGAGTATTTACAGATATTGATGCATCAAACAAATGATCAACCTGAGTAAGCCAT
GGTAGAAATAGAGGCCAATACATTGATTTTAGTCCATTTTGGCAGCAGAAGCCTTCAGAG
ACGCTTACCAAAATTTTAAATCTAACTTTTTATTCTAAATTTTAGGGGCTGGAAATCTGA
GAAAATTTTACAAATCTACCCCAGAAATATATAACGTTATCATGTAATAAATAAGATCGC
AAATTATTCTATGTTAATGCTGTTTGAGTGCTTACTGTATGCAGAGCATTATAATAATAA
TGTTGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAGCGCTGGGGTAGAT
ACAGGGGAATCAGGTTGTCCCACTTGAGGCTCACAGTTAATCCCCATTTTACAGATGAGG
TAACTGAGGCACAGAGAAGTTAAGTGACTGGCCCACGGTCACACAGCTGACAAGGGGCAG
AGCTGGGATTCGAACCCATGACCGCTGACTCCGAAGCCCGGGCTCTTTCCACTGAGCCAC
GCTGCACTTGGGAAAGTACACTTCAGTCGAATTAGGAATTACGTTCCCTGCCCATAATGA
GTTTACAGTCTAGAGGGGGAGGCAGACATTAATATGATTAAATAATTTATATTATATAAA
GATATGTATACTTTAATATTGTTTTGTTTAAAGCCCCCCCCCCCACTGAGCAGCAATTTA
AATGATCTGTCCAAGAGCTTTTAATCAAATCTGAAGTTAGTCATCTGGCTGGTACTTTTA
ATAATTCAGGATTATAATTATCAGCGTAAGATTGTTTTTAGATTGACACACAGTTATTAT
TTATGCAAAGTAGTCACTGTAATGTCAAGTTTTTATTTCCTCTGTTGTCTCTCCACTCCT
TTTTTCGAGATAGTTGTGCTAGGTAGATTTGAGGGAGGCCAACATCTGCAAATCTTTTTT
TCTTTCTCTTTTCCTTTGGTCAGTTTCTTTGGTCTTGTTTTTGGCTTATCTAGAAATAGA
TTGAGAAAGGACATTTCTACAAGAAGTGGTAACTTCATTTAACTCTTGCTGGGTTTAGTG
GGGGACCTTTTCGTCAAAAGGTCTGCATTTAACTTTTGTGCTGTGTGCGTTCAAGTGTTC
CAGTTTTGTAGAAGGTCATTTCAAGCAAATAGGTCTACCTGCTAGAAGTGTGCTTAGAGT
AAAATCCCTGAATTTACTGTCTTATAAGTAAAAAAAAAAACACTCCTCTAAGAGAGTGAA
TTTATCCCCAGCTGTCATTAAAGAATGCAGTTCTAGACAACCCGAGGAACAGGTGCCCTA
GAAAACAACAACTGACTTATTCTTTGCCATCTTAAATACATTAAAGAAAACTTAGAGCAG
ATACACATGAAGATAAACTAGGTGCTTTGAGAAGAATTGATAAGAGGCAGAGTAGCATTG
TAAAGGCATTAAATATTCACAAGCTGCGGTTAAAAATCCTCAAGTCAATTTTCAAAAAAA
TTATGTCAATAGGCAAGCCTGGAGAGAGGTCAGTTTTTCAGCTGAAGTCCCCTCCCCCAC
CTTAAGATAGTAAGTGTTATTTTTCCATTATTCCATGCTACCTCCTCAAGCATTGCCCTT
AGCACTGATACAGGAATAAAGGTATAATTAACAGAAAGAAAAAACAAATTACCATTTTAA
TCATGTCATGTAGAAATGTTTATTGGCAGTCTTTTGCCAACGTGGTTTTCAGGCTCACCC
ACATTTCGAGTTGTGAAAATTTGTAGGCTGACTTTCATCTCTGGTGAATATCCCTTGCTA
TGAATAATTGGGCTGGACTAAGTTGCTTCTCAGAATTCCTAAGATTCTCTAATTCTCTGC
ATATTTGTGAACAGTGGGATTTAATTTTTCAAAGCGACATCACCAGAGGACTGTGAATGT
CCCAGTTTTAAAAAGTAACAAATTATTATTCTAAATAAATTCAGATGTGCAGGCAGCTGC
CTTTAAATCCACAGTCCATGTTAAATAAGACTTTGAAAATCAGGATTGCTGTGGTCCCCT
GTGTATGAAGGAGGGGGTTTCAGGCAGGGCTGGGGAATTGGAGCAAGGGGTTGGTGATGG
GGGGATGAGAACGAGACACAATAGATTTCCTGGAGGGGAATGAAGAGTGCAAGCTGGGAT
GTAGTGGGAAAAGAGGGTGGATAAGTGTAGAGAGCTGATTTGGTGGTGCTTTAAAACCAG
ATATGCTCGGAGAAGGTGGGGAGGCTATGCCCAGCCGTGGTCCTTTCTCTTGCGTGTGCC
TCCAACGCATTGGCACCATTTTTAAGATGGACTGGGCTCACAGTGTGCCCAGCCATTTCC
CAAAAGTATGGACATAGAAGCTTCAGAAGGGACTTCTCAGCTCTGGGCTTCCAGCTGAGA
AACCAGTGAGAACTGTCCCACTTCCCTGGATCAGGAAGTTGCTGGATTGCACTACACCCA
CATTCCCCACTGTGTTCCTGGTTGTGGTGTAACTTGCTGGTAGAGTTGGCCCCCAGTGCA
GCCATTTTAGCTCCTCCCTACTTTACATATATATATATATAGCTTAAGTTGGTGAAGAAT
AGAGGAAGAAATGCGTTTGAAGAAAGAACTTGGTTCCCGTCTTGGGCTGAACCTGACAGA
AACCAGTCCGCGGGTGAAGAACTGAATGGTATTTTTGTCAAAATCTCACTTCACTGTGCT
CTGTTAACCTGAGAGATTCAACCGTTTCTTGACCGAAGAAGGGCAAGGGGAATTATCCAG
TCTGGTTCTTCCTCTTTGATGCCATAACAATTTGAGATAGGGATCGTGATTGAGCATCCT
TTTGGTTCTAGCTACCCCTTTTCGCCTTTACCAGATAAACCTGAGGTTTTGTTTAATAAT
CTCAGGAAAATCATTTTGCATTCACTTGGAATCTCACTGGTCGCTCCAAATATTTGGGAG
AAATGGTGAAATCGGAGTCTTTAAATGTAGGTCACAGTCTCCCTCACTCCTGGTTTCAGT
TGAAGACTGGGAAGAATGTGAGAAATTCCAGGAGGTGCAGCTACATGCTCAATAAAAATC
ATGGTATTCAAGTGCTAACTATGTGCCAAGCACTGGCATAAGTAAAGGATGATCAGGTCG
GGCAAAGCCCTTGTCCCACTCCATACTCAACAAAGCAGGAGAACAGGTATTTAATCCCTA
TTTTACAGATTAGGAAATTGAGGAAGTTGTGACATGCCCAATTTCATACAGGAGGCAGTG
GATAGAACAAGGGCCTGGGAGTTAGAAGGTTGTGGGTTCTAATCCTGACTATTTGTCTGC
TGTGTGACCGTGGGCAAGTCACTTCACTGATCCTCGGTTCCCTCATCTGTAGAACGGGGA
TTGAGACAGTGAACCCCATGTGGGACAGGAACTGTGTCCAACCCGATCTGCTTGTATCCT
CCCCCAGCGCTTCGTACAGTGCCTGGCACTCAGCGTTGAAGAAACAACACCCTTATTGTT
GTTGTTGTTTACTCATCCAGGTGTGGCAAATTTTAAAAGGTTTATAAGGTAGAGAAAGAA
TGGAAGTCTGTTGTCCCAAGTATATCCCCGTCGATGCAGATGCTCCAGGGTTTGTGGGAA
GGTCCCCACAGTTTAAGCAGGACTGTCTTCTTGGGCCACACTTCTGCCCCTAGAAAGGCC
TTGTGTCTGCTTATAGGGAGGGTGATGGTCATGAGGCAGAAGGTCGTGGGTTCTAATCCC
AACGGTAGGATCCCCATGCCTCTTACCAAGAAGAGAGAGAGGCCCCTATTGTCTCTTGTA
TTTAGGGCCTTCCCCTCTACCTTAGTGGGCCCCAGGGGTCTGTTTCATATGTGAATTTTT
GTGCAGACTCACATGTGGCTTCCAGCATCTTGTGATAGTCCTTAAGCTCCTTTCCTCACT
TCTTTTTACTCCACAAGAACGAGGGTTTTTTCATTTTTGTTTTTTTGCTAAACACTTAAC
CTCAGCAAGCCTTCTTAACGCAGTCCTTATTTTTGGATTTTCTCATACTTTCTTGGGACT
GACACACTCCTTTAGGAGAGAATTAGAATAAAGATAAAGATAAAAATTGAGTGTTTTCTA
CTTTCCCCTCCAGTCTTTTCAGGAGTTTTTCCTTTTCTTCCTCCTCTAAACGTAAGGCCT
CTGTTGAGACTTAACAATGGCCCAGAACCACCACCCCCACCTCCCTGCCCCCAGCCACCC
TCAAGTAAATATTCCCTCTTTGTCACTTTTCCTTCCCTAGTCATTCTGGTAACTGTGGGG
AAACGTGTTGAAGTTTCATACGTGCGTTTTACTTGGCGTTTCGGCTAAATGATTTTGCTC
TAAGGCTTCCTGCCTCCTTGAAGGTGGAGAAGGGATCGAGTTGGCCAGCAGAAAACTCCC
CAGAGTCAGTGGACTAACAGACGTCCAGCTAATCCTCCTTTAATTCATTGAGGCCAAATT
ATGAGGTCTCTGCCCGGTTAGCCCTCTGTCCTCCATCCTAGATCAAAAATTTCCTCCAGG
CGCTCACCTCTCTAGACTGTAAACTCGTTGTGCACAGGGAATGAGTCTGTTGCTTTTTTT
TTTTTAACTGTACCCTCCCAAGCACTTAGTACAGTACTCTGCGCACAGTAAGGGCTCAAT
TGGTAGGTTGACCTCTCTCCACTCCCTGACCCACCCAGGCTCTGCATGAATTAGCCACTT
TATATGAAACAATCGAATCCCTCTTGACAGTATGTCAGACTGCTTAGTCACCAACTGTCT
GATCACTCATTCACTGGCCTCTTAGCTTCAGGCTCTCCTTCCTGCTGAGTTCTTAGCAGA
GGAAATACTGTTTTTTAGAAATACTTCCCCCTTTAGTGTGGGATTTGGGTGAATTTCCCC
CCTACCCCCCCTGCCCAAAAGGGCCTACTTGAAAAAGCAGGCATAGAGAAGCAGCGTGGC
TCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGTTCGTATCCCGACTCTGCC
CCTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTCACTTCTCTGGGCCTCAGTTCCCTCC
TCTGTAAATTGGAATGAAGACTGTGAGCCTCACGTGGGACAACCTCATTCCCCTGTATCT
ACCCCAGTGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACGTTAT
TATTATTATTGCCTAAATCAATCAATAAATGCTATTTATTGAGCTTACTATGTACTAAGC
ACCTAAAGGCACAGAGGAACCGCCTCTGGAGCCCATTATCAATCAAATCATGCTCAGTAA
CTCTGCCGTCCACTCAGAGTAACAGTCCCTGGTCCCTTCAGAAACTCTCCAGTCTGCCAC
CCATTATCAGTTATGATAGACAAATAGGTATCTTTTCACTGGGATTCCTCTCCCTTTGTC
CTCAGTCCCGTCATTTGAAGGATTCCCATCTTAATTAGTTCACTGACTTTGGGGAGTTTT
CTGCTGGCCAACTTGATCCCTTCTCCACCTTCATTGAGGCGGGAAGCCTTAGAGCAAAAT
CATTTAGCCGAAACGCCAAGTAAAAGATCGGCAAAAGATGCTTGGAGCCACCCAAGGGTA
TCGATTCCTCCCACCAGAGGAGATAATCAGGCCGTGCGTGATGCCCATTTAGGTCCTGGC
AAGCTGTGGCCACTTCAAGCTTAGAGTGGGCAAGGATGTGGTGACTGCCCTGGCCACCAT
TTATTATTGATATAGGTCACCCCTGCTGAGATTGATTTGGCCAGCCTCACTTAAATCAGG
TAGAAAAACCTCAGTTTTAAGTGCTGAGGCATTTTGAGAGGGGCTATCAACAAGATAGAT
TGAATCAGTCAAATATATGGAGCGCTTATTATAATAATTATGGAATTTAAGGGCTTACCA
TGTGCCAGGCACTGTTCTCAGCGCTGAGGTGGGTAAAAGCAAAAGGCTAGGATGTGTGGA
GCACTGTCCTAAGGAGTTAGAGTACAGTATGACAGATTTGGTTAAGTAACTAGTACAGAG
AAGTCAAGTGACTTGTCCAAGGTCACACAGCAGAGAAGTGGCAGAGCTGGGCTTAGAACC
TGGGTCCCAGGCCCATGCTGTATCCAGTCGGCCAGGCTACTTCAACCAACTTGGTTGATT
GTATTGTCCCAGGTGCTGACTACAGTGCTCTGCGTGCAGTAAGCGTTCAGTAAACACCAT
TGATTGATTTGGACCAATCAAGCTAATGAGCAGCTCTTTGCTTCTTGGGACTGGTGAAAT
CGTGAAGTAACAACGATGGGTATTAAATGCTTACTATGTGCTTAGTGCTGGGATAGATTG
AAGGTCAGATTCAGACCATGTCCCACAAGGGATTCTCAGTCTGAGGAAATGTGGAAACTG
GAGCAGAGCGAGTTATCGGTGAGGAATGATGGGAGAGCAAAAAAGAAACCAAGATCACCG
AGGGGACTAAGTGACCGAGCTGGGACTAGAACCCGGGTCTCCTGGTTCCCCGCACTGTAC
TCTTTCTCCTCAAGGCTGCATGCTGCTTTATATATTTTCTTTTTTATCTTGTGTGGGAGC
AGCATGGCTTAGTGGAAGGAGCACAGGCTTGGGAGTCACAGGTCGTGGGTTCTAATCCCA
GCTCCACCACTTGTCAGCTGTGTGACTTTGGGCAAATCACTTAACTTCTCTGCTTCTGTT
ACCTGATCTGAAAATGGGGATTAAGACGGACCTTGTATCCACCCCAGGATTTAGAAGAGT
GCTTGGCACATAGTAAGCGCTTAATAAATACCATCATCATCATAATCATCATATAGGAAC
TACTCTCCCTGGGTCCATCTCATCCAATCCATTAGGGTCAGGCAATTGGCACTGGGGTGC
TGAGCATGTCCTTGTAGAAACTTCCAAAGCCCCCATCTGGTTCTGTCCACCTGTGCCAAC
CACTGTTATTTACCTAAGACATCTAGGGTAGAAATGGGTTTAGGTAGGTCCATCCTGTTG
CTCCTGCTTTAGTAGCTTTGTTCCTATTCCATTCCCCTTCTCGAGGGGACCAGCTATAGA
ATCTATCGGATTGATCAATTGGTTTGTCCCTTAGCCACGTTTATCCAGGAACTCAGATTA
AATTAAGTATGAGGACGTTCCAAGTGATCACATGTGCCTCCCCTCCCGTCTCTTCAAAGG
CACTTTCTGTCCCCACTTGGTGCTGTTCTGTGGCAGGGTTCAACTCTGTCAGTCATATTT
GTTGGGAAACAGGAGAGAAAAGGTGTTGACTTTTCTGTGACCATGGGATTGTTGGAGCCT
GAACTCACTGGGGACTAATAATAATCATAACGGTGGTATTTGTTAATCACTTACTATGTG
CCAGGCACTGTTCTAAGCGCTGGAGTAGATGCAAGGTATCCAGGTTGTCCCCCATGGGGC
TCACAGTCTTAATCCCCATTTTACAGATGAGGTCACTGAGGTCTGGAGAAGTTAAGTGAC
TCGCCCAAAGTCACACAGCTGAAGAGTGGCGTAGCCGGGATTAGAACCGATGACCTCTGA
CTCCCAAGCCCGGGCTTTTCCCACCGAGCCTCGGGGAAGTCATTTGTTCTTCAGTGAGGC
AGCTTCTCAGCCTTTATAAGCGATCATTATAATAATAAAAATAAGAATGTCATGGTGTTT
GTATAGTGCTTTGTTTTTCCAAAGTGCGTCCGCATCAACTATCATTTTATCCCTCAGAAC
ATCCTTGTGAGGTACAGAGATGCACGTGATATCCCCATTTTATAGGCGAGGAAACCGAAG
TAAAGAGAGGCTGTGACCTGGCCAAGGTCACAGCAGATTAAGGGCAAAGCCGAATTTGAA
CCCAGGTCACCTGATTCCCAGGCCAGTGCGTTTTCCATTGCACCACCCTGCTGCGCCTGC
ACCTATGATGCCTCTTGTTTTTCCGTCTTTGTCATGGCTTAGCTTAGACCGTGAGCTTGC
TGTGGGCGGGGAACGTATCTACTGACTCTCTACTCTCCCAAGTGTTTAGTAGGGAAGCAG
CGAGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGTTCGAATCCCAGC
TCCGCCGCTTGTCAGCTGTGAGACTTTGGGCAAGTCACTTAACTTCCCTGTGCCTCAGTT
ACCTCATCTGTAAAAGGGGGATTAAAACTGTGAGCCCCACGTGGGACAACCTGATCACCT
TGTATCCCCCAGCACTTAGAACAGTGCTTTGCACATAGTAAGCGCTTAACAAGTACCACC
ATTATTATTATTATAGCTCTCCACAAAGAACAAACACTCGGTACTCCTGATTGATTGCTG
TTGTGCTTTGCAGCTGTCCTGTGCTGTCGACTGGGAGATTCTAGTAGAGTTATAAGGAAG
CAGCCCGGCCTAATGGATAGAGCACGGGACTGAGAGTTAAGGATCCAGGTTCTAATCCCG
GCTCTGCCGCTTGTCTGCTGGGTGACCTTGGGCAAGTCGCTTCACTTCTCTGTGCCTCAG
TTATCTGTAAAAAATGGGATTAAGAATGTGAGCCTCGCTGGGGACATGGACCGTGTCCAG
CCCGCTTACTTTGTATCCACCCCAGTGCTTAGAACAGTGCTTGGCGTGTAAGTGCTTAAC
AGATGCCATTATTTTATCATCAGTGTGTGGAGATAAATCTTAGAAGTAGCAATTTCAGGT
AGATGCCAAATTAGTCTTAAGTTAGCAGTTCCTGGCATGTATACTAGAGAAGCAACATGG
TTCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGTTCTAATCCTGTCTCCGC
CGCACGTCAGCTGTGTGACTTTAGGTAAGTCACTTCACTTCTCTGGGCCTCGGTCTGTAA
AATGGGGATGAAGACTGTGAGCCCCCCATGGGACAAACTGATCACCTTGTATCCCCCCAG
CTCTTAGAACCGTGCTTTGCACATAGTAAGCGCTTAACAAGTACCATCATTATGAGAGTG
TAGTGAATGCAGGTATATCCTGCCTGGGACATCTCCCTGGTCTGCTGTTCCATGGCAGGA
CACTCTGGTGTCCTTTTGCTCTCCCATCATTTCTCAATGCGGACTCTGGCCGTCTCTACT
CAAGGCAGCAAATAAGGGCCATTCATGCGCACTGGGGGAAAGGCGATGCAAGTCTCTATC
TTAATAAAGGAAAAAAAATGAAGGTAGATGTATTGGGATTGCTTCCTAGTGAGAATAAAT
TGATTAATTTATGATGGCAACTGTATTTGAGTTCAAGGCTGCTGAGTCCATGCAACTTAG
ATAAGTCTCAACTTCTTGCAACCACTCATCTTGCTGCCCAAGTGGCAAAATTAAAAATCT
GGACTTATGGGTTCAAATAACTTGTTGGTCTTTATTTGGGAATTCAGTAACGAATGGAAG
CTGCATGTAGGAATTAGGAGAAAATTTGCCAGAAACAGGGTTGCCCACAGGTTTTCAGTA
ATGGGCCTTGTGATTGGAAATCCATATTTGTGTGGGCTGCAGGTGTTTTTTATTGAGAGC
AATGGTGATGTGTATCTAGCCTGCCAGCTATTAAAATATGGATTTGTAAAACATTAATAA
AAAGTTTTTTAAAGTTTAAACTTTAGTACAAAAAAATTATTAGGACAGTGGCAAGCCTAG
CACTAGCCTTTGATCAGTTTAAGAAAAACATGGGTATTTAACTATTGTCAAGGACTATAG
AGAGTATTGTCAGGGCACATGTCAATTTTGACTAGCCCCTGCTGGGCTTGTGGTTCATGT
GTGCTAATTAGGATAAAAACAAAATTGCTAAAAATCTCAGGTGGCTGCACTTTACTGCCC
ATTAGACTGTCCTGGCTTAAAAGATAAGCAGCGTGGCCTCCTGTGAAGAGCACAGGTCTG
CGAGCCAGAAGACCTGGGTTCTAATCCTGGATCCGCCACATGTCTGCTGTGTGACCCTTT
TCTGTGTTCCCTCATCTAAAATGGGGATTAAGGCTGTGACCCCTATGTGGGACAGGAACT
GTATCCGACCCAGTTACCTTTTATCTATCCCACAGTGTGTGGCACACAGTAAGCCCTTAA
CAAATACCATAAAAAAGTGAAGTATCTGCCTCACTTTTTTTTTTCCCTAAAGAAGGTAAT
GCATCTTGCATTTAAAGACCACCTGCCTAAGTAAAAGCTTAGTTTCATCAAGGAGGCCAG
TAGTTAATGCATTTCAATCTTTGAATAAGAAAACATAGTTCCCGTGGGGCTTCTGGGGCT
AGAAGGTTGATAAATACGTGACCCCAAGAATGGCTGGTGCCTCGGCGGGTCACCCCTAGA
CAGTTGAGGTGAAGTTTTCCAAAGCTTTGGAATGCTCAGAAGTCCGTTCTCAGGGTGGAG
GAGAGGGTAAGAAGGAACCAGTGCTTTACCTCATTATTCTCAGAAGGAAGGGGGAATGCC
TGCTCTCATTAGGAGAGCACAGCTGGTCTTTGCTGATTAGTAGTGAGCCTAATATTCTCT
TATAAGGGTTCCTTGTGGGTGACTCCATTTTCAGGAATCCCAACAACTCCTAGGGTGGTG
TAGGATGTATAGGGTTTGAAATGTTGCTTCAGAAAATGAAATGTGGTGGCTACTCTATGC
TTCGATTGCAGATAGTGGGGCGTAATTTGGACCTATACTGTAAGACCACCTGGCGAAAAG
ACCAGGTTGTTTGGGAATCGAGGGTGGTCTCATTAGTGAACTCTGCTAACGCAGGAGGAG
GTTTTGGGAGAGTTTTATCCATTACTGAGATGACTTCTACAGAGTCGGATGCTTTGCTTT
GCGCTTAAGACTCGCCCGCCTTCTTTGGCGAAAGATGGTCGGAAGCAGATCATCTGGGAC
TGCCTTCGGACCCAATCAGTTTAGGTAATGGGAATTTTAAATAACTGAGCAGAATCGAGT
TAGGCTATCTTAGACCCGTTTATGCCCAATTTTGTGTAGCTGTCTGAGCCAGAGATCATT
CATCCAGTCGAATACTCTGTATAACCGAAGTGAAGGTAATCAGTTCTCTACTGAGTATTG
TAAAACTTGATCACCATTGGACAGAACACTCATGTTCATTGTTGAGTTAAGTGCATTTGT
TAAAGCCAGATTTTGGATATTAAACTTGGACTATTTTTTGGTTTTATTCCAGCGTGGCTC
AGTGGAAAGAGCGCGGGCTTTGGAGTCAGGGTTCATGAGTTCGAATCCCAGCTCTGCCAC
TTGTCAGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTCCCTCATC
TGTAAAATGGGGATTAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTATGTCTA
CCCCAGCGCTTAGAACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAACATTATT
ATTATTGTTATTATTCCCACAACCAAAATGTAAATCGGGGGCCAGTGGGGTGTAGTGTAA
ATTATAAATCACTCTTTCCCAAGTGAGTTGACTTTTGCAACATTTGATGCAAAATATTAG
TGATTTATTTTCTAATTCATATTGGTGTTCAGTTCAGCCTGGTGTTGCTTTTTTAATCTA
CCAGCTAGTATTCCATGTGGTTTAGCTGTTTAAAATTTTGATTTGTATGTTATAGTGACC
CAACTCTAATCAGTGTGTTTTTCTCCCTTCATCCTGCCTAGAACAACACAGAACAAACTT
AAAAGCAGATTATTTGAAAATCGATGGGACCTACATTCCTTTGACTTCAATTCGGCATTC
AGATTTTAAAGCTTAAAGATGAATTTTTCTGTTTTTAGATTGTGAATCGGCACGGCCCCG
AAGCAGACAGGCATTTATTACGCTGCCTATTTTCGCACGTGGATTTCAGTGGCGATGGTA
AAAGCAGTGGCAAAGATTTTCATCAGGTAAATTTGATGTATTTAAAGTTTAAATATTTAG
TAATATTTAAATATTTAAAGTGTGTGTGTTTAACTGTTTGGCCACACCGAGTACCTAGTA
GTAAACTAGTTGCAACCAGGGAGTACTTTTGGTTTAGCCTATTGCTAGTTCGTTTTTTTC
TTAATTAGTAATGTGGTGATTTCTCTTCACTCACATTTAAGGGCATATTATAAATTAAGA
TCTTCCTGTTTTGAATATTGAGAAATTCCTTTAGAAATTAAAAGGAGGAAAAAAAAATGA
AAGTAGCCTAATGAACTAGTTTTGTGAATTTTTTTTATTTTAGACTCAGTTTCTGATTCA
GGAGTGTGCGTCGCTGATTACGAAGCCAAACTTTATCTCGACGCTGTCCTATGCCATTGA
TAATCCCTTGCACTATCAGAAGGTTTGTATTTCTATTATGAGGGTCAAATCAATAATGTG
ACTACCTGCTACCATGCATTACACTTGTAAGTGCTTGGGAGTTGAATACAGTAGAATCAG
ATGTAATCCCGGCTGTCATGGAGTTTGCAATCTAGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGGCAGATCCTGG
AGATATTGTGAGGGAAAATGTACAAGGTCGGCTTTGAGAGGGGGTGGGGGGCGGGCACAG
ATCCAATAGCAATCAGTGGTATTTGAACATCTTCTATGTGCAGAACACTTTACTAAAAAG
GTGGAAGGATAGAGTAGAACTAATAGGTCTCTGCCCTCAAAGAGCTCACAATTTAGCAAG
TTTATTGGGGTTGAAAGAGAGGCTGGAACCAAGAATCATGTCAAGGTTGTGACCTTTAGA
GCTGTGGAGGATGGTGGTGTCAACTGACAGGAAAGTTAGGTAGAGGAGGAGATTTCCTTC
AAAACGGTATATAAGTTCTTAGTATGTTCCAAGCACTGTATTAAACGCTAGGTTTAATAG
ATCATCAGATCAAATGCAGTCCCTGTCCCACAAGGGGCTCCCATTCTTAAGTAAGAAGAT
CAGGTTTTGAATCCCCATTTTGCAGGTGAAGAAACTGAGTCGTGGAGAAGTGAAGTTACA
CATCAGGCATGTGGTAGAGCTGGGATTAGAACCAGGTCCTTGGGTTCCCAGTGTTCTATC
CACCAGGCCAAACTGCTTCTCCTTGATGTGGAAGCTAAGTTGAGAAATTCATTTGGGGAC
ATACGGACTTGAGATGTCCAGCAGAAATGCAAGATTGCAGAGCGAGAGGAGTCGGGCTTA
GGGAGGTAGATCTGAGAACCTGCAGAGTGCTGGTAGTTGAAGCCGTGGGAGTGGATAAGC
TCACCAAGGAGTAACTAATGTCAAGTGAAAAGAGGACCCAGAACAGAGCTTTGCGGGACA
GTGTAGCCAACGGTTGAGAAGCAGAGGGAGCTCTGACTGGAGAGACAGGCTAAGCTAGAG
CCGTAAGAGTAGTCACAGGAGGTAACTGTGGGGAAAACCAAGCTTTCATATTATTTCCAG
AAGGGAGTGAGCTACAGAACTGAAGGCAGCCGAGAAGTCAGTGGGGATTAGAGTAGAGTT
TAAGCCTGATGGGAAGGTGACCTAGGAGCGGGTGATTTCAGTGTAGTGAAGGAAGCAGAA
GCCGTATTGTAGATGGTTGAGGAAAGTTAGTGGCGGGAGCCACTCTAAAAACCAAATAAA
ACCAACCCCCAAACACCTGGAGATTGGCCTTTTTTTTTTCATTTTGAATTCTGTTTTTAC
ACCTGCATTATCAGAGTGACTTAGTGAGTCTTCATCATAAATATTGGTGCAAAGGTTTTA
AGGATGTAGTTCAGGGCTCCGCACACAGTAAGTGTTCCAATAGCAGTGATTTTTAAGGTC
TGATCATGCTGACTTAACGCAGTGTCTCTTTTGCTGTCCTCAAAATGAGTCAGCTTCACG
TCGGTGTTGCCATTTCATCTTTCTAATGCAGTGCAAACAACTTGAGGATGGTTTGGGCTC
TGCAAAGTTTGGGTCATTAAGCTGAAGCGTTATGGGAAAACACTCACAATTATGGGTTAT
GGCATCTTAGAATGAGTAGGCCCACTGCAGAAGTGCATGGCCTGTCTCTCTAATTTGCAT
ACGTGGTGGGCAGAGATACATGGAAACTTTGTTTTTAAAGTACTGCTCTTCGTTTCAGAG
TCTAAAGCCGTCACCCCACTTATTTGCCCAATTGAGTAAAGTTCTCAAGTTAAGCAAAGT
TCAGGAGGTAGGTGAATTTATCATGCAGTTGGGTTTATACTGTATATTATATAAAAGTTT
TACATTTGAGAGTTTCATCTTTAATTACTCTACTTCTGCAGGTAATTTTTGGTCTTGCGC
TGTTGAATTCATCTAGCTCAGATCTACGAGGTTTTGGTAAGTTGGGTTCACTGAAATACG
AGAGCCCCAGTTTTCATTTTTCCATGCGCGTGTATGTATTGGGAGCTGACGTGGCCATCC
CCTCCGAGGGGACTCCTGGGGCTTTGAGACTACTGCCAGGTGCAGTCGACGAGGAGTGTG
CCCACAGGAAGAGTAGGAGCAGAGGGAAAGTAAGAGGTGGAAGACTACTGGGAAAAAGGA
GCAAGTAGTGGGGCACTTCCAGCCATCTGATCAGCTGAGCAAGAGAAAAACAGCAGAGAC
AGACAGGGAGAGAGTCTGGCTAATGGAAGGAGGAGAGACAAGTATAAAAGTAGAGAAACT
GGCCGAAAGTAGGGGTTTACACAGAACAGTAGTGAGTGAGTAGTGTTGTCATGTTGTATC
GTGAAAGAGCTGTTGTCTTAATCCCCAGGCTTCTAAAGCTTATATCAGTGGCTACCTCCA
ACCCCATGGAGAAGATCAAGGCTAAGAGAACTTCCCTGATGTGCTGTTGTTGTAGTTCTG
TGGTTTTAGAGCTACCTTCAAAGTACAAGAACGTTTCCTGACCCAGGGCCATTTGAAATG
GGAAAAGTTATGACTTCTTAGCAGCCTCAGCTCCTAGGTGTTGCAGCAGAACATCAGAAC
AAGATCTCTGAGTCCAGCTTCAGCATGGGCACCGTAAGGAGCCACTGCTATTTCAAAGCA
GATTCCTTACAAGGTTTAGATGTCCCCGTGTCAGGGAGAGCCCCGTGAGTCGTAGTATTT
TTAAGAACCGAGCAGTGGGAGGAGGTTGAGAAAAATGAAGAAGAAAGGCAACCAAGTTTG
GGAGAGTATATATATCTCTATGTGTATATATATATATATCTAAAGAAATGTTCATGTTTG
GGCAAGAGTTTCTCTTTTTTTTTCCCCTCTTCAAGCTGCCCAGTTTATCAAACAAAAGCT
TCCAGACCTTCTGCGCTCTTACATCGACGCGGACGTTAGCGGAAATCAAGAAGGTGGCTT
CCAAGATATTGCAATAGAGGTCTTGCACCTCCTCCTCTCCCATCTCCTATTTGGGCAGAA
GGGAGCCTTCGGGGTTGGACAGGAACAGATCGACGCATTCCTCAAGACGCTGCGTAGAGG
TGAGCTGTCATTCCAGCTGATTTGAGTTTGGGCACTGTCTGGCCGGAGCAGATATTCTAG
CATAGAAGGGTCTTAGGTACGTGTCTGGATCCGATGACGGTGGCTCCTTGGTGACCAGGG
AGACCCTGCTATTTTCCTTGCCACCCACAATTCGGGACAATGCTTTAAAATATTTTAAAA
CAACTAAGAAGAGAATTCGGCATGGAAAAACACCACACGTATTTGCATGGTCTGTCGTGT
TTTCTGGGTACTAGAGTCAGAAACGGGACCCAGCCGAATCAGTGTCCTGCAAGCCCAGTT
ATTGGGTGGAGGCGCGCAGTTGAGGAGTGTGGCCAATGGGTAGAGCACAGGCCTGGGAGT
CAGAAGGGCTTGGGCTCTAATCCCGGCTCTGCCATTTGTCTGCTCTGTGATCTTGGGCAT
CACTTCACTTCTGTGCCTCAGTTATCCCATCTGTTAATCAGGGATTAAGACGTGGAGCCC
CATGTGGGCTGTGGACTGTGTCCAACTTGATTAGATTATGTCTGTCTGCCCAGAGTTTAC
TGTAGTGCCTGGCACATAGTAAGAGCCCAACAGATACCATAAAAAAAAATTGCCGCAGCC
CAAAATTTGGAACTGTAAGGAATGCCAGGAGCCATCTTATTCCTGACCCTGGAGCGTATT
CCAAGAAACTCTCTAATAAAAAGGCTGCACTTATACCCTCCCACCCCCCGAATCAAAATT
CCCCTCTCTCTATTTTCCCCTCTCCACTCTTGCCCTCTAGGTGTCACAAATAATAGGGAG
GGGTGGAGGACAATAGGTGGTTAGATAAATACCATATTGCAGTTTAAAAAAAGTGGAATT
TTGTGGCATTTAAGCTTAAATGATTCAAATGCACATCTTACTAAAACTGAAGATAAATTG
AAATTTTCCCCCCTTTCAAATGAATAGCTAAAGCTTTAATAGGCGGACCATTAATAATGT
AAAATTGTACTCTTATAGGATTGCACCTGCACGTGTATTTTTTGGGTGTGAAAAGTAAGA
CCCCCATTTTAAGCAAAATGCTTTTCTCAGAATGCATTCTGTCACCCAGGGCTTAGAATA
CTTTTTTAATTATCCTGCTTTTAAGAGAGACCTCAATGTTAAGTTGGCCAGCTTTGAGTA
ATTCATACGGTAGAGTCCACTTGACTTGGTAGTGGTTTTGGATAAATTCCCAAACTGGTT
GATTTCTCAGTCTTATAAGTTCAAATTTCTGCCCACTAACCTACAGGCTCAGTCTCTAAG
GAATTTTGATGGCATCACTGACCTCCTGGGTTGAAATTGCCCCTTATGTCAGCTGGAAAA
AAAAAATCAAGATTTATTCTGTTTGGTTTCAATGATACATAACCTCCACATTTTGTTTGT
TTTTGATTTCTTTAAGATTCATCAAATACGGTCCTATTTTTGTCTCAGTGTATGAGAGTG
TACTATCCGTGGAATGCTAAGAAATAGAGGGGCATATAAAAGAAAAGGTGCAATCTCCCC
ATTCAGGGAATAGCAACTATCCTTAATCTGGGGTAGAAACACTGAAGTACTTAAAAAATG
GAAATTAGCAACTGAAGATGAATTCTGCTTTTAATAATGCTATCATCAAACTTATGCTAA
AACTCTGAGGGCTGACTGAATAGAGAACTGCTTGTCGTGCACTCGATCAAACTAATAATC
TTGTCAACTTTACGAATCTCTTCACCAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTT
GCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGACTCT
GGAGGGATAGCTAAAACCATGATGGAGAGCTCTCTTGCAGACTTCATGCAAGAAGTTGGC
TATGGCTTTTGTGCAAGGTTGGTAGACTATGGGATATTAAGATGCTTACTATAATATTTA
GCCCAGTGAAATTTCCTGATATAGGCTTCTGCTCTAAGGAGCTTCACTTAATTGTTTTCC
AGGATTTCAAACCCCAAATTTTACAGCCTTAAGAAACTGGTTGTAGAGCTAAAAGGAAGA
AGGAAATATCTTAAAAAATGAAGGGTGGATTCATGAAGATAGTCCTCCGCCAAAGGGGTT
CTTGGCAGAAAACTTTGGAAACCAGTACTCCAGCAGTGTAGCCTCTCTGAAAAGTCAGAT
TTTTCTGTTTTTAAATGTCCTTTCTTAGATTTGAAAATCTACTCTGACATTTGACTTGAT
TATTTACCACTTTGAAGCAGAGCAATTTAATTCAAATAGGTTATTTGGTTTGATTTGGCT
TTTGAGGGTAGCCAAGTAATGGCATTCCCTGTCGCATTGTCTTGCATTTGAAATCCCAGG
GAGTTGGGTTTTTTTGCCTATACTTACCTTAAAGTGTCTAGAGTTAGACTCTAAGAAGTC
TCACTCATATGACTCATTAATTCTGAGTTCAGTGTGATCTGGCAGTGTTTTCTTGCTGTT
TTTCCGGTCATAGTAAGTACAGTATTGAAATACTGTATACAGTTCAGTTTTAAGAGAAGA
CTGCTTACTTCTTCTGGCTAGATACTTCTATGAAGAGGGATCTTGTGTTTTACTGAAATA
CACGACCTCGCCGAGGTTGATGACACTTTCTCGTGTTGTCTTCTTGGTTTAGTATTGAAG
AATGTCGCAGTATAATCAGGCAGTTTGGTGTTCGGGAGGTCACAGCAGCCCAGGTCGCCA
GGGTTTTGGGAATGATGGCCCGCACTCATTCAGGGTTGACGGATGGAATTCCATTACAGG
TAAGTGCCTCGGGTTAACTAGCAGTTTTAATAAGTGGCCACCGAGCATTGCATCTTGTAA
AAAAGGACCATTTAGATGGTTTATGTCCCGTGTTTTGCTTTTTACAGTCCATTTCAGCCC
CTGGCAGTGGGATATGGAGTGATGGAAAAGATAAAAGTGATGGTGCACAGGCCCATACCT
GGAATGTGGAAGTCTTAATTGATGTCTTGAAGGAGCTGGTGAGTTGGGGACACTGCTTTT
CGTCATTTCTGACGATGCAAATTACCAGGGTTCCCAGGGTTCCGTAAAGGGAAGAAGGAG
AAAGGAGAAAAATGGAGGAGGGAGAGGGAGGCGCCAGGATGAAAACATCACGGCGAGCAG
GAAAGCAGAACCCAGCTGGAAGATTGAAAATGCAGATCAGATAGCATTCCCAAAAGCCAA
GCGAGTGACCCAGGTGAGATTGCTCCCAGGAGCTCCAAGTGTATTTTTCAGGCTGAAAAT
ATCCTACCTGAAGAAAACTAGCAGTGAGGGGAGAGCTTTCCAGACGTATTAAAAAGAGGA
TCGGGAAAACCAAAGAGAGAAGCAAGTGAGGGGCTCTTATGATGAGTTAATCGAAACAAC
ACAGGCTAATAAGGAAACAGTGAAAGTTTTAAACATACAGTACCCAAAAAACTTGCAAAA
GCAAAAAGACAAGCACAGTTGTGTAGAACAGCAGAGGGACCCCTAAATATCTATTCTCAA
GTCCAGATAAGAGTGGTTATTTTGGCTAGTCATAGTCAATGTAAAGATAGCCTAAACTTA
TTTTGGGGAACCCCATTCCCTTACTACCAAGAATGGTAGGAACAGAGAGAAAATAGTACA
AAGTGCTTAATGAGCAAATTTGAGCTCTCGATGCACTATTCGCTCCCCCGCCCCCCACGT
CTTTGTGACCTTGGGCAAGTCACTTCATTTCTCTGTGCTCATATGGGACAGGAACCGAGT
CCAACCCGATTTGCTTGTATCCACCCCAGTGCTTAGAATAGTGCCTGGCACATACTAAGT
GCTTAACAAGTACCATAATTACTATCATTACCTTTCTTCCCTTGGAGCTCCAGCTTCAGG
TAAAGAGTGGTCTTTAGAGCATATGTTATTCCAAGGATTTGTTATCTCCTCTAGACTGGA
AGTTCCATATGGACAGGGAACATGTCTACCTACTCTGTGATTTTTGTACCCTCCCAAGTT
CTTAGTACACAGCTCTGCACATAGTAAGTGCTCAATAAATACCATTGACTGATCTTATCG
GTTTGGGAGCTGGACCATCTGGAAGCTAGGTTGTGGGCAGGAGGGGTGACCCGTATTGTT
CCAAGTAGACGCTTAAGTGAAATGTTGTGAAAGAAAAGTCAACTCTTGTTATCAATCATG
CCAACTGTGTACAGGAAGTGTACTGTACATCTGCACAGAGCCCTCTACTAAGAACCTGGG
AGAGTAGAGTGCCCTTGAGCTTACCGTTTAGGCTGAGGTTGGAGGTTGTGGTTGGTTTTT
ATATGTATTCCAAACCTCATTTTAGCCCATAGTTATAATCTCCGTTACGGGATTATCTCA
TATTCCCCTGGTAGTTGAGTGAGTTCACTGTGAGCAACTAATTTAAGACCAAAGGGAGAA
AAGACATATAGGCTGTTGAAAGCTATTAAACGGCATGCCTTGATTCACAAGAAGCAGCGT
GGCCTAGTGGAAAGAGCATGACCCCGGGAGTCAGAGGACCTGGGTTCTAATTCTGACTCC
ACCAGTTGTCTGTTGCGAGTGGCCTAATGAAAATCAGCGTGGCTTAATTGATAGAGTATG
GGCCTAGGAGTCAGAAGGACTTAGTACAGTGCCTGGCCTATGATGATTATTATTATTATT
AATAAGGACCTGGGTTATAATGCTGTCTCCCCCACTTGTCTGCTGTGTGCCCTTGGGTAG
GTCACTTCACTTCTCTGTGCCTCAGGTAAAATGGGGATTAAGACAGTGAGCCCTATTCGG
GACAGGGACTGTGTCCAGCCCGATTACCTTCTATCTATCCCAGTGCTTAGAACAGTGCCC
AACACGTAGTAAATGCTTAATAGATACCATGAAAACAAAAACACTTCTCTGTTTCATCTT
CTGTAAAATGGGATTAGATACCTGTCCTCCCTCCTACTTACCATGTGAGCTCCATGTGGG
ATGGGAATATGCCCAACCCAACTATTTTGTACCTACTACAGTGCTTAATAAAGAGGTCCA
CACACAGTTAGTACTAAACAAATAGAATTAGCATTTATTCCAAAGTATTGAGCTCCTACT
GTATACACAGGACTGTACTGAGCATTTGGGAAGAATACAACAAATTCGTTTTACATTTGA
TACCTGAAAACAGTGGTAAATGACAAAAGTACTTAGAAGGACTAACTTTGGCTATATTTA
AGCTAGTTGGTTTGCAGCGTGAAATAATTCACGTGGTATTCTCACGTCACATTCACTTAG
GTTACACGGAATTTTTCACTGATTTTTTTTTTTAAACCCAATTTGCCATTCTCCTTTTAA
CTGTATCCTCCCTTGAGCCGGTGACCGTGGGAGGATCTAGTCTAGATGGGTTTAAGAAGA
AGAATTCAATGTAGTATTTCATAGGCAGTGAGTAAAGTGGTAGAATTCTGCAGGGCTTTC
ATAGTGCTATTTTAATGTGCTCTCTGGAGTGGGGTATGTCTGGTTCCCAACTCTGACTCC
TCCTCGTGTAACGCTTCAGCCCTGACAGGGGTTTCCACCGGAAAATAATGCCAGCTGAGG
TGAAAGCCCTGGTTCAGGCTAGAGTGGCCTGTTCTGGAGCCTGCTTTAAGCAAGCCAGGA
TTGAGCTGGCAGAAAACAGCATCTCTCAGTGACATTTGCAAGGCCTGCCCAACTGCTGTC
CACCTTAGGTGTCTGCCCTGGCTAATGCCGCTGCCTGGGGAAACGCCTGCTGGAGCTGCA
GAAGCTTGCTGGAATGTTAGCTAGCCAAACTAAGGCAAGGGAAGATCCATGCTGAAATCT
CCATAGCGTGGGGCTCGTTAAGAGTGGGACGTGGAGCAGTGACCCAGCTTATGACTTAGT
GCCAGTTACTAAAATGCCGAAGTATATTCATGCCAACCTGCGTTTTTGAAAGCTAACGGC
TCTTAAATCAAAAGTCCTTCAGTTCTAATTCCTTAATTGCAAAGATCATGACTACTAACT
AGTTAAAATTATCCATCTTGCTGAATTGCCTGGTATCTCTTTAGAATGATCAAGTTTGAA
TTTAGGGTAAGTCATATTCTTTGAGCTGACAGACCGACCATACATGTGTACTTTCTGTCC
CTCTATTCTGAATGGAATCAGTATTAAATTAAATGTTACTCTCTTCCCACTGTAGATAGT
GAGCTTTTTGTGGGCAGCGAACACGAGTACCCACTGTATTGTATTGCACTCTCCCAAGTG
CCTAGTACTGGGCATACAAGCGCTCAGTAAATACCATCGATTGAACGGCTGTATTGTGGG
GTATGCTTTTCTGTAGATTTCCGTGTTCTCGATTGGGATCCGGTCCAGAACCTCTGAGTG
CTTACGTTGCTTTGCCGTCGGGCAATCTGTCGATACCATTGATGAGCACGAATGATGATG
GAAAATGTTTTGACTAGTTTTAAACAGTACACTTTTGATCATTCTAGAACCCTAGTTTGA
ACTTCAAGGAAGTAACTTACGAACTGGACCACCCTGGATTTCAAATTCGTGACAGTAAGG
GACTGCAGAATGTGGTGTATGGCATTCAGAGAGGCCTTGGCATGGAAGTCTTCCCAGTAG
ATCTCATTTATAGGCCTTGGAAACACGCCGAGGGCCAGGTGAGTACTTGACACGGAAGAC
GACACCCAGCGAGCCCGCAAACGTTTGCATCTGAGTTTCAGAACTTCTCTTTGCCTGGCA
CTGGGGAAGACAAGAACTGTCAAGTATTTTAAGTAATTTGGATAAAAGACTGGATTTCCT
CAAGAAGTCTAACGGCAAAATATAGCATCACATCCACTCCAACACTACTTCTTCCTTAGC
ACTTTACCATTATCTGAATAATCTGAAGGATTATAATGTATATAATGTACGGGCATTTTT
AAGAAAGCAGCCTCATTCTCCAGGAAAGTGAACTTCCTGTGGCCTAAATAAACCCTTGGA
TTGAAAAGCCTGTGGCTGCTTATCAGAGTGGGCCCCTCTTGAATTTGGAGGTTAATGAAA
GAGGTGGTTCTGCTCGCATTTAGGGTTTTCAGCATAATTACACTTTACAGCATTAAAGAT
CTTCTGTTCTTGATCCTTGTTATAGCTCTCCTTCATTCAGCATTCCCTCATAAATCCAGA
GATCTTCTGTTTTGCTGATTATCCCTGTCATACTGTGGCAACTGACATCCTGAAAGCACC
ACCGGAAGACGACAATCGAGAAATAGCCACATGGTAACTTCCGTCGTCTAATTTGATTTT
TCTCTGAGACGCTTTCTTTGGTTTAATGATGAAACCGCCCTCGGTAGTACTGCTTGCAGA
TGGTAATGGGCCCATCTGATTCGTGAACGTTATTTGGCAGAGCCACTGTTCCACATTTGT
TGTACGAGGTGGGCTAATGGAAGTTCTCAACGAATAATTGTATTTAGCAGTGAACCTTCA
GTGGTTTCCGTCCGGATTTTGTCGTCATATCTTAGAGCACTCGTGTACCTCGGAGAAATT
CTTTCAGCGTCCATTCCTGTTTAGGGTCCTTAATTGCAAATGGTCATGTTAAAGTTTGGG
AAAACATGGACTTTTGGTATTGATCATTGTGCTGTTGGAGGGAAATAGCATCCTATCCCG
TCTACCTCCCAAGGTGGTGATAGTTTATGTTTATTTTGATCCTTATGGAAAAGCCCTTGG
CCTTTTATGGCCTTGGATTTAGCAGTCATAACCCGTGCGTTTTCTTTTTCCATTCAAAGG
AGTGCATTTTTCTTGGGATGAAGTCCTTTTGGGTTTTTCTTAACTAGGGAAATGGAAACT
GCTTCCATATTCTTTGTGGTTTTGACCGTTAGCATTTTTTAGCTTCAGGACTTTGGAGGA
AGTGCCCTTTTTCCCTCCCCTTAATCTGCTTCTGTCTAAGGACATGTTGAAAGTACAAAT
CAAAGGCTTGTAGAGGATCATGAAGATCAAATAATTCTAGTTGTCAAGCGTGTTCCTCCG
TAAAGGATCTTTATCTATTTTTTGCACTAATTTAACTTGCATGGCTGTCCCCTTAGCCTA
AAATCCTGTGAGTCTTTTTAAGCAGAAAATTCTTGTGCCCATCCATTCCTCAACCCTTTT
GGATGGATTTGGATGAATATTTTCACCATCTTTACTATCCAACTAATTTACAATAGTATA
TAAGGCATGCTTGCCGTGTACAGAACACTGTCCTAAATGCCTAAGGAGGTACAGTAGTTG
ACACTCCCTGCCCTCCAGGAGTTTAAGCATTTTTAGCAAACAATTGGGGTGTCTCATCTA
GGCTAAATCCCAGTCTAACATTCAGAAAATTGAATACCAAGTTAATTAATCATCCGGTCA
CCCAATGCTTACTTTAAATTGCTTCTGTCACTTAAATTCACTCTCCTAGAATTTATTCAT
GTAGAGCATAATTCTGTTTTGGTTAGGAAGAGCCTGGACTTGATTGAATCCCTGTTGCGA
CTGGCTGAGGTGGGCCAGTATGAGCAGGTCAAACAACTCTTCAACTTCCCTATCAAACAC
TGTCCGGATATGTTGGTATTAGCCTTACTGCAGATCAACACCTCCTGGCATACCTTGCGA
CATGAACTCATCTCCACACTGATGCCAATTTTCCTTGGAAACCACCCTAATTCTGCCATT
ATTTTGCACTATGCATGGCATGGTCAGGTAAGCTTTCGATATCTATTACTTCTGTTCTCT
TTTTCCGTATGTGGAAGGAATCCAGAGCCAATAGATAAACTGCTCTGTGAGTTTTAGTGA
CCCAGGCTGGGGCATTTGGACCCAGAGCACTCAGAAGAATTAGTTAAGGGAGGTTTTGAA
GGTAAGTTGTTCTGCAAAAAAGCCCAGCGTGGCTAGATACTTCAGTTTTCCCTGTGTCTA
GAAGTCTCAATTATTTCAACGGTTCTAACTTCCCTGCCAGGGCACAGGCTCACCAGTAGT
CGCTGGAGAGATGGAAACTTGGTTTCAGAGTAAAAGGCTCTGTTTGACATTTAGATTTGA
GTGTTTTAACCGGAAGAGAAAGGATGGCATAAAGTTTTCAGAATTGTACTGCAGTCAACA
AGTGTTTCTCTCTGTGATGCATCACGGGCTGTCTTTTAGCTTTTCTGTTTAGGTCCATGC
ATGGACCTTGGCCTCCAGAAACCTTACTGTAAGGTATCCCTCGGAGGTTTTCTTGAACAT
GTACCTATGGCAGTTGGTGCTCTCCTTTTCATAGTCGCTTGTGATTACTCCCTAAATTAA
CATTTGAAGTGGCTTCTGGTCTCACATTTTAGACATTGGAGCAGCTTGCAGCCAGGGGAG
CCTTCCATCATACTTTCTCCCTAAGGAGTTTGTTGAGAGCCATGGCAGTGTTAGTGGCAT
CCAGATGTTAACAAAGCACTCTTAATAGAACCACACTTTATGGGAACAGTAATGCTTGTT
TCCTTCCTCCCCCCGCCCCAGTTGCTCTACCTTGCTTGTATACAATGAAGTTTTGACCGG
GCTCTTTCTGCTGAATGGATCATGATAGCCTCCTATAGTAGAGCAGGTTCCTAAAAGAGC
CAGATGAGGGGGTTTTTTGTGTATTTTTTTTTTTAAAGCCAGATGAGTTTAACTAGGACT
CACTGATGTTCTGTGATGACCTTAAGCCTTTCTCAGGAGCTTTTCTAAATAGCTTTGAGA
GTAGCCGTACGATTATATCACACCCTATGCAAAATGGCGAGATCTTCACTGGTTTCAGTG
TATTTTACTTCCTGCTGCTAGGTAATCTATTTTTTGATATATTTAAATTACTAGTGACAT
GACTAGTAGTGTACAGTGCTTCTTTGCCCTGGAAATTTGGATTAATGAAACCTACACTTT
ATACTAAGAAAAGATGTGTAAAATGTTAGTCTGCCAGGAAAGCTTGAACACCCGCCTTCG
AGTGAAACTTCTAAATTCTGTCAGGTGTATTAATGTACTGCAAATGATCCGCCCGTGCCT
GAGGGCCAGTAGTTCTGGAAGTCGAGGGCTATTGAGTTTTGAATGTGGAATCTTACTGGA
CAGTTGCCCTGCATTTATGGCCATAAACTTTCGGAGCACAGCTCTTGCTATCCGGGTGAA
GAGGGGTATAAACGAGTTAAAGAAAGCTACCTAATTATTTTTTTTCAGTTCAGCGGTTTA
CATCAAATTGCATATGCCTCTGTGAAGTTTCTCATTTTCTTTCCTTAGGGCCAGTCTCCT
TCAATTCGCCAACTTATCATGCATGCAATGGCAGAATGGTACATGAGAGGGGAGCAGTAC
GACCAGGCAAAATTATCTCGGATTCTTGACGTGGCCCAAGACCTGAAGGTTAATTTTTTA
GTGATATTTTGTCATTTCTCTTTTGGCTCAAACTGTTTTAAAAAAACACCCAAAAACCTT
GAAATATGAAGCCATCCTGCTTCTAGAACTGTGGATCAGCAAGTTGAACATAGTTAGGAT
GTCTGAATTTAAATTTTTGTTTTGGTTTAAAGCTCTTTAGGCTGTCTATGCTTTGCTTAA
TCAGAACTGCAGTTTAATTTTACTATTTTGGAGGGACGCAATAGAATGAGGGAAACTTAC
AACACAAAAACTGAGTTCAAAGGCACTGAATTGTAATTTGTGAGGCTGTTAAAGCCATTT
GGGAAGTTCTCACCATTTTCATTGTTGACTCTTGGACATCAATTCAGTTAGTCGTTCTGA
AATGTTTCTTTGAGGTGTGTATCACTATCTGTTGGGGTTTTGCTTTTTTCCCTAATTTTA
TTTAGGATGCAACTCTCGGTAGACTAGCTGGTCTGGCAGGGCCGGTAGGACTTTGCGACA
AGCACATATTCCTCCGCACTGTTATTGATGATTGGGCACATTTAGTGCTGTGACATTTAG
TTGTGCTTTGGTCATGGTAAGCTCGTGCTGAGACCTTTAAAGCAGAACTCAGAACCAGCT
GCACGCTATCGCAGTTGGTGCGAGGAACTAGTCGTCTTGCTCTGTGCGGTCTTTTAAATA
TAGGTTTTTAGATGACTTTTAAAAAGCACAAGGTCGTTTAGTTTGAAGGTAGTGTCATGC
TTTCGTATTTAGAACAATTGTTCTCACTGTAAGCAAGACATCACACGATACAACTGAATA
GTACCAAACCATTTTTTTTTTTGTCGTCGTAGATCAAGGAAGCACTAGCAGCATGTTAGT
CAGGCTTATCCGTGAAAATAAAGTAGGGATTCGGACAGAAGAAGGGAAAGGGTAACTTGA
TCTTTTGACTAGTAGTGTCTTAATTTTTTTTCTTTAGGCCTTGTCAATGCTGCTAAATGG
TACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCCTCTCGTCGGGAATACCTCAA
ACTTGACAAATGGCTCACAGATAAAATTCGGGAGCATGGGGTAAAGCAGGATTTTTCCTT
TCATTTCTGCCTTTTAATTTTGGTGATTAAAAATTGCTAAAGAAGTGACCGAGTAAAGTA
GCATTGAAGAAATGGAAAATGTTTGCAGTCTGATAGTTTAGCGCAAATATCGGACGGTAG
CATAGTACGTATCGCTTGTGTATTGCAGCAGGTGAGATGAAATCCAAATAGATTGAGAAA
ATCTGTCTTCCTCAGGAGCCCTTCATCCAGGCGTGTATGACTTTCTTAAAGAGACGGTGC
CCTTCTATCTTGGGTGGCCTTGCCCCAGAGAAGGATCAGCCCAAAAGCGCCCAACTTCCT
CCAGAAACACTGGCAACAATGTTGGCCTGTCTTCAAGCGTGTGCCGGGTAAGAACTCTTG
AGCGTGAAATAACTGACTGCTTAAATTCACGTTGTGCTAAACTGTAGCTGATGGAGTTGA
TGATAAAAGTGAGGGCATGAGAGACGTCTGCGGTAGTTTTAAAATGTCCAAGCGTTAGGC
AGACTTGATGGTCTGCATCAAGTCTCGTAAGGATAGTGTTAGAATTTACATCGTGGGTAT
CAATAATCCCTTTACTGTGTGTGTGTGTGTTTGTGCGTAGAAATTTTTCAGTTGATTGAA
ACTTTCTGGTTAAGGTGACATTAACCAGGCTTTGGGGATCTTTTGGTTTGAGCGAACAAT
TTGCCGAATTTTAGGAGTTCTTCCCCCAGAGATCTGGCGTTAGACCTTTTCTGCAGTCTG
AAGTGGAAAGGAGTCTTCGTCTGCACAGAGCTAGAAAATCTAGTGTTATCACATCAGACC
CCCAGTTCTTGTCGTTCGTGCGGATGATGTGTCCAGTACAGAATGTTGGGAAGAGTATGG
CCTAGTGGAAAGACCCCAGGCCTGGGATTCAGAAGACCCGGGTTCTAATCCCAACTCGGC
CACTTGTCTGCTGTATGACCTTCACTTCTATGTGTCTCAGTTCCGTCATGTGCAAAATGA
GGATTAAGACAGGGGGCCCTATGTGGGACAGGGATTGTGTCCAACCTAATTATCCTGTAT
CTACCCCAAGCGTTTAGTACAGTGCCAGGCTCTCAGCAAGGGCTTACAAACCTTAAAAAA
AAAAAAAGTGCTAAGAACCCAGAATAAATTGGTAATTAAGTCCAAGGACCCGTTTCTAAT
AGAATATAACCACATTTTATATATACATATAGTTAGGTCTTACAGATATATATTGCACAT
GACTCAAACATTATGTGATAGAATATTATGAACATTTGTGAATTGGTGAGTGGAAAATTT
CTGGTCGTACTTTGTATTATATCAAACCATCCGGGAGTGAGAGAAAACAGGCCATTGTAT
GTAAATGTTCTCTTGAGTGAGGAAGATTGTGACTCCTTAAGTGGTTTCTGTGGGCCAAGG
AATGTATTAAACATTAGGATATATACAAGATAATTAGGTTGGACACATCCCCTGTCCCAC
ACCAGGGGTCAAAGTCTAAGTAGAAAGGAGAACAGGTAGTCCCCACTTTACAGGTAGGGA
AACCGAGGCACCGAGAAATTAAGTGACTTGCCCAAGGTCACAGCAGGCAAATGATAGAAC
TGGGGTTAGAATCCAAGTCCTGTGACTTCCAGGCCCCGGCATTTTCCATTAGGTCATACT
GCTTCTCGCAGCCCAGATGTGCTCCAAGAACTGGTTGAATTTACGTAGCTTTCTTTGGCT
AGAGGCTAACATATTTGCATTTTGGTAAATTTTGCAATCTGAAAATCAGTAGCTTAGTGT
TGTGAACACTTTGGCAGTATACACTACCATGTGGGACTCCTTTAATAAAGTCATGCCTAT
AATTTTAGAGCAATATTAATGCTCAGATGTGCAGGGGAATATCTCTAACCACCAGTAATA
TAACGTAAATGAAACTACATGATAATGGATTTGGAACTAGTAGGTTTTTTTAAAATGGCA
TTTGAGCGCTTACTCTGCAAAGCACGTTTTTATTCTAAAAAGTTCAAAAATGTCTACTTA
GTATAGTGCTCTGCACACAGTAAGCACTCAAAAAATACCATTGATTACGGGGAAAATGTC
AACTTAAAAATTAAATTAACACTCATCATCTGGAAAGGGGAAGAAAATAAAAACCATAAT
TTTGCTGCTAATAAAAACATGGTATACCGTCATCCAGAACCTTGCTTGGGTGTAGGAAAA
ATGTTATAGAGGAGGGCAACTAGGATGGTGATAGGAATGGAGAACCCCCTTTTTGAGGCC
GAGGGAGTTTAGATTTTTCAGTGTGGAAAGTTACATGTCAAGAAGGAACATAATGCATGT
CAACAGAATGGTGGAGAGTCTGGACAGGGTAAACACAGAATTGTTGTTCATCAAGTCCCG
CCGTGCCAGGATGAGGTAATACCCACTGAAGTGTGACGATTCAAAACAAATGAAAGGAAA
CGTTTCACACAGCGAGTTCTAAGCACCTGGAATTTGGTGGTACGGTAAACAGTGTATGTA
GAAAAAACTAGGAAGGAAATGTCAGTAGGCTCAAGAGATTTGAATAAATTCAAAATTAAA
CAGTCCATGAACGATTACTAGAAGGGAGGTTGGAATGTGTGGATAGGACGGGGAGATCTA
CACAAGCATTCTGTTGTAAGTGGGAGTTGAATCGTGCACTTGAAGAACTATTGGTCTGGT
GCAGGATTGGAGTTTTTAAAACTTTCTTCATGAAGCCAAATCCTCCACAAATACCAAATT
TTGTAAGTTTCCTGAATTTGTGCTGCTTTGTCATTCAAACTAGGGTGTATTTTAGAACCT
CAGGCTCTCCAATTTGGAAATAAACTTAAGTAATTAGGAGGGGATGCAGGTTTGAAAGTG
CTCATTACTCAGGGTGAGTGTTGCGTGCCCTTTGACGCCTACTCCTTCTGGCCTCTTAGA
CGACTCCCTTAGAAGGAGAAAAGCACTTTGCCCTCCACCTCTCCTCTTCACAATTGCCAG
CCCAGACCGGAGAAAAGCAGTTCGGCCTCCACCTCTCCCCTTCACAATTGCCAGCCCAGC
CTCAGCCTACTCACTGTACATGCTGGCGTGACTGCCTGGGAAGGGATTGTTAGGTTTTTG
TTTTCAGTAGTGCACATAGTGATGCTTAATAATGCTTGGTATTTGTTAAGCGCTTCCTAT
GTGCCGAGCACTGTTCTAAGTGCTGGGGGAGATACAGGGTAATCAGGTTGTCCCATGTGA
GGCTCACAGTTAATCCCCATTTTACAGATGAGGGAACTGAGGCACAGAGAAGTTAAGTGA
CTTGCCCACAGTCACAGCTGACAAGTGGCAGAGCTGGGAGTCGAACTCACGACCTCTGAC
TCCGAAGCCCAGGCTCTTTTCCACTGAGCCACGCTGCTTGTAAACTGACTGTGAGCTCTC
TTAATTGAGTTGTATTTCTTCCTTTTGCCTTCCTTTCCCTGCTGAGTGTGGGACCACTGC
AAAAATGGCATTCATTTAATAAGCTCCCCTTGAGACTGTAAGCTCGTTGTGGACAGGGAA
TTTCACTGTTAGAATTTCTCAAGTGCTAGTACAGAGCTCTGCACACAGCAAGTGCTCAAT
AAATACAAATGAATGAAAAGAATTGACATATTTTTGCTTCCTCCTGGTTTCATTGATAAA
AATTTGTAAAGAGATTTGGTCCTATGTCAGAACAAGATCAGAAGTGCCAAAGTAATTGTG
ATAAGATTGGAGAATGGCTGGGGGCAAAGGGAGCTTCTCGCTGGCAGTCAAGATTTGAAC
GATTCCTGAATTGAAGAAGTTTTTGAAAACATGTAGTGCTAAGGCAGCTCAAGTCCCTCG
TTATGATCTGCACGAGACTTTTTCCTGACTTGATTTGCTTGGGAAGGAATAAATCTTGGT
ATCCATTTTTTATTTCAGCCAAATAATTTACCAAATGCCACAAGTTCCTATTTTAGCCCC
TGAGCTCATGAGATATGTTTGAACTTGTCTTCAGTGATTTAGTGAAGGTGTCTCAGGAGC
ATAAACATTGGTAAATATTCAAGAAATGTTATGTGCTTTCTACTTAGAGAAGCAGCGTGG
CTCAGTGGAGAGCGCATGGGCTTGGGAGTCAGGGGTCATAGGTTTAAATCCAGACTCTGC
CACTTGTCAGCTGTGTGACTTTGGGCAAGTCACTTCTTTGTGCCTCAGTTCCCTCATCTG
CAAAATGGGGATTAAGACCCTGAGCATCACGTGGGACAACGTGATTACCCTGTATCTACC
CCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAACACCAACATTATTAT
TATTACTTTTTATCCTTATGCATTCATCTCTTTAAATATTCTCTCCTTCTGGGTATTTGT
CTTCATGTGGTGGAAATCTGTTAGGGCCCATAGTTTACTCTTGATAAGAACTTTCAATTT
TATTTCATTTTATTCTTAGGAATCTCTTTTTACTCTCAGTAATACCTGGCATACTTGGCA
GACCTTTCCTAAAGTAAGACTGGATTAAGAGCAGGTTCTCAAATCAAATACTTTTGAACC
TGCGGTGTAGCCATCTGGTGGTCTAGGTAATTTAATAAAAAAGCAAAAGCAACAATACAA
GGCACTTGCAAGCACAGGTCAGAACTCAGGTTTCTAATCCGGAGATATCCGTTGGGCTCA
GTCTTTTTGTGGGCTTCTCTTGAATTGATCAACCAATGACTGACAGGTGTGTCATTGGAT
AGCTTCTTATCCATTCTCTTCTCCCTCAAAATCACACTATAAACTTTGTGGGTTTGTCCG
TAGGAAAGCTTCATTGTTAATTACTATGGAATGCTACAGATTTTACCCATATATCTGAAA
AATTGATTCCCTTTTTTTTGGAGCTCCAAGTTGAAGGTAGAAAAGCGAGGATGCTTGGTA
ATCAAATGTACTAAACTCCTAGCTTATTGATGTTCTTATGGGATGGTCATCTTTGTCCCA
AGGAAGTCTTATGGAAATTCAGGGAACGGACGCAGGCTTTGGAAATAATAAAAATAATTG
ATTTTAATATCTAGGAAACAACCCGTTGCTACTCTTTTAAGGGTGATATATTAATCCTCC
TTTGTCCAGTCATCCCATGAGCCCTTCGTTCTTCTTTTAAAGGTCAAATTTTTCATAATG
AAGATAAATTCTCATACTGGAAAATATAAGAGCAACATTGATATAAAATTGAAACCAAGC
CCCAAGAGGATCTTTATATCTCTAAGTTATCTCTGACATTGCCTTTTCAGCTTCCTACAG
TAAACCTCTATCAGGTAGTTTTGAAGTCCGTCAGCCTTGAATCTTCAGTCATCAAAACTA
TGTCAATTTTAGCTCTTTCTTGGCTGTTTCCCAAACGGACATTCATGAGACTCGTAGGTA
AACTTCAGGAGTTTCATCTTATAGGACACTTTTATACACACTCAGTTCTGCTAAAATGTG
TGTCTCAGCTGTACATTTTGACTAAATGTTGAGTAGGGATTTGGTGGGGGAGTGGTCATT
TACCTGAAAGCGTGAGCCTGTTTTGATACAGTGCGCCATGGTGTCAGAAGAAATGGTGGT
ACATTTATGTGGCGTCTGGTCTTATGAGTACTACAACACCAGTTTTCTGTGTCATTCATG
AGAATGCAGCCCCAGCCTTCTAAGAGACTTGCGTGTATGTGTGCATGTTTGTGTGTATAA
AAGGTGAAGTACAGTATTTGCAATATACAAAAGTTTCTCCGTATGACACGCACCCCTGGA
TGCAGCCTCATCAGCAACATCTTGGAATTGAAGGGAAGATGTGTCTCCCCTTGATCCATG
TGCACATTTGAGGGAGTCGCTTAATGACGAATGTACACTTCCCATTACCTCTATCAGAGA
AGTGTTGTGAACGTAGCTGCTGTTCCCTTCAGTCTCTGAGAGACTGTTTTAATATGCACA
GACCTGATAGGAAAAGAGCCTCTGATTGAGATTTTATAGCAAGTGGGTGAGATTCTGTTC
ACATTCCAGATGAGCAAAGAAAGATCTTGTGGTCGTGTAATTCTTGCCATACCTAGTTTG
CCTTTTGTTCCCTTTTCACAGATAAACCTTTGGGAATCTGAATAGTTACCACTATTGCGT
GTTTATAAGGAAAAGGTGTAAAGGGGCAGTTGTGAATTTATAGTGATCATTTTGTATCTT
CTCAGAGGTTTGGCATTTCCCTCTTAAGTGATATTTTTGGATAAAAAAGTTATGACATCT
AAGGAAAATGAGTATTTCCTGTTGCCTTGAGGATTTGAAATAATCAGTCTTATTTATTGA
GCACTTACTGTGTGCAGAGCACTGTCTTAAGCGCTTGGGAAAGTACAATACAACAATAAA
CCCATTCTGCCTATAGGAATCTGCTTCTCCCTAACTCCTTGCCTTACCTCCTCCCACTCC
TTCCCTAACGAACATTTACTTATGACTGAGGAAACGGTGAACACTAAAATTTTCCTATCC
GAGAACGTCTCTTTGTACTAGTTACATTTTCTCTGTTAGAGGCATAGCAGATACAAGTAC
AGTAAGCAAAATCCTCAAACCGTATTTGTGGCTTGTACTAAATCGGTTCTAACGGGATCT
AGGTTTCCGAATGAAAATTGGTCCGCCTCCATTCCTGGTTGCAAACAAGGAGTTCTGTGT
CTTGCGGGTGGGGGACCGCAACTTGCATTCTCCCCGTCCCTACTTCCGAGAGCTAGAATG
CGGAGTAGTAAGAGTAACACTTAACGAATGTGTGTTGAACTGAGCTAAACGCTGGGGAAG
TACAGAATACTGAAGCGATGCATTCCCTTGCCTCATAAGGAGCTTACGCTGTAATGGGAG
ATTAAAATATCTACCGAATTGTAAAAATATGTAATTGGAGTGAAAATACACATCCGAGGG
TGTAACGAGTTCATAAGTGCCAAAGTACCATTAAAAAAACCCTTGAGATTCTCAGTTTTC
AAACCGGGACCCGTCGCCTTAATTTCGTTCCGCATTTGCCACCGTAGTCCTGTTTCATTC
CGCGTTCTGGTCGGACCTAAAAGTCCCACCTCCCATTTTGACCCATTTCCTCTCTGTCCT
CAGGAGTGTTTCTCAAGAGCTTTCGGAGACTATCCTCACTATGGTGGCCAACTGCAGCAA
TGTTATGAACAAGGCTAGACAGCCACCCCCCGGAGTCATGCCAAAAGGACGCCCTCCCAG
TGCAAGCAGCTTAGACGCCATTTCTCCCGTACAGGTAGATAAAACCGTGCGAACTACCGT
CGTTAGAGAGGTACTACTGTTGCCATGTCTAGCGTAGGATGGATTCTTACAGTATGTCTG
TCCTGAGCAAAACGGGAAAAATGGACTCAAATTTGATATAATTGCATGTTTAGAGAACTT
GTTTAAGTTAAAATAGATGGTACAGGGGGCATAATTCAGAATTGGCTTTAATCTTTGCTA
TAATATCATAGTTTTGAGAAGAAAAATACAAAACGACTATTTTTTAGATAATGCTAAGGT
TGTTTTTGTTTTTTGTTTTTTGTTGTTTTTTTTTTTCTTAATGATGAAAAAATTACTTAG
ACTTTTGAGGAATAAGCACTGCCTTTGAACCTGATATGTCTTGTTTGTAGCTTCACGGGC
CAAGCAACAGTGCTAGAGCATAAGGACTTGTTATAACTGGGGCTCTTCAGCTCTCAACTG
AACTGCTCTTTTAAAAACAAGGTACATTTAAGTTACTCCCTGCCACTCACCACCCCTCTT
CTCCTCTGGGAGTAGCATACTCAGCTTCTCCTACTTTCAGCTACCTTGAATGGCAGACTG
GGGTTTTAGGAAATGAATCATATTTATTTGAATTAGTGACACATCAACACCTACAAAGCC
CCAGATTCAAAATGGTTCTCGATCTCATCAGTATGCCGCAGTCTGGAAGGTGCAGAACAG
AGTTGGACGATTACTCCTTAGATAATTCAAATACGAAAACGCCCTCGGTGAATAGTACGT
TCTGCTTTAATGGCCGTCAGAGCTGCCCAATCATCCACAAATCTCGAGTAGATTATCGAT
CAGTCTGGATGGACGATTCTCGTGTGACTCTGCTTCCATTTCCCAGTGTCAGGATGTTTA
GCTTATCCTAAGCTGTGTAATGGATTTTGTGACCCTTCGTGCTAAGAGGTCAAAAGATGG
CTATTGAAGGGATTTGGTCATGTTAAAGGAGGAACAAGAACTCCTATACTAGATCGCTAA
GTGTTAGGTATGATGTTGCATGGTAGTAACAAGGTGAAAGTCTTCTATGAAAAACAGATT
TCATTTTTTCAGTTCTGGAGTTTTAGCCTGTTGACTGTAAATATAGCAGCCCTCTTAGAA
TGTGATCATCTGTGCTAAGAGGAATGAGGAGCAGACTATTTAGACTCTAGTAGCCATAAA
AGCATGTGGCTTTTTATTTTGGATTGGGGGAGAGATCTTTGTAAAATGTCAATTTGTTGC
CAACTTAAGTTTTTTGTTTTTTGTTTTTTTGTTTTGGTTTTTTTAATTCATGTGGTAATG
CCATTTAAATATGTCTTTATTTCTTTGGTTGGTATACATGGTAATATTGGTTTATAATGT
CTCTCTCTTTAGATTGACTCTCTTGGTGGGATGGCATCTCTTAGTATAGGTGGTTCAGCT
GCCCCCCACACCCAGAGTATGCAGGGTTTTCCTCCAAATTTGGGTTCTGCCTTCAGTACC
CCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAGACCACAGCTTTC
AGCGGTATCGGAGGGCTCTCTTCACAACTTCCAGGTAAGAAAACACTTGAGAAATATTAC
TTTTTTTTTTTCTTTTGTCGTGGGGAGGGTGGGCTGCACAGCAGGGATTGGAAGTTTATT
AATGGAAATTAGAAGCGGAGAGAGGTCTCTGGCAGGTTTCCTTTGGGTCAGATAATCCTG
CCGTAATGTAAAATTTCTATTTGAAATGCACGGTCTTTGCTAGGGGTCCCTCCCCTTGCC
CCTGCCTCTGAACTCACTGCTCACTGTGTCCGTGCTTCCGCCGGACCAGCCAGCTCTGCT
CCCTCTGTAGCTGAACTCCCTTCCACTCTTCTAGTAATAATAATAATAATAATTATGATG
GCATTCATTGAGCACTTACTCGGTGCAAAGCACTGTTCTAAGTGCTGGGGTGGATACAAG
GTGATCGGATTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTTGACAGATGAGGTGA
CTGAGGCATAGAGGAGTTAAATGACTTGCCCCAAGTCACACGGCGGAGTTGGGATTAGAA
CCCACGACCTCTGACTCCCACGCCCGGGCTCTTTCCACTGAGCCACGCTGCTTCTCTCGG
GCCAGACCCTCAAGTCCCAACCCTTCTGCCCCTCCAACTCCTTCCACCACTGCCGCCCTT
CTTGGTCTTCCCCGTCGTCCTTTTCCACTCCCTTTACCCCAGCGCCTGCTTCAGGCTCTT
CTGAGGTTCAGCCCTCCGGCATTAGGCCCAGGAGATGTCCTCTAAGCAATCAGAACACCT
GGTGGGGGCCCCCCAAAAGACCGCCTCTTGTGACCTAGTCGGAACTTGTGAAATGTACAT
AAGGTTTGAGTGGGTGTCCCTGAATGAAGACCGCCTCAAAAGATTAAAAGCCAACACATT
TGCCACCAGACTCCTACAGTGGGCCCACAAGGGATCTGGCATATCCACTTAAAAATGTGC
TGTCAGAAACCATCCAGTCAACCCCACGGATTTTCATCGAGTAGTCCTAAGTGTGTATTC
AGGTGCGAAAAGGAATGTAACTTGGGGGTGTTTTAGACGTTTTCCGATTTCAGAGTAATC
GTGTCGAAATGGTGAGCGGCGAGCCGAGGCAGCGTTCACGTCGTAGGAACGTGACCGCTC
TAAGCCGCCGAGCCTTGGCGCACCAGTGGTATGAATGTAATGGGTCTGCCGGTTACCTTC
CTTTCGTTTAGTAGGTGGTCTCGGTACAGGCAGCCTGACCGGTATAGGAACTGCCGCTCT
TGGGCTCCCCGCAGTGAATAATGATCCGTTTGTGCAGAGGAAACTGGGCACATCTGGACT
GAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTGTAAGTGGTAGTGTTGTCTGTG
ATTGTGAAGTGTGACTGCTCATAGTCGATTGGCTTTCGGGGGCTGCCGGAGAGAAATAGA
GAAACCTGGTGCCAAGAAAGTGGGAGGTCCCAAATGCGTCTGGCCTTGATCATTTTCTGT
AGGGGGTGGTGTGCGAGTGGGGAGGGGGGATGGGGTGGCGGGGGGGGGGGGTAGGGCGGA
GTCTGTGTCTCGGAAGGGGTTAGGATCGGTTAATGTTTCCCCACTCATCCTTTTGGAGTA
GAATACTGGTTCTTGGTTTATGTAGGACTTAATTGGATCGCATGTTAATTTTGCCCTGGA
ACTGTTCCCTTCCCAGTCATTAAGAAAGAGCAGGTTAAGACTTTCCAGGCAGGGTAGTTG
ATGTGATCCATCTTAAAGATAAAGTATGCCGTGAATAAGACTTTTGTAAGTGGAAACCAC
TTGAAGAGATGTGTGTAAAAGTCTTCCCGACCTAGTTGTAGTTACTCTTTCTGGCTAATT
TTGTTATCTAGTAGTTGTAATATTTAAATGCCCTCTGTGTGCAGAGCACTGTATCAAACA
GCGGGAAAAAATGCAGAGGTGAGAATTAGACACAGTTCCTGGCTCCGAGGGGGTCAGTGG
CAGACACGTAAGGAGAGGCGCAACAACAGAGGTACGGAAGCAACAGGGAAGCGATAAAAA
AAAAAAATTGGTTTAGAGCAGTCGAGTGCTGTAGCTAAGAGAGCAGAGTTCCCGGCTTCT
GTCTTACGATAATGTGTAAGAGAGCTGGACCAAGGTCCTTGGGACTTTCAGGTGGAAACC
AGACAATAGTTAATTAGTGAGTGTTTTTTGTTTAATCGGACAGTTTGCTTCCTGGAAGCC
TCATAAAAAGAAGTGCTTCCACAAATGATAGAATAAGCCTTTAGAACTTGCTGATGTTAC
GTGGGTGACCTTTCTGATATTTGGGCTGTGCATCGTTTCACCTGGTTCAGAAGTGCATCA
GCTGTCCTGAAAGTACTAGTGTGAAAGAATTGTCTGCATGTTAAATGTTGTGTAGCATGC
CTGTGTTTTTATTCCTTGTGTTGCACATTCAGGGCATTAGCTTCAGTGAGCAAGCTAAAT
TAAATCCCCATTTTACAGTGCCCTTGATTCCACCAAACGCATAGCACAAGTTTAGCTTTT
TTTGAGGATGAGCATCTTACAGTCTGAACTGAGCTAACTGTTGTGGAGTTTTAGGTTTTT
AAAAGGCCTACCTATAAGGGACTGAATGTTCACCAGATTGTGTCCTTTCAGACCTTTTCT
AGAATATGTAGAGTATGGTGTCAGTGTGTCTGTGCCACACACGTTAACGAAATAGGTACA
TACTGGGGCGGCCTAGTGTCCTTATTGTTTTTGGCTCTTGACTCAAGATTTTGTCAGTTA
GGAGGAGTTGGGTTTTGGGGGATCCATATGCTTATCAGTTACTTCTTTTTTTTCCTTTTT
CTTTCCCCCTCAACAGCGGACTTGTCTCAGGTGTGGCCAGAGGCAAATCAGCACTTTAGC
AAAGAGATAGATGATGAAGCAAACAGCTATTTTCAGCGTATTTATAACCATCCACCACAC
CCAACCATGTCTGTTGATGAGGTGAGTGTGATTTAGCTCTGAAGATTAATTTGTGTAGAA
AAATATATTTATCAAATAACGAACCCCTTGCCAATAGTCTTCAAAACCACACTCTCCCCC
CTCCCTCCCAAAAAGTTTATAATATGTAACGAAAATATTCATAAGGCTTTCATTTCTCCA
TCCATAGAGCTTTGCTTTCTTCCTGGATGATGCGACCCCAAGATTTAACGTACCCTCCCC
ACCCCACCTTCCCTCTTTCTTCATAGCCATCAAAAGGAAAATTCACGCTTTAATGTTCAG
GGCAACAAAATCGTCTTGCCTTCCCTGTTGCCATTTGCCTTGCCTGGTCTTCAAAGTTTA
AAGTAGAATTAACTCTCCAAGACAGAATATCATCCACAGAGAGCCTCTTCTAGCATTAAC
CCAAATACCCTCGTTGTTTTGCACTGCTCCTCTTCCTCCCTTGATAAGTAATGTAGTTAT
GCAGTTCTGTAGGATGAGCCTCCAAGAATTTCTCCTAGATCTTAGCGAGACATTCTGGAA
AAAGTTGTCCAAGAAAAATGCATAAATGCAACATTAAATGGTATCAAACATTTTAAGGGC
ATAGGTGTCACAATCTTAATTATAGTACAAACTATGAAAAGGAATTTATGCAAACCAGTC
CCAGGTGGGCTCATGGGGTTACTTTGCATTAAGCTTCCCAGAGCAGTTTCTCCTTTTTCC
CAGCGGACCTGGGTGGCAGCGGGAGGAGGGGAAGCTCCACAGGCTTTCCCGGGCCTTGGC
AGTCCGCAGCGCTCCCTTGCCGAGGGAGCAGCCGAGGTCGGATGCCACAGGCTTATTTTA
CTTTCAAAACGTTGCTAAGTGAAACTTTAACAGTAATACAGAAGTTTAGGGAAATAATGA
TATTGAAAGAGGAGAAAACCGCTTTTGTTCATTGGAAACTTGCTTCCAGGTGGTTTGAAT
ACAAATAACCAGAGTTGCTTAAAGGTCTTATGGAATTATGGAATGTTGGGAGTCTTGGCT
GGGGTAAGATGTGGAACAAGCGTGGATTTAGAGGTAGTGAGACAAAGCCCCACTATCCAT
TTAATCTTAATGTATCCATTCATTCATTCAGTCGTATTTATTGAGCATCCAATACAGCGT
CCAATTTATGTCCCCCCTTGTAGACTATAAACTTCTTGTGGGCAGGAACCGCACCTACTG
ACTGTTGTGTTCTACTTTTTCAGTATTCTTAATACAATGCTGTGCACATAGTAAGCACTC
AAAGTCCATTGTTGATTAGCGCTAAACAAAGGCTATCTTGAAGGTGAAGCAGGAGGCCCA
TTGAGAGATTTGACCCGTTAGAAGGGAAGGATTTCGCTCTTTGGGCTTTTCTGTAACTCC
TTTTGCAGTCTCTCTCACTCCCCTAAGATAGCTTAATCACACTTTCTCATCCCCCCCGGG
TTAGTTGCAGATCAGTTAACTTGGAAGCACAGTAGAAGGAAGCTTTCCCACCCCAAAAAA
TGTTACTTACTAAAAGGCAATTGATGCAGGAGCGTTTTATGAGTTTTAGAATAAAAAAGA
CTTTGGTATTGAATGAGCTGAGTTTTTTCTAATATTTTAAGTCTTTTACATTTGTTGGAT
GTGGGTAACATCTACTAGCAGACCCGTACCTATCTCTGTGTTTATCTTAAGGGATTAATT
ATATCATTTTGAGGTATTTAAAGCTTTCCCTTCAAGTCTGGATAATGACCAGTTAGTAGC
TGGTGTTCCCATAAGGGCTAGGTGAGTTGAGTAAGACTTTCGGTAACGGTTTCTGCTTCC
TTTTCAGGTTTTAGAAATGCTACAGAGGTTTAAAGACTCCAACATAAAACGGGAACGAGA
AGTGTTTAACTGTATGTTGAGGAACTTGTTTGAAGAGTATCGGTTTTTCCCCCAGTACCC
AGATAAAGAGCTGCATATAACAGCCTGCCTCTTTGGTGGGATAATAGAAAAAGGACTGGT
CACTTACATGGCTCTGGGTCTTGCCCTGCGCTATGTTCTTGAAGCCTTACGCAAGCCGTT
TGCATCCAAAATGTATTATTTTGGAATCGCTGCACTAGATAGGTTTAAAAATAGGTGAGT
ATGCTTTCATATGTATGTCTAATCTTTGAAATATAAGCAATGCTACTGTTCTGTTCAGTT
TTGTCACTTCACCTCATCTGCCTATCCCCATATAGATGGACTTGGTTTTTTGTAATAATA
GTAATAAAAGTGCTCACCATGTCCCAACCACTGTACTAAGTGCTGGGGTAGATTGAAGAT
AATCATGTTGGATACAGTCCCAGTCTCACATGGGGCTTGCAGTCTATAAGTAGGAGGGAG
AAGAGGAACTTAATCCCCATTTTACAGATGAGGAAACAGGCACAGAGAAATTTGGACTTG
CCCAGTGTCACATAGCAGGAAAGTAGCAGAGCTGGCATTAGAACTCAGGTTGTCTGACTT
CCTGGCCTGGGCACTAGTCACCAGATTTATTTTTTTCCTTTTTTTTTAATGGCCCGTGTA
ATGTCAGGGTGATAGCAATTTTAAAATCTTAAAATACTATTCCTTCGTATAGATGCTGCC
TTAAAATATAATCACATTGAAGATTTGAAATTCTTTATTTGAGCAGCTTGTTGGCTAGAG
CAGGTTAAAAATACTCAATCTAAATCTGCCTTTTCAACACAGAGATGTTTGCTCCAAAAT
TCTCAAATGGTAAAAATGCAGTTAGCATTAGCAACCCTTTCCCCCACTAGCATGTCGCCT
CTAAGTATTAGCTTTCCTCCTCTGTTTAACTGTGGCGTGCCTATGTATATTAACACAGAT
CTTAAACCCAATAAGCCAAGCAAAGCTCCTCTCAAGTGATGGTGGGAAAGGAGCAGGGGA
GAGTCTAAATGGAAGGAGGTGGCCAGAGAATTGGCCAACTGGAGTTTGGCAGAGAGAGGG
GCAAGGCTGAGTGATCTAGCCCTCTACCCGACCCACTCATCTGACCCTCCCAAAATTCCC
CCAATACCCACTCTCCTGGTCTTTGAACTGCTGTCTAGAAGAAGAGGCATAGGAATTCCT
GTTCCCCGGCAACATTCCAGCTGCACGCATGAAGCACACCAATTTTTGGTAGAGCTGCTC
ATAAGCTATCATACCCAGCCAAACATCTTTTCCTTTAATACTAAACTGGGGAAAGAAAAT
AGTATTCCTGACGCTGAAAGAACTAAAAATAGCTCAATATATGTATTTTTTTCGACTACG
TACATAATAAGACCATCTCAAACTATGCCAGAAGTTTAATACTCTGGAAACAGCTTTTAA
AATCTGTACCTTTTCCTTCTCAAATATTCGAGAGCTTGGAAGGGTGCTTTACTGGCTGGC
TGTGTTTTGGTTTTGATATTTTTTTAAAATGTTACTGACAGATTTATGCTTGTGTGAGTG
GAAAGACCGATGTCACAACGGATTCTTTCTTACAGTGTACATACAGAGAATGCCTTTTAC
TCAGCTGTTTGCCTCTTTCCTCGGTTGCTGTAGTTCCTTTATTCTTGTAGCCTTTATATT
ATTGGGTAGTTTCCATTTATCGTTGACTGTCGTCCAAAGTCAGTAGCCCTCTGCTGAGTG
TCTAGTATAGTTGAGGCCTGCAGTTTTTAAGGGTGGAATTTCTCTTCCTCTTCCCCATTT
GAATCGAGCTGAGATACCTTAGGGTGTTTACCCAAGAGTGCTACTAGTCATTCAGCAGGC
CGTGATCAATAGTTTGTCGCCAGAAAGAAATCTGGCTTGAAATCTCAACAAAGCCAACCC
TGCCTACCCTAGTCTATTCTGGCCCTAGTAAATGCTTGTGCAGCATTTAAGTAAAGTGGC
GACTGTTAGGAATTATGAACCTCTCTTCCCAAGGTATTTGTTTACTCTGTCATAACAAAT
TAAGCTTTAAGTCCCCCAAAGCAGAGCAACTGCAGGGTGTGCTCAGTGTAAGCAGCTATG
CACTAGGCAGTTCTCTGTCAGGATGAGTTTCTCCCAAAGTGCCTAATTGATTACCAGGGA
ATAATGTTTTGTCCCGGGAGAATTGGACTCAATATATTTAATTATGTGCTATAGGAAGCA
ACTTAATTCTGGTGTGTACTTTCTCGGTTTGGCATAGTGTTCCATCAATATCTCATGCGG
TCAGTAAGTGCAGATTTGATGTGGGAAAGGGGAAAAGGTGCCTGTTAAAGTTTGCTCTGT
CCTTTTTCTCTTGACAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATT
AGTCACTTTATACAGTTTCCTCATCATCTACAGGAGGTACGTCCTTGCTTAGGAGAGCTC
ACTTAATTGAGCTCTCAAACCAGTGCCATTTAATCTTTAGATCCCTCTGATGTAATTTTT
TCTTTTTTGTGTTAGAAGATGGTAATGCTAGTTATCTGCTTTCCATGGTGTCTTTGATTT
CAATGAAGTTATGAGGTCTTCAAGAATTAATAATAATAATGTTGGTATTTGTTAAGTGCT
TATTATGTGCTGGGGAGATAGAAGGTGATCAGGTTGTCCCTCATGGGGCTCACAGTTTTC
ATCCCCATTTTACAGTTGAGGTAACTGAGGCCCAGAGAAGTTAAGTGACTTGGCAACAGT
CACACAGCTGACAAGTGGCAGAGCCTGAATTAGTACCCACGACCTCTGACTCCCAAGCCG
ATGCTCTTTCCACTGAGCCACGCTGCTTCTCTGTACTGTTCTGGAGATAGGGATATCCAC
ATATCTCTTGTCCAGTGCCCAGTATCTCTTTTTTAAGGGCAAATGAAGCCATGTCAAATT
ATTTTCAGGTTTATTTGGCGGTTCCCTCTTGGCCAAGTGTTGCCGTTGTGGAGTGGGTAA
ATCCTGTATTCATTCATTCATTCAGTAGTATTTATTGAGCGCTTAGTATCTGCAGAGCAC
TGTGCTAAGCGCTTGGAATGTACAACTCGGCACTGATCAAGGGGAAAAACAGCCCTTTTC
TCCAAACCCCTGGGGGCCACCATTTTATACCTCTCGGAACCCCAGAGCAGAGATTTTGCT
TCCATCTAGGAATCCCATATTCTCTGCCTCGGTAGGAGTTAGATTTAAGCGGAGAATACG
TTCCTGGGAGGTCAGAGTAGTCGTGGCTTCTCGTAACCCAAGTGTTAGGGGTTGCCTTTC
TGACATTGCGGGAGCTCTTGGAAAGGGCCAGTCGGCAACTACTACCCTTCCCACCTGTTG
CCGATCCCAAATGGGGTCCCAAGTGGCTGTCGCCGCTGTTGTTCGGGCACTGCGGTGGGG
AAGTTCCCACCATCAAATTCAAGAGACATTCCTCAGAGGGCTTGACAGCTCAAGACAGCT
TTCCCCGCACCCACTCGCAGGAGAAAGAGCCCTCCATAACTTCAATTCCTGTGGTTGTGA
CTGAATTAAGTCCCCCAGTTTGCAAAAGAGGTGGAATTCACAAAGTCTGCCTCACATCTG
ACACACCCAGATGCAGACTCCCCAGCAGCCTCCTTTATTGAGTTACTCTTAAATGCTTGG
GACACACCAAAGCAGGAAGAATCATCGTCAGTTAGGTTTGTTTTGGGAGCGGGAGAAGCA
CACTGTTATAATTTAGTAACGATAAAGAAAATGTTTTAGGTCATCGCGAGCAGGGGCTCA
TTCCCAAAAACAATAAAGAAACTGATGGAGTATCCAAAACAAGCCACCACTGATAATAGT
GGAATTTAAATGCTTGTGTATTAGAATAGCTAAACAGTGATCCCACATGAGGCTCACAGT
CAAAAGTGTGTGTGTGGGGGGAGGTGTAGGTATTCATTCATTCAATAGTATTTATTGAGC
GCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGTACAAATCGGTAACAGTCCC
TGCCCTTTGACGGGCTTACAGTCTAATCAGGGGAGACGGACAGACAAGGACAATAGCAGT
AAATAGAATCAAGGGGATATAAATAGAATCAAGGGGATATAAATAGAATCAAAGGGATGA
TTGAATCCCAACTATACAGATGAGAAAAGTGAGGCCCAGAGAAATGGTGTCTGGCCCAAG
GTCACACAGCAGTCAAGTGACACCGGGCCACGCTGCAATTATTCATCCAGCTGTCACCTG
AAAACCAAGCAGAACCGTGTTGGTGTTGTGCTTTCTATCGCAAAGAGGGTCCTTTAAATG
CAGCAGTCCTCTGAATCTGCAACTGGTACCAATATGTCTGTTTGACCGTCAGTCTTTGTC
TACTCTTCTCTCTCCTAGTACATTGAATACGGACAGCAATCTAGAGACCCTCCTGTAAAA
ATGCAGGGTTCCATCACCACCCCTGGAAGTATTGCACTTGCCCAGGCTCAGGCCCAGGCC
CAGGTTCCAGCAAAAGCTCCTCTTGCTGGTCAAGTCAGCACTATAGTAACCACCTCTACC
ACCACCACTGCTAAAACCATCACGATCACCCGACCAACAGGAGTCAGCTTCAAAAAGGAT
GTGCCAGTGAGTTGTTTATTTCATTTTTTTTTCTTGATGGTTATAGCCTTACCGTTTCTC
TTAGGAACCCTAAAATATCCACTTGCAGTAATTAGCAGATGCCTGAAGGGGAGCATAGAA
ATTATGCTAACTTGTTCTCTTTTTCCTAGCCTTCTATTAATACTACCAACATAGATACAC
TGCTAGTGGCGACCGATCAAACTGAGAGAATTGTGGAACCACCAGAAAATGTGCAAGAGA
AAATTGCTTTCATCTTCAACAATCTCTCTCAATCAAACATGACACAGAAGGCAAGTATGC
TGTGATGACTCCCTTGAAAAATGACTCTCTTTTTCATTAGAGGGGGAAATCTTAATTAAT
GAGGATTTAATGGTTTAAATTGAATGGTTTTAACGGTTGTTTGCTCAAAGCAGAACTATC
AGATATGAAGTGAAACAATAATTGAGGGCACGGTTTTATATATGTGAGACATAAATCAGT
CAGTGGTATCGAGTGTTTACTGTGTGCAGAGCACTGTACTAAGCATTTGGGTGAGTACAA
TACAGCAGTTGGTAGACACATTCCCTGAATACAAGGAGCTTATGCTCTTGAGTATATAAA
GTGCTTGATAGAGTGGAAACTATTGTAGGGAGTCAAGTGGGAATCTGGCGGGGTGTATTC
AACATGTTGAGTTTCTACAGGAATGGGAGCGGGGCATGGAGCCATTTTCTGGATCCTACT
GCAGCCACCAACCAAGGGTTTTTCAGTATAATAGAAATGTGGGTATATTTGAAGGCAGAA
GGAAAACAGAGGCTGAAGATGGCAGGTGTGAAGGGAAGGATAAATGGAGCAAGTGGTTTA
GAAGTGGAGAATGGTTCGCAGAGGCATAGATAATGGGGAGAATTTGGGAAGCAGACATGA
AACCTCTTGCTAGGTGGCTGGGATGGGTGAGACTAGGTCTGTGTAAGTAGAATGGAGTTG
GGGAGATGAAGAGGGACTTTGGGGAATTCATGTCTGGTTTCAGTTTTCCCAGTAGTTGGT
AGGTTGCCAGAAGCAAGAGGGAAGATGAGGGCTCTGAAAAGGAGCTAAATGTCTGAAGTA
TTTGATGGGAGCAGTGGGCATGGTGAGGGAGGAAAAGTAATGTTACTGAGCAAAAGAAAG
AGCAGAGTAGAAGGAGGTGAGGCTGAATTTGGAGTGGCAGAAGTTTATGTGAATTTCCTC
CAGTAGTGCCCTACAGCACAAGTAGAGGAAACAATCCTTGGAGGCGATTCAGGGCTGGGA
ATCGGTGTGCCAAGAATGAATAGAATTGATTTACTGTAGTGGTTGATTAGTAATAATATC
AAAACCTGGGTTGAATTGTGGAAATGCCACAGAGGGTAAGAAAATGTTACTTGGAGCATG
TTATTTTCAGTTCCACTCTCGGGTCACTATCCCCATTCTGGTTTTAGTTCGGAAAGAGAT
CCAATGCCCAAGTCCCCAAGAATGGTATGTGCATACCCACTCTGCTGATATGTAATGCAA
CATTGATTTGTGTAAACAGATTATAGGAGTACCCCCTACCCTCTTCCTTTCTTGGGTAGG
CATGCTATATCATCATTCACTCTCAACTACTTGAGGCAGCTTGGGATGGGGAGGTGGGTG
GGGCTAAGATTATCTAGGGAAATTTTTAGCATAGTAGTCCACTGACTCACATAACACAAC
TAGAGACACAGTGCATTCTGTTTTAGTAGTGAAGTTAAATCTGAAACGAGTAATACTGAG
CTGAGTGAAACTTGACGTTGATGGTCCCGAATGCATTAAATGTATTAAATTTGTAACCAC
ACTCACGTTATAATTCGCTTTTCTTTTTTGCTTGGGTCGACTAGGTTGAGGAGCTGAAAG
AAACGGTAAAAGAGGAATTTATGCCTTGGGTTTCACAATACCTGGTAATGAAGAGAGTCA
GTATTGAGCCAAACTTCCACAGCTTGTATTCAAATTTCCTCGATACTCTTAAGAACCCTG
AATTTAACAAGATGGTTCTGAATGAAACCTACAGAAACATCAAAGTGAGTAGCAAGTCTT
TCAAAGTTCATTCGAGTCACTGTCCACTTGACACCACACTTCGAAGTGAAGTTTTATAGT
GTTACCACGGTTAGCGCTAAGAGTTTTGTGTTTATGGAAAATGGGCTGCGTAAGTTGCCG
CTGAAGCGCTCAAGAACCTAACAGATAACCTCTTGATGTTTTCATCGGATTAAAAAAAGT
ATAATGCCGAATGTAAATTATTCTGTGGCTTTCTCATAGCCCACCGCGGTCCTTTTAGTT
CTTCCCCTTATTATTGGAGATATTAATCCTGCGTGTCCAACAACCTAGCATTTAACTTTG
GGAAGAATAACTGAGAGCACATATCTTAAGGGAACTCGTACAGGTAAAATAGAAGATCCA
GTAAGAGTATATTTTTAGTTGTTGGAAAATCTATACCAAACCCATCAATGAACTTTCAAG
ATCTATTGATATGACTGTACCTTTACCTCATTTAATTAATTTTGAAGAGTATTTTTGTAT
TGGAATGAATACTGTGTCAAAAACCATGATGCTTGGAAAGGCAGAGGTCTGTCTGGAAAG
TACAAGGTGGGGCGGTCGCTCTTTAGAAGCACTATTTTTAAACCTATTGATGGAAAACCT
CACCATCCTAGGTTACGCTATGGTGCAAAATAATTTCTTGGCTCTCCTAGCACAGCTGAC
TGTTCCTTTATACTGATGCTGTGGTGGAGTTAAAGAAACATTACTGCGCGCAGAAGGTCT
CCGAGATGTGTGTGTGAATGGGTGAAAGGCCTTCAGAGATCACTTGGTGATGTTGTCAAC
TTACTCATTTTGCACATGACTTAGTGGGCTGTTCCAGGAGACTGGTCCAAGCACAAATGC
TTTCTCTAGCAGTGCAGGGGGGCCTTATGGGAAGAGTAGGGGCCTGGGAGTCAGAGGTCC
TATGATTTAAATCCAGCTACTCTATTTGCTTTGCTGTGTGACCATGTATGGCAAGTCACT
TCTCTCTGGCTCAGTTTTCTCAACTGTAGAATAGGGATTCTCCCTATTCTGCTCCTTCGT
GGATGGTGAGCCCCAGTCTGACGTGATTAACTTGTATCTACCCCAGCGCTTAGAACAGTG
CTTGACACGTAGGAAGTGCTAAACAAATACAGTTTTTTTTAAATGGCCTTTTGGGGGCCC
TTCAAGTAGATTTGAAATTCGTTGCAGCAAAACTTTCAATTCCTTCCTTAAAAGGAAGGT
AGAAGCTTGGTTTTCCTTTCAAGTACTAGGTGGTAGAAGATGATCAGAAATGAAGTAGAC
ACACTGGGGTGGGAGAGGACAATAGGTGTCAAAAGTAAAGTCTGGAGTAGTTTTATGTAC
GAGGTGTCTCCATCTTCAAAGATTTCACACGTGACCTCTTTATTTTAGGTGCTACTGACA
TCAGATAAAGCTGCAGCCAATTTTTCAGACCGTTCCCTACTGAAGAACCTGGGCCACTGG
CTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTGCACACTGTGAGTTTCAGTTTT
TAAATGGCAAAATGAAAAGTTAATGTTGCTAGGTGCTGTATAGTCTTATCGCCAAATGTC
CCAGCCTTTCTTTCAGCCGTTTTTAGGTCTAAGATTGAAGTCACCAGGTAACAGTGGTGA
TCCTCTGAGTTTGTAATGTAGCCACCTAGAATGAAGTTTCTAAATGGAATTTACCTGTGT
ATTATAGGACTGGGGTGTAAAAGCCTTTGCTGCTCGGGACTTTTGAGTGTATTTTCATGT
TTTTTTTTTTTACCAGTATACAAGCGTCTTTTCAGTAGCTTCTAAACGATAATTTACCTG
TGTGTTTTAGGACTTGGATGTAAAATCTTTGCTGCTCGAAGCTTACGTTAAAGGACAACA
AGAATTGCTTTATGTGGTGCCCTTTGTTGCCAAAGTACTGGAATCCAGTGTTCGAAGTGT
GGTAAGGTTTCAGACCATTAAATGCGCAACTGTCTCATATTATTAAAGCCTTTAGTGCTA
TATGGTTCAAAGCCCGAAAATGCTGTAGAGTTGCTTTGAGTCTTGCTGCTTTGAAATGCC
TGGGTGGGAGAACAGATTTTGCATGGGGGCTAGTGTTGCAAAAGTTGGGATCTTCAGACT
TCCCTAAATAAAACAAAAATCAAATTATTCTGTAGGTGTTCAGGCCACCAAACCCCTGGA
CTATGGCTATCATGAACGTCTTAGCCGAGTTACATCAAGAACATGACCTGAAGGTAAACT
TCCATTATGCACTGGTGTTCGCTTGCTTTCATTCCATGAAATATACTAGAAAACTTTTTG
ATTTCACCTTTTGAAAGTCGAAGCTGGAACTTCTTTTTTTAGTCTAATCAAAATATTGTC
TTGAACTTTAAAACGTGGGAGTTGATCCTTTATTTTGTGGCTAAATGACATCCAGAGACC
CAGAATTTCTAGGAAACTATTTGAGGTGTGATCTGAAGTTGAAGCTTGCCTGATGTTGCT
AATTAAGGTAACTATCTTGCAGCTAAACTTGAAATTTGAAATTGAGGTGCTCTGCAAGAA
CCTTGCGTTAGACATCAGTGAGCTAAAACCCGGGAACCTTCTGAAGGATAAAGATCGATT
AAAAAACTTAGAAGAACAGCTCTCTGCTCCAAAGAAAGATGTAAAACAACCAGAAGAACT
TCCAGCCATCACAACAACTAGTAAGTAGCCCGAGCACATAAAAATCAAGTGAAGTTCTCT
TCCCCTTGTGGGCCAGGGCCTGATTAGCTTGTGTCTAACCCCAATGCCTAGAACAGTGCT
TGACACATAGTAAGTGCTTAACAGAATCCAGTTTAAAACAAAATACCTAATGGTCCTACT
TTATCCATTCAGGTATGTGGCACAAAGAAATTTAAATTCACAAAGAATACGGTGTAGAAA
TGGGAGGAATAAATGGAAAAAAGGATTTCATTCATTCAGTAGTATTTATTGAGCGCTTAC
TATGTGCAGAGCACTGTACTAAGCGCTTGGGATGAACAAGTCGGCAACAGATACAGTCCC
TGCCGTTTGACGGGCTTACAGATTTGCACGGCCTAGCACGGAAAGCTTTCGAACTGGGAA
TCAGGAAATCTAGGTTCTGATCCCCACTCCACCACTTGCCCACTATGTGACATTGGGCAA
GGTACTAAACTTCTTGGTGCTTCCGGTCCCTCATCCGTAAAATTGGGATTCCCCCATCTT
TAAACTGAGCCTTGTGTGGGACAGGGACTGTGTCCTTTCTGGTTGTCTTGCCCTCCGATT
GGCACATTGTAAGCTAATAAATACTGCTATTTTTTTTTAATTATCACTGAAGGTTAATGT
TGAGGCATGGGGTCTCATTTGAAGGAATAAGTAGAAATGTCCAGAAAAACAGAAAAATCA
GTTGTCTGGGAAAACTTCTGGCAGTGATCCTTCTTTCTCAGGGTATTAAATGTAGAACTC
GGACTTGAAGGATGTATTCACAAAACCTGTCAAGGCACTCTGGCTGTCTTAAAAATAGCT
GGGTGGTGATAGGTGGTGGAACCATTTAGTTCTGACTCTTGCTAGAATTCCTCTAAGGGA
AAATGACAGGTGGCAAAGTTGGTACTGAAGGAAGGCAGCGGGGTTCTCATTTTTATGCCA
GGTATATTCTTAATGTCCCCATCACTAGATGCTACCGATACACCTAGCATAATGTATGGA
GACCATCCCAAAGGAAGAAAGATTAGAAATAGCAGCTATGATATTTTATCCTAGAGTCTC
ACTTTTATGTAAAAGTTCCCTTATCCTGAATTAAAGTAGATGATTTAAAACAAACTGGTA
TTGTATGCAGGGGGCTCTAATTTCTTTTAACCCATTGATGAGGATCGGCAACTCCTCATT
TGACCGGTGGGTTAAAATGAAGATAGAAATGATGCCCCCTTACACATTTCCTAAACCCAG
AGGCGGCCCGAAGTTTTTTATATTTTCAAACAGTTTTTCAGTCGTCCCAACTTAGCGATG
GTTTTCTTCTGTAAAAGTTCCTGTCTGAGGTTGTTCTAATGAATTCTTAATTGTACGTTA
AGCGGCCTCTACAACACCAGCCACCAGTACGACCTGTACGGCGACAGTTCCTCCTCAGCC
CCAGTACAGCTACCACGACATCAACGTGTACTCGCTCGGAGGGCTGGCCCCACACATTAC
TCTAAATCCCACGGTATGTATCTGAGCTCTTGGGTTTCCTCGCTGATGTTTTCCCTGATT
TCTTTAGTCCTACATGGACAGAACTGCTTTTAACCAACACACACAATTCACCCGACACCA
TGCATCCCCATGTAACATCACAGTCATATTCTGTGACGTTAAGGGCCAGTGGGCAGGGCA
GTGGAGTTCAGATTCCCTGCAAAGTCTCCTAAGGATTCGATGGAGTTTTGTCTCCCCCTG
TCAGAAATTGTTTCTGGAGACAAAACCAGTAAACATTTGTCAGCCGATTTGCAGAGTAAC
TCCTTCAAGAGGATTTTCAGTTTGGAAGTTAATGTAGGCCTTCGTTGGTTTTTAAGTAGA
AATTTATGTTCAGTTCTGTGCTTCTTTGAGCAAGTGACGGGCCCAGGTGCACTTCCAAAA
TGAAGCCCAGGTTGAATTAAATTATGACAAGTAAGTTCCTCAGACTGTTATTCCTTAGCA
AGCCAAACCATTAATAATTTGAAACTGGTCGTAAGTAAAAGAGGATTATTTTGATAATAA
TGTTGGTATTTGTTAAGCGCTTACTATGTGCAGAGCACTATTCTAAGCGCTGGGGGAGAC
ACGGGGGAATCAGGTTGTCCCACATGGGGCTCACAATCTTAATCCCCATTTTACAGATGA
GGTAACTGAGGCCCAGAGAAGTTAAGTGACTTGCCCACAGTCACACAGCTGACAAGTGGC
AGAGCTGGGATTTGAACTCATGACCTCTGACTCCAAAGCCCATGCTCTTTCCACTGAGCC
ACGCTGCTTCTCTGATAGATTTCCCTGGGAATGAACTAATGAATGTAATCTTTTGTCATT
ATATTTATAAATCATATATTTCCCTCAATGGTATTTACTGAGCGCTTACTATGTGCAGAG
CACTGTACTAAGCATTGGATGAGTACAGTACAACAGAATTAGCAGAGACGTTCCCTGCCC
ATAATGAACTTACAGTCCTTAACTTTTCCTTGTTAGCTGTCGAGGGAGTGGAATCAGCTT
CTGGTTGTAGCTGTAACCCTCTAAAAGGTCACTACAAAGTTTAAATGAATGAATGCATAT
TCTTCCCTAATTATCTAATTTACTCCCAGGGAGTGGCCTTGGAAAGTGCAGACATAGGGT
CTTCCAGGTTAAACTGGGCTCTCAAAAGAAAGTACTTATTTAATTTTATTGCCTACTCTT
GAAAGCAATAGCTGTGCATCTCAGCTCTCACAAAAACCCTTTAATCAGGGAAGAATGAGA
ATTCAGAATGGGGAGGGGACTCTTGGTGGTACAAAGTCTTCGTGTCTATCGGATTAGACG
CGACTGGAAAAACATAGGTTTCACGCATTTCAAAGGTCTGTAGAGCACTGATACTTATTC
TTAGTTTTGTTTGGCCCCTCATTCATCTTCCCTCTACCCACTGCTGGCATTTCAAAATTA
AAATAACACTCCCAGCTGTCCTAAAATGCAAAGCTCGTGTTCTTGCAAGACGTCAAAACA
AGGAAAGCTTAATTTATAGCAGTCATCTTTCCACCCAAACCTTGCCCTCCCCCTGATTTT
CCCACCACTGTAGACACTCCATCATCATCCTCCCTGTCTCATTAGCCCATAACCTTGCAT
TATCTTGGATTCCTCTCTCCCATTCAACCCTCTTATTTCATTCATTTCATTCAGTTGTAT
TTATTGAGCGCGTACTGCGTGCAGAGCACTGTACTAAGCACTTGGAAAGTACAATTCGTC
AAATCCTGTCAGTTCTACCTCTACAGCATTTCTATAATCAACCCTTTCCTCTCCATCCAA
ACTGCCACCATGCTGATCCAAATCCTTATATTCTCCCTAACTACCGCATCAGCCTCCTCA
TTGACCTCCCTGCCTCTTTCGACTCCGGTCCGTACTTCAGTCAGTCATATTTATTGAGCG
CGTATTGTATGCAGCGCACTGAATAAACAGATACATTCCCCACCCGCAGGGAGCTTACAG
TCTAGAGGGGGAGACGGACATTAATATAAATAAATATATTACAGATATGTACACTTGGCT
GCCCACATGAGTTTCCAAAAAAGCTCAGTCCACAACTCCCCACTCTTCAGAAACCACCAA
TGTGTGCCTACCCACCTCCACACCAGACAGGAACTCATTTCCATTGGCTTTAAAGCACCG
TCTGTTTTGCCCTTCCTCCCATCCCTCACTCATCTCCTGTTAGAACCCAGCCTGCAGACT
TTGCTCCTCTAATGCAAATCTATTCACTCTACCTTGGTCTCGTCTAGCTCACCGCCCACC
CCTTGCCCACTTCCTCTCTCTGTCCTGGAACTCCCTCCCACTTGATATCTGACAGACCTC
CACTTTCCCCACCTTCAAAGCCCTACTCCTTCGAGATCACATCTCCTCCAAGAGGCCTTC
CCTGACCAGACCATCATTTCCCCTACTTGCCCCCCTATTCTGCGTCGCTTATACACTCTG
ATCTCTATCCCCCTAAGTAACTTGATATTTGCCCCATCCTTAGCCTCACAGCATCGTGTA
CCTATCCTTGGACTGCCATTTTCCCCCATCTGTATTTGAATGTCTGTCTCTCCCTCTAGC
CTCTAATCTCCCCGGGGTTCAGTTCAGTGCTCTGCACACAGTGAGTACTCAAGAAATACC
CTTGATCGATTGATTTACCTGCCTGTTGGGATAAAGCTGCCCCCCAAAACCCCAACGGGC
TCGTGTGATCAGAGGAATACTCCCTAATTTCCCAACGCCGATCCAGTCAAAATGCCATAG
TGAAAACACGTTTATGGGAGAACACATTTTAGCGTGTACCGGCAGCGAGGCGTGGGTTGT
AGAAACGGATCTGATTTTGCTCATTTAACCTCATCTCGATTCTCCGCAGATTCCGTTGTT
CCAGGCCCATCCACAGTTAAAGCAGTGTGTGCGCCAAGCAATCGAACGTGCTGTACAAGA
GCTTGTCCATCCGGTGGTGGATAGGTCCATTAAGATTGCCATGACTACTTGTGAACAAAT
AGTCAGGAAGGATTTTGCACTGGATTCAGAGGAGTCACGCATGCGAATAGCAGCACATCA
CATGATGAGGAATCTGACAGCCGGAATGGCTATGATAACTTGCAGGGAACCTTTGCTGAT
GAGTATAGCTACCAACCTGAAAAACAGCTTCGCCACCGCACTGCGGGTAAGATAGTTGAA
TCTGTGGGTAGTATAAAGCCCCATCATCTTGCATCTGTTTGTGTCGTCTGGAAATCTGTG
AACTTAAGAGGTGGGGTGAAGTAACTCTGAACCTTCTATTTTCTTTTGAGTTTTGAAGGA
GAAAAGCGATTTATAGCGGCTGCTCCAGCCCACTTGCCTTTCCCACCCCTCTTCTCCCAT
TGGATGTTAGGTGTTCAGCTCCTGTTATTCATCATAAGGGCGCAACTCCTTTAAGCCTCG
AGTTAGATGTGTTTTAGAGGAGAAATTATAAATTATCACGATCCTTGTACTGTGTACAAG
TGCAGGACAAGACCATAAAACTATATGCCGTTAGGATGACCCCTTATTTAATTGTGGGGT
CACGTTTGACACCGCTCTTTTCACTTTGAACTTGCTTCAAAACCTTTTTAAAAACTTAAG
CCTTACTTTGATGCATGCTGAAGGGAATGTCGGCATTTAGGGAGATAAACCAACTAGCTT
ACTGCGTGAGATCTGTTTTTCTTTCACCCAAACTATCTTTCAACAATCAAACTCTATGCT
AAAATCATTTAAATTTAAGAAGACTGAGTGGGGAAAAATGGCTTAAAACTCAAAGTAAGC
TGTCTTTTCTAACAAACCGATTACCAGCAGTCCAACAGGTCTGAGATTGAGGCAGATTTT
TTCCAACAGGAAAATGCACGGCAATCTCTAATGCTGTGCCTCGCTTTAATAGGCTGCGTC
TCCTCAGCAAAGGGAAATGATGGAGCAGGCAGCTGCGCAGTTAGCTCAGGACAATTGTGA
ATTAGCCTGCTGCTTCATTCAGAAGACTGCCGTAGAAAAAGCAGGCCCCGAAATGGACAA
GAGGCTAGCAACTGTAAGTACCCGGCTCCCTTTTAAATAGCACTTGCGTAGGTTATTGGG
AGGACAGCATTTCAGCGACTTCTCTCATCTGCAGGAGTTTGAGCTGCGCAAACACGCTAG
GCAGGAGGGCCGTAGGTACTGTGATCCCGTTGTATTAACCTATCAGGCTGAGCGGATGCC
AGAACAGATCAGGCTGAAGGTGAGTTTGCAGGAGCTTAATGTCCTGTTCCTCCTTTTTTC
TTTTTTCCTTGAGGTCTTTAAGTACCTGATTTGAAATGGGCTGGGGGAGGTGGGGAGGAG
GTGTGCTTGAAAATTCCTTCCGAGAGGCTGCTTAATTTTGCTCCATTTATGCTCAGAGGG
CATCTTTGGGGCTGGTAGTCCAAGGCCATTACCGAGAGAAATGTTCCTAACCTTTCCAAG
TGTTTCCAATCAGAATGTTGATGTGATTTGCCTCTCGTCAGATTAGCAAGTTTGAGGTAG
CTCGGATCAGTGATCCTGAGGTTCTTTGTCAGTTGTGTCACTCTTGAGAGTCGTGGTGTA
ATTTTTCTCAGTTTTTGGAAATGTCCTTTGTTTTATTGAACTTAATGGGTCCTCTCCAGT
GATTTGGCTTTTCTTCTACAGGTAGGAGGTGTGGACCCCAAACAGCTGGCTGTTTATGAG
GAGTTTGCACGCAATGTTCCTGGCTTCTTGCCTACTAATGATTTAACCCAGCCCACGGGA
TTCTTAGCGCAGCCTATGAAAGTAAGTATTCGGCGAGAAATGTTCCGATGAATTGACGAG
TGATTGTTTTAGCCTAAGTCGCGTTGGTGCCTGTGCTCATAGGGTTTCAGTCCCTGGGAC
CAAACGCGAAGTGTTGCCAGATGTTTGTCGCAGGGTAACGTTTTTAGCGTTTTAGGACAT
AAGGCTGGCTCCTTGGGCTTGTAGGGGTCCATATGGTAAGTCAAAAGGGAATGACTGGCA
TGTCTCCCTACCGGTATAGTTGTAGAAAACTAGCCCTCTTACAGTTGCCTGAACTCTTTG
CATAATGCCAAACAGTTCTAACAGTTCTGTTGAGAAAGCTAATTAGGTTGCCTACCATAT
CCTTGTTTTTGTTTGCTTTTTCATTTGTACGTTTAAACACTTGTTCATTGTGGTTTCGTT
CTTTCCCCCTCCCCCCGCCCCCCCTTTGGAGCAGCAAGCTTGGGCAACAGACGATGTAGC
CCAGATTTATGACAAGTGTATTACAGAACTGGAACAGCACCTGCATGCCATTCCACCTGC
ATTGGCCATGAACCCTCAAGCTCAGGCTCTTCGCAGCCTTTTGGAAGCTGTGGTGCTGTC
TCGCAACTCTCGTGATGCCATAGCGGCACTTGGGTTGCTTCAGAAGGTTAGTTACCTTAA
TCGTACTCCATGGATGCATTTCACTCAATTGACTAATCTAGTAGCAGAGGTAATCTCGTG
GCTTTCCATAGTTTGGGTGCCCCTCCTTGGCCTCTAGGACAACATTTAGGGATCTCTCTA
GACTTCTCACCCCAGATGACCTTGCCACCTGCTTTGTGGGTAAGACTGGAACCCTCGGGT
GGGAGCTTCCCCAAATTTCGGCCTTACTCCCTAACTCTCTTCTCCCGTTCCCGGCTGTGA
ACCTGTCATCCGTGACTTTTTCCAAACCACTCCCGAGCCTCCTGTTGTTTTCAACCAACC
CAACTTCCCATTACCACAGATTAGTAATGCTGTGGGGAAAAAAGTGGGTTTTTTTGCTTG
GAGCCAAACACCTTCAAGCTTCAGTCACTTGTCCTGAGCACTTGTGTGTGCACAGGTCTG
AATTTAGGGGAGTAAAGTAAAATTAGTCAACGACATCACCATCTCAAGCAAGGTGCCTAC
AGTCTAAGAGGGGAGACTAGGTCCAAAAATGATGGTTAGAAGGAAAATGGCGAGGGGGAT
CTGTGCTGAGCTTGGGTTTTAAGTATTACGGAAGGTAGGAACAAAAGTGATGAGGGAGAG
TTTGAGTGGTTCTGTGGCACCGGAGTGGTGTTCAAGCAGCAGAGGGGATGTAAATGGGAG
ATCGTGCATTAATCAGAGATGGCTTCTTAGAGGAGGCGTGATTTCAGAAGGACTTTGAGG
CAGGGAGAGCTCTTTTCGACAGGAAGTAGGGGGAGGGGTTCTGTCGGATACGAAGGGGGA
GGAAGTTCCATGGAGGAGGGAGGTCTTGAAAGAGGTCTAGGATCACACATTTACATAGTC
TGCCTGTCACCTTGGTTGCCATTCATTCAATAGTATTTAGTCAGTAGTATTTATGGAGTG
CTTACTATAAGCAGAGCACTGTACTAAGCTCTTGGAATGTACAATTGGGCAACAGATAGA
GCCAATCTCTGCCCGAAGGGCTCACAGTCTAAACGACAGGCTCCCAGTTGGTGTGAGTTG
GATGGTGTTCCAGGTGCAGGCACACCCCACAGAATTATGGTGGCAAGCCATTCATTTGGG
TGTTTTTTTTAAATCCCTTTCTCGATGGCCTTTTGGGCGGCTGTTGCACATTAGTCTGAT
TTAAGGGAACAACCAGCAGTGATTTCAAGATCTGCCCTGAGTTGTGACTTAGGCCTCGGA
GCCCATCATCACATCCAGCAACCTCCGTTATTCTTCTTCAGGGGCATTATGCTTTTCAGG
TTCCCATTCAGGTTCATACCCCTTTTTTCAGCCACTCATTCAGCCGGGGAGAAACAATGC
AGCAGAGATCATGCACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGTGACTTA
GGCCTCGGAGCCCATCATCACATAATGCAATTGGATATTTTTCTGCAGGGGCATGTCTTT
TGCATGCTTTCATTCAGGTTCATTTGCCATTTTTCAGCCACTCATTCAGTTTTGTGCGGT
TTATGCAGTTTATTTCTGTCTACATTGCACTTCGCCACAGCTCAGTGTTATCTGTACAGT
TGAAGATTTCACTGTCCACTTCCTTTCCTAGGTCACTTATGAAAGTGCTAATCAGCAATA
GTCTCATCACTGATAGACTACCTTGTTTTTTATAGTGCCTTTATTTTTCCCATTATTCAC
TTCCTAGTCCGGAAAAGCGTTCATTTGATTGTCTCTGCCTTTTGGTTTCTATCTACTTGC
CAGCTTTCATCCCCAGATTACTCCCGATTTTTTTTTTTAAAAAGCCTTTTTGCACTGAGT
CTTGTCGAATGGCCTTTCGAAAATCGTACCTCCCAACCCTCCCCTTTGAAGAATGGTCAT
TTATCAGTTTGTGGTCACCCCCTGCAACATAGCTTTCCCACATAATCCTTCTGTACTGAG
GGGTGGAGAGTACCAGGGTGGTGACTTTGGAATCAGGGCAAAAATCACAAGAGGTGGGTT
TAAAAAAAAAAAAAAGTTCTCTGAGGACGAAAGGTGGTGAAAGTTAATGATGGGATTCCA
GGTAGAAGAAGAGTGGAGGTGGCTGCTGCTGCTGCTGCTGCTGCTGAGAGTTTTGTGCCA
GGCTGATGTGACGAATGAAAAACCTTTTGCAGAGACCGTGTTTTACCCCATTCTCATCAT
TGGTGCTGGATGTTTCCTTCCTTGTAGGCAGTAGAGGGTTTACTGGATGCCACAAGCGGT
GCAGATGCCGACCTATTGCTACGTTACCGAGAGTGTCATCTACTTGTACTGAAAGCGCTG
CAGGATGGTCGGGCCTATGGTTCACCGTGGTGTAATAAACAGATCACGAGGTGAGTAAAG
GCGAATGAAACAAACGGAGCACCGTGGGTCTGTGGGGTTTTTTTGTTTTTTCTTTCTGTG
CCTTGAATGACTGTAGGTCACCTCTACCAGATGAAAAAGATGGTTTCCACGACCTACGTG
GGATGGTGGAATATATGAGTTTTAGCATGGGATATGGGGGAAGTTTTGGGTTTTTTTTAC
ATTAAGTAGCTAATCTGAAGAAGAAAACAAAATTGGGTACTTATTCAAAACACCAGTGCA
GTTCATATTGAAATTTACCTCATTAATGTAGATGTGGAAGCGTTTAACAGAATCTGGATG
GAAATGTGGAAAGAGAGGGCAGATACTGATGTGGCTCACAGTTGGATGGAGTACAGGCTT
CCACTTGGGTTGAATTTGAGATACTGCTTCATCTCTGGCATTCATTTATTTCACACTTTG
GAGTGACATGTTGACTCTTCTTAGGTGCCTGATCGAGTGTCGGGATGAATATAAGTATAA
CGTTGAAGCAGTGGAACTGCTGATTCGGAACCATCTAGTTAACATGCAGCAGTATGACCT
GCACCTGGCTCAGGTAAGGAAGTATTAGCCCGAAGAGTCATAAAAAGAAAGAATTGTGAT
GCCTTCTTGCTGGAAAATGTCAATCTCCTGATCTTGTGATTTTTCCATGTTGCCAGTCAA
TGGAGAATGGTTTGAACTACATGGCAGTGGCATTTGCTATGCAGTTGGTGAAGATCCTGT
TGGTGGATGAAAGGACTGTAGCCCATGTAACAGAGGCAGATTTATTTCACACCATTGAAA
CTCTGATGAGGATTAATGCTCACTCCAGAGGAAATGCCCCCGAAGGGTGAGAATGAAATA
GTGCGGTAGACTTTCGTGTTCAACGACCTCCTTAAGTCCTCTGGAAATGAATGAGGGAAC
TCCAAAAAAAAAATTCCTTTTATAACTCTGCTCTGTCTATAATGTTAAGGAAGTTCAAGA
TGACCATTTCACCAAAGACGACTTGGGTCTAGATGAATGTGTTGGGCAGAGCTGAAATAA
CGTCTGCAATTGCCTCTTCCTCGGTATCTATAGGTAGTGGAGCCAAATATAGGGACTGAC
TTCAAATGTCATGAGAGAGAGAGGAAAAATGAGCACCGTAAACCGTGGTTGATCCACTGA
AAGACCATCCTTGTGTTTAGGTCAAGCCAGCAGTGGTGGTGGAGGGGGGCGGAATCAGTC
ATGTAGCCGAACAGTGTCGTTCGATTCAAATACAAAATAAACAATAGGTGAAGAGTATCG
TTTACCGAAAGTGACTTAATGCATCGTGTTTCTCAAAAAGCAAGGCTGTCCAGCCGTTGG
CAGTTTCGGGAAGATGAGTGATATGATTTTTGCTGTATATTTCACCCCAGATTACCCCAG
CTGATGGAAGTGGTGCGTGCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGTCCT
AACTTCATGATGCACTCTGGGATCTCTCAAGCCTCAGAATATGATGACCCTCCAGGCCTA
AGGGAGAAGGCAGAGTATCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCCGCAGCT
GGTCGCGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGA
AAGGTGCTTTTTATTTGACATAAGTAGGGTGTGATGCCCCCCCAATGTTAAAGCATAGTG
TTATGTACCCGTGGACAGTTACCTCCATACTCATGCAAACTAAAAATTGTATTTGTCGAA
ACCCGATTAAATTCACGGGATACTTGTTGAATTCCTCAACCCTGATTATCATCACTGCAT
AAAGACCTCGCTCCGTTTAACCGGATCCCTTCGTCGGTATCTCAGCTCAGTGGTCATAGA
CGTTAAATACGGTGTCCGATTCTGAGGTGGTTCATTTTCCCTGTGTAAATCTGGAACTGA
GAGCCTCTCTGAGATGCATCTTGGTGATCAGCAGTCATGAGGAATGCACACCTCAATCAG
AATGAAACACGCGATGGGGTTTTTGTTGCCTAACTTTCCACATTTTCTGATTACCTAAGG
CAAAATTTTACTAGAAAACGTTTGGAATGGCAAAGCACTTAATGTTATACTAAGTAAACT
AGCTAGTCTACTCGCCAAACTAGTGCTTTGGAAAGTTTGGATTTAACGTAGACTTCAATT
GGATCTGTCAGAAGACACACCTTGACTAAGTTTAGGTTGCCAAAAGGCTAGTTTTTTTTT
TTTTTTTTTTTAAATAGAGGAGGAGAACCTATCCAAGTATTTTGCAGCAGAACAATTTTG
CTTCCTCATACCAGGTCTTTGTTAGTATGTCCATGTCCCCTTCCTTGGAAGTCTCCATGT
CCCCTTCCTTGGAAGTCTGCTTGTTTAAGAGACCGTGGGCAAGGTCGTCACAACTGTTAA
ATGCATCTTTTTGCCCAGTGACACCCTGGCAAAAATGGAGCCAAAACGGTCCCGCCATTT
CTGAAGTACAGTGCAGTTTGGCTAAAGTGGGACATACAAAGCAGGGTTTTTGATTCACTT
TTTAAGATTGTCTCATATCCATAAATTAAGAAACAGAGTGGAATATCCCACAGAAGAATG
ATAGGGCTGGCCTGGATAGGTTTAATAACTGAAAAGCTGAAGACGAAGCTTTATTTTTAA
GAGAAGTCGGGAAATAAAATGAGGCTTATTTACAAGTTTAACATTAATAAATGCTACTTC
CAAATAAATGTACCCGTGGAAACCCCAAGAAAATGAGTTATATTAAAAATAATAATCACC
TCCCTCAAGCTTGGGAGCGGAGGGGGCAGGAAAGTATCTCGTGAATGGCCATTACTACAT
TGGTTTTATGGCTTCTGATAAGATGGAAGATATTTGTTCCAATTTCATTTATAGCATACA
ATTGTAACATTTCATGGGTATGGATGAGGCACCTGTCAAATCTCATAGCTCTCCTATTCC
TGGTTTTTGTTTTGCTTCTTGCTCTCCTGGCCCCTTCACAAAACAATATTTGCTGTATTT
TTATGTTCACTCTTCCTTCCTGGTGGCTTAAAAATTCTTCCTGTGCAGGATTTGGTATCT
TTCCTTTCTCCCATCTCTTTTTTTCCTATGAACTATAGTTTTCAAATCCATGGGAAAGTC
TCCTGCCCACCTCTTCACTTGGTCCAGGGGTATGTGAGCCCATCATTGGTATCAGATACC
TTTAGTCCTACTTCTTGCCTTTCTGGCCCCACTTAGAGAACCGAACTGGCCTTCGGGTTT
CTAGATTGGGGCATTCTTTTCAAACCTTCTGTTTCTTGGTTTTCTGAAAACTGTTCACTC
TTCCTCTCTCTTGATCTAACCGCTCTTATGGCAAGAATCTCCTGGAAGCACTTCAAAGAC
TTCTCTAATTTATCGAATCACCTTGTCTGTCTTCCCCCTTCTTACTTTTATTTAGCATAT
TTAATAAATAATGTGATGGTTAATATCCAATTGTATTAATGCAGTTAATTTAATTTCATG
GGCTTAGTCTGTTTTCAGTGGTGCTTATCTACCACGCTAAATGATTTACGATCTATGTAT
TGAAAAAAAAATTTCCAAGGAAAACAATATTACATCTCTGCACAGTTCAGTGGGTTTTTT
TGATGACAGACTTCCTTTAAAAGTGGTCTCGAGTTGCCATCCTTTTAGGCCCATTTTTAT
ACTGTGCCAAGTCATATGCTGATAGGGTATCACTGATTTTATTATTCCGGAGAAAAATAG
ATGGGATCTTCAGTGCATTGCCAAGTTGAATTCTGTTAGCTTGTATTGCCCATTTAGTGC
ATGGGAATCCGTGGTCTAACCATTGACTTCTATTGCTTCCCATCTGTACCCATTTCCTGT
GAAATTCGGGCCAGTAATCCTGGGAACAATCACTTGGCATTCTTAATAGGTGACTCTGCC
ACCTAATCAGTGTAAAAAGTGGGGGGGGGGGCTTGGGCATATGGGTCTCTTTATGAACCT
TGATGTGATTGAATCTAAATGAGTGTTTCTTCTTATTTTACTGTACTGAGGGTTTACTTT
TCTTCCCCGTAATAGATGCACCAGCAAGGAATCTTGAAGACCGACGACCTCATAACAAGG
TTCTTTCGCCTGTGCACAGAAATGTGTGTTGAGATCAGCTACCGAGCTCAGGCCGAGCAG
CAACACAATCCCGCAGCCAACCCTACCATGATCCGAGCCAAATGCTATCATAACCTGGAT
GCTTTTGTGCGACTTATTGCCCTCCTGGTCAAACATTCGGGGGAGGCCACCAATACGGTC
ACCAAGATAAACCTGCTGAATAAGGTGAACGATCCTTCGGTTTGCAGCCGCCCCAAGCAG
TACTCAGTTTCGGCTTTCGAAATCGATAGGTGACTGGTAAAGTCAGCTAATGGAGTTATG
AGTAAAAGCCAGTCCTCTGGGTGTCTAAAATTACTCCCTGATGATAAGTTGGGTGTGGTG
GAAGGAACACCAAGTCTTTGTGACCACAAGGTGGACTCCTTATAGCCCATCGCTTCACAC
TGCGGGAATGCATCCCGTCAGCTTCTCTTGGTCTAAAAGAACGTGCTCCTCTCAAACTTA
ATATCAGAATAATTTGAGGCACCGGGAGACTTGAGCGCAACATTAACGGGAGGTCTATGG
CTAATACTGTTTTGTCCTCCCAGTCTGTTACTTGTCCTACTTTTAAGTTCAGGACCTTAA
ATCTGGGCCAGGATAGTAGTATATTATTTGTCTGAATTTCTCATAGCTAGAAAGTCAGGT
GGAAGATTTTGACTCATGGTAAAATGTCAAGCACGGCTCCCAAGGAGCTCTTTGGCCAGT
TGCTCCTTTGCTTGAGCTTCTAGGTGGTGTTCCTTCTGGAATGATGGTTGACCTCACTGT
TGCCTTCTAAGCAGAGTAAGAATCACCGCTTAAGCAGTTTGGGAGAATTTAGTATTGGTC
ATGCATAGTACTGGAAGGAACCCAGAGGGCCTTGGGCCCAGCCCCCGCCACCTCCCTTCT
TCCAGGCAGGTAAATAATGATGGTGCTTGTTAATAACAACCGTAGTATTTGTTAAGCGTA
AACTGTGTGACAGGTGGTGTTGCACAGTGTTAAGCATTGCAGGGGATATCAGTTAATCGG
TCCCTGTCCTATATGGGGCTTGCAGTCTTAAGTAGGACTCCCCATTTTACGAGTGAGGAA
ACTCAGACTTACAAAAGTTAAATGACTTGCCCAAGATCACCCAGTAGGCAACTGGCAGTT
GGGATGAAACTCTGCTGGTTAGACCGAGTCCGACCGAATTAACTCGTACCTACCTCGGCG
CTCGGAAAAGCGTTTAACATAAAAAGCACCTAACAAGTGCCGTAAAAAAAGTCCCCTGAC
TTCCAGGCCTGTCTCCTTTCCAGTAGGCCACACTGTCTGGGAAACTGTCCCTAGAGATCA
ATCGGGGAAGGGGGTAAAAAAAAAAAAAAGACCTAGTCACTGCAGCATCCTCGGTGTCCT
TTTCAAATGTTTTCCAGTCCTATATCTTTAAAAATTCCTTGCCGTAGTGAATCAAGAGCA
TTTATTAAGCACTTACTATATGGAACACTACTGAACGCCTCAGAGAACAGTGCATCAGAG
TTGGCAGACACATTCTGTGCCAAGGAGCTTCAGTGTATTACCACCCAAATTCTCTCCTGC
TTAAATCAGAAACCTATTTTCTTTAGTTCAGTCAAACGGTGGTATTTATGGGGTAACGAG
TGTGAGTCACTGTTCTGAGCTCCTGGAAGAGTGCAACCAAATGGAGATGCCTGTTTCCCT
GCCCTCAGGGAGCTCCCAGATCTAATCTCCCTGTCTGCAAACAGGCAGAGAGCATATTTG
GAGGTAAGTACGTATTTACTTCATCATGAAATAGCCAAACAAACCATTGACTATAAAAAT
GAAAATCCAAATTAGAGTATTGGGTCCTTTTTTTGTATTTTGAAAAATAAGGGGGAAACG
GGAAAGGTCCAGGGTAGAAAATAGTTTCTATGAGGAATTCACGTTGGACTTGGAGGAGAC
ATGGCTGAGGTGATTCCGGGACAGGGGCCTGCTTTTGTAGTTGACTTGGACCTGAGCCTT
TTGTCGGTAGTCACGCCTAGCCTATATTCCCATGTCCTCTATATGAATGGTTGTGCTGCC
CTAGCAATGTCAACTTCACTTTGATTTTTAATTTTGGCGTACAGTAATACCCTCTCATTT
AGCATCACCCGCAGGTCTGGGCGGAGTTACTAAAATTGGGAGGACAGTAAAATTCAAAGA
GTAAGAAAAGGAACCTCCATAACGGATGCAGTTGAACAGACAAGTGCAAAGCAGTGCACT
TCGAGAATAACACACACCCCAGGGCAGGATATTTGAATGTTCACTAGTTTAGAACATTTC
CTGGAAAGAAGATCCCAGGGTATTGTTTCCTGAAACATGCCCCCCCCCCCCCCCCCATTA
TATGTAATTCTAGATTGTAGAGCATCAAGAAAATGGAAGTCATCTGTCCTGTCACTACAT
GAGGAGAGGAACCCAGAAAAGTGATAACAATTGGAGAAGTCAATTTGGTCTTGGTGTCCT
CGTGACTTTTGAAACATTAAAGAATAGAGCCTATGAGAGAGAGTAGAAATGTTTTTCTAA
AGCCCGGCACTGAAACCTGTCCCCTTCCTTCCTTCAGGTTCTTGGGATCGTGGTGGGCGT
CCTCCTGCAGGATCACGATGTTCGGCAAAACGATTTTCAGCAGCTTCCGTACCACCGTAT
TTTCATCATGTTGCTTTTGGAACTCAATGCCCCCGAGCATGTCTTGGAGACCATTAATTT
TCAGACGCTCACAGCTTTCTGGTATGTTACCGATTACTCCCTCTACGTTGCTTTAAATAA
TAAGGATTTTCTTCTGGAGGGTTTTTACCTTGGTTTGGTTGGGGTCTGGCATGTGACATT
CTCCACGTAAAGATAATTTGCTTAGTGTATTGAGTAGAACCACCAAAATGCTTTCGGTCT
CCACTTCTCTTAAAGACTTTTGATAAGCTTTAAGTTGAACTGTATTCCTAATCGGGATTA
TAAGGTCCAGTTATTGTTGATTTGATGAAATCTGGAGCTACGCTGTTAACTGGCATGTCT
CTTTTCAGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCCGGCTTTGTGTATGCC
TGGCTTGAGCTGATCTCCCACCGGATATTTATCGCACGGATGCTGGCACATACACCACAG
CAGAAGGTATGGCCGCAGTTTACCGTCTAGGAATGACAACACGGTGTTTTAGCCGTTTTT
AATTAGTGGTTGATTTCGTTATGTGCTTAGCCATGGCCTGCAAGCCCAGCTGCGGATGCT
TTTGGTTAGCTTCATTCCTTTGTAAGACATCCTTCATTCCACTCGCCTTTCAGATTCCAG
GAGAGACACAAGTGATTGGATATGGAATGTATCTTTTTCAGATCCAACAGTTCTTAGAAG
GGTAGTCAGGTTGTCAGTTCATCGGGACTTTTTCAGGTTTAACCAGAAATTTCCTAGGCG
TTCAAGGGCCGGGCTAGCTCGTTTTGTCCAAATACTTTAAAACCACTTGTGGACTAGAAT
GGTGACTGTGTACGATGGAGGGGATCAAAGACCAGGTAATGTTATGCACGTAGAGATTTT
AGGAAAGCTGGTGTAACGGAAGACCATTCCCCAGTGAGCCTCTTGATGATTAAAATATTG
TTATGTAGTTGTTTGTGCCTGATGTCTGGATTCATACCCTCTTTCTCCTCTTTCAGGGCT
GGCCCATGTATGCCCAACTACTGATTGATTTGTTCAAATATTTGGCTCCCTTCCTTAGAA
ATGTGGAACTTACCAAACCTATGCAAATCCTGTACAAGGTATGTTATTTTGGTATAAGTG
TGTATTCATTTATCTGAAGCTCACATTTGGCAAGTCTGATTTGGGGAAAAGAGGGGAGTC
CTAACAGGGTAAAAGTAGCCCTCTTGCCTTTTTTTTATCTGGCATTAAGGTATTCATTTC
ATAGTGCATTGTACTTTGAAGATGACAAAGCCAGGATCACTGCTAGTGGTGAGCCCATAT
ACTATGGCTCCAACTCCTTTTGCCTCATTAGATATTTCGTATATATAGGAAACGTTTTCC
TCCTGTGTTTGGTTTTGAATTTCTGTGTTCACCTCCCCCCCGCGTCTCTGTCTTTTCCCC
ATAGGGTACTTTACGAGTGCTCCTGGTCTTATTGCATGACTTTCCGGAATTCCTTTGTGA
TTACCATTATGGGTTCTGTGATGTCATCCCACCCAATTGCATCCAGCTAAGAAATTTGAT
CCTGAGTGCCTTTCCACGCAACATGAGGCTCCCAGACCCATTCACTCCCAACTTAAAGGT
AACCAGCTACACTCGAGGAACAGCATACGTTCTCGGAGTTTCTGCTCAGCCCATCACGGT
GGATTCCAGAATGTAGGCCAGCTCCTTGGGAAGCCAGCGAATTAAACTAAATTACTTTGT
ACCGGCTGCTAGAGTGGTGAAGGGATATTGCTGACAGGCCACTGATAGCAGTACAGGGCT
CATAGCAGATGTTGAGATTCCAAAGATCTGACAGTTTCCGTCTTGATTTTGGTATTAGAT
CTAACCATACTCACCTCTCATTTGGCATAAAAAGCTTTATAAAGATAATTTAGATGTTAA
CTTTTGGGGAGAATGGAAACATCTGTAGGGAACTCTAAGCTAACGGACCTAAGGTCTCAT
CCCACGTGTTTTGGCTAGTAAGGTGTCTCTTGAGCCTTGTGTCCCGTATCACAGAGGATG
ATTGATTTCACGCAAGGGAGTGTTTTAGAACAGACTCAGATCGTTGGTGGTGACGCCCGA
GAGTAGAGTCTCCTGGCGAGAGGCTTAAGGGCGTGAGCCGCTAGTCATTTAGAAGCCAGT
CATCAAGCCAACTGTGAATACCGCAGATCCTTGCCATTTGCCAGGGCCGAGATTCCCTGA
ACACCACACGTAACAGATGCGTCTCGGAAAGTGGGTTCTCGCCACAGGAGATACCCGAGT
GCTCTGCACGCCGTGAGCTTAGGTCGCTATCGGTCCGGTTAAAGTAACAGGCGGAGTGTC
CGGCCTGCCGCGTGCCCTGTAAAAGCTTCCAGAAGGCGGTTAGATTGTGTCTGCAGGCGT
GCAGCAGAAGAAACTCATCTGACTCTGGTTTTGTCCTCGACAGGTGGATATGTTGAGTGA
AATTAACATCGCTCCTAGAATCCTCACCAATTTCACAGGAGTGATGCCACCTCAGTTCAA
AAAAGATCTGGATTCCTATCTCAAAACCCGCTCACCAGTCACGTTCCTTTCGGACTTGCG
CAGCAACCTGCAGGTACCTCGGGGTGGTAACTTGGGGATACGAGCGTCCGAACGGCGAAT
TAAAAATCGCCGTGGCCTATTGGGTGTGTTACACCATTTGATCTCTGTGGACTTGCGGGA
ACTTTTAGCGGAGCCTCGATGGAAAGTGAATCGGGATGATATCTCTGGCGTCACCGTCCG
TTTGGGGATGAGCTCGATAATGTAGAATGTCACTAACACCTGTATGGCCAGTTCCTAAGA
CCTGCTGGGAGTGGCCCAGTTGTCCTCTATCTAATCTAATCGGGAACAGGTCTCTACACT
CTAAGCTTGTGGCCGGGGAACGTGTCTACCAACTCTGTTGTGCTGTACTCTCCCGAGCCC
TTGATACGGTGCTCTGCCCACGTTAAGTGCTCAGTAAATACCACTGATTTCCTGTTTGTC
ACGCATGAGGAGTGGAGAACGTCGCCCAGGGGGTGGATATAAAACCACCCCTGTTTTTCT
TTCAAGAGATGTGGAAGGGTGGTTGTCATTTGAAACTTACTTTTCACCTTCACCTTGTAC
CTTTGGTCAGCTGACGGGCTACCGAGGATCACTTTCCACTCAATAGTGATCGAAAGGCCT
CGGTGGCTGGGGTGGGCACGTAACGGAGGAACGGTCGCACGTCGTAAGAGTCCCCATGTG
CCAAAATACCCCGGAGCACGATTGGATTTTTCGGTTCAGAGTCCCGTGCTGGTAGAACAC
GGCAGATTAACGTATTTCTTGTCGCTTGGAAAGAGGAGTGGCGAAGCGGGTTTAGGAAGT
GAGGCCTCTGAAACTGATCAGCCTTGTCTCGTTTGGTTTGCCAGGTATCGAATGAACCCG
GTAATCGTTACAACATCCAGTTGATCAACGCCCTGGTGCTCTACGTAGGTACTCAAGCCA
TCGCCCACATCCACAATAAAGGTAGCACGCCATCCATGAGCACCATCACCCACTCGGCTC
ACATGGACATCTTCCAGAACCTGGCCGTGGACCTGGACACTGAAGGTGATTGGACCCTCC
CGAATCCCAGTGACGCCGACCGGCTCGGAAGCTTGGGGTGGCTTAACTTCTTCTGACCCA
ACCACTCGCGGTGGACGTGCCTGCTGTAGAGAAAACATTCCCAGTTGTCGTCGAACGTAG
TTTTGACACGATAATTATCCGCCCTCCCAACAGCCGTACCTATGAAGTAAGCTGTCCTTA
CTTCATGCCCGCTTCAGAGCACGCGTCTGGGAGTCAGGAGGTCATGGGATCTAATCCAGG
CTCCGCCGCTCGTCTGCTGCGTGGCCTCGGGCCGGTCACGTCGCTTTTCTGTGCCTCGGT
TATCTGTAAGAGCCCCAGGCGTGTCCAACCTGATTTCCTTGGATCCACCCCGGTGCCGAG
TACGGTGCCTGGCGCAGTCAGGACCTAACGAATGCCATAATCATCATTATTAAAAGCTGT
CCGGTCAAACCAGACATTCCAGCGCGGGACCGGGGGTTCGGCCGAAATTCTCGTCCCCCA
GAGTTGCCTCAGCTCCCCCTCTCTGTTTCTAGGTCGGTACCTGTTCCTGAATGCCATCGC
TAACCAGCTGCGGTACCCGAATAGCCACACTCATTACTTCAGTTGTACCATGCTGTACCT
GTTCGCAGAAGCCAACACTGAAGCCATCCAGGAACAGATCACCAGGTAAGAGGGGTCAAG
TGGACGGTCTTCACCTCTTGCAGCCCCTCAGTTGTCAAGCGGTGACTCGCCCTTGCCTCT
TCTCTTCCCGGAGGCTTTCGGCTAAAGTTGCTCGGATTTTCACACGCCGAGGCGAATGAC
GACAGTAGTGGTCGTGAAAGCTGAATCTGCACGTCCTCTCAGCTGACGCTTTTTTTCTCC
CCTTCTTCTTCACCCCAGGGTTCTCTTGGAACGGTTGATTGTAAATAGGCCACATCCTTG
GGGTCTCCTCATTACCTTCATCGAGCTGATTAAAAACCCAGCGTTTAAGTTCTGGAACCA
CGAGTTCGTTCACTGTGCCCCAGAAATTGAAAAGTGAGTTGAGTGGGCCTTCGAATGTGA
GCGGGTGTAGGGCCGTCCCCGCCGGGCCAGGGCTAGCGGACGATGCCCCCCCGGGATCCC
TACCTGGGCGGCGGGCTGAGCACGCGGTTGCTCGAGCTCCTCGGCGATGCCCGTAACTGA
ATGCGAGGGGGCCCGGGTTTGCCCGTTTGGACCGGGGCCGAATGTGCACCTGCAAGACCG
CCCTGGAACCGGAAGGGTCTCCGGGCACGGAGAAGCGAAGCACCGCTTAAAGAAAGCCGC
TCCTGGGACTTCTGAATGTTCAGAAGAGCCAGTGGAGTGGAGGGGGTGCCTCGCAAGCCC
CGGGGGTTGTCTTGGTATTCGAGTGCGGTGTCTGGCGCGGAAGAGCGCCTTCTCAAAAGT
GAGTTGGCTGCTTCAAACCACACCGAATCTGTTCGGGTCGGAGAGCTGGCTCACTAGCGG
TCGCATTAAAGGTTGCGTTCGGGTGAGACTCGTTCTGAGGCCGGGGTCCCGGGTATGACC
GTGAGCTTGTTGCGGGCGGGGGATGCGTCTGGTTGTTGTCGTATCGTACGCTTCCAAACG
CTTAGTACAGAGCTTCGCTCACAGTAAGGGCCCAGGTAGGAACGAACGCGACTACGAGGG
GTACCCGGCCGGAGCTTTCCCGGACAACTGACCGAATGACGCTCCCTGGCCAGTCTTGGG
GGGAAGAAGGGCTCTGATCCTCTTCTGTCCGTGTTCAGGTTGTTCCAGTCGGTTGCACAA
TGCTGCATGGGGCAGAAGCAGGCTCAGCAAGTGATGGAAGGGACCGGTGCCAGTTAAACG
GACTGCGTCTTGCTTGCGGCGAAAAGCGTGCCAGCCTGGAGGGTCCCCGTTCCGCCGAGT
TTCCCAAACTGGAGAATCCTTTCGACTCTTCCTGACCTTCCCTTGGATTTTGGGTACACA
CCACCCCCCCCTCGGGAGGGGGGAAGGGGGCGAGTCTCCCGTGGGCACGTTCCAAAGTTT
AAACACATTTTCTGACTCTTGGCCAAAATTTAGAAGATGCTGTGAATATCATTTTGAACT
AGTGTAAATACATGAAACCGAAAACCTTTGTCTGGACTTTTTGGGTTTGTGCAAATTGTG
TTTAAAGGCAGGGGGATTAAACTGGCACCTGTCGAGCTTGTAAGAAAGGGGCAGCTGCTG
ATGCCAAGCACTTGTCTGGGGCAGATCTCCTTGTCCTGACATTCCTGGACTCCCAAAGAA
TATTGAAAAGCCAGTTTAAATATTATGTAACTTATTTTTTTCTTTTCTGTCGACAGGGGA
CCTTTAAATCACTAAGTTGTTTAAAAAAAAAAATGTGGATGTGTTGGAATATGGGATACT
ATGGAATGTGGGGAGGGTGGGGGAGGATTTGGGATTAAGGTCCAATGGGTATTTTTTTTT
TTTTTGGTTTGGGTTGTTTTTTCTTCCTTCCGGGTTTCATTTTTGATTCCCTCAAAAGCT
GACAGCAGGGAGAGCTGCAGTGGAACAGCTTCTCGTTTCTGCTGGAGAAGATGCACCTCG
GGCCCTCTGGGACAGGGCCAGCTCTTTGTATTAAAGGAACCCAGACCAGGCCCATAGCTT
CTTTATTTTTTCCTGACACTTGTAAATTTGTGGGGAGAGAAAAAAAAAATATATATATAT
CTCTGAACTGCCTTCCCCCTCCTCCCTGCTCCCATTCCTTACTCCCCGAAGCCACACAGT
CTAAGTTTGTAAAAAGAACAAAGGACCAATACAGCCCATTTTGTAAGGATTTTGAATGTT
TTGTAAATGTATTGGTCCACGTGTTGTATTTTGTAGCCTTTCTAGTTCCTGGGCTTTAGT
TCTCCCACTTCTTGTATGTATGCATACTGTAGTTACACATTAAAGTCATGACATGCAATC
TGGTCCACTGTGGCTTTCTCAGTAGCAGCCAGCAATGGCAGGAAAGGCAAAAGTGGACAG
TCACTTCTCCGGACAGCCAAAGAGGTCTGAATTCTTTCGCCCCGGGCCCCTATCTAATTC
CGGACTGCCGTAGGCCTGGGAGCACACTGGCGCAACTGTTTTTTTGACTAGTTTGGGCTC
ACCTTCCCTTCTCCTACGTCCCTGATAAGTGGCGTTCAGAATCACCAGCCAAGTAAGCCG
CAGATGTAAATAAATGAATGGAAGCGGGTAGAGTCCGTGGATTTATTTGCCCTTCTGTTC
CGAAAGGGCCGGTGCCATCTCATCTGGACCCGTAACAGGCGAGGTCTGGGCGAGTTAAGC
AAACGTCAGCCTTGTGTCCTCATCTCAAGGCCGTACTTTTAGTTCGGGGAGCAGGGAAGC
CC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 14678..14785, 15103..15201, 19738..19806, 19901..19955, 20855..21058, 22768..22936, 23692..23818, 23927..24037, 27467..27637, 28105..28232, 29426..29666, 31188..31308, 32258..32379, 32595..32746, 39423..39573, 40932..41133, 42311..42442, 43936..44060, 45847..46133, 48257..48335, 50298..50525, 50669..50809, 52364..52543, 53928..54044, 54370..54481, 54696..54772, 55042..55219, 56582..56712, 59569..59865, 60592..60732, 60814..60918, 61341..61460, 61894..62085, 64287..64429, 64884..64992, 65096..65265, 65810..66041, 68475..68723, 71077..71240, 71528..71645, 72176..72277, 72604..72777, 72829..72840
1001..1102, 14678..14785, 15103..15201, 19738..19806, 19901..19955, 20855..21058, 22768..22936, 23692..23818, 23927..24037, 27467..27637, 28105..28232, 29426..29666, 31188..31308, 32258..32379, 32595..32746, 39423..39573, 40932..41133, 42311..42442, 43936..44060, 45847..46133, 48257..48335, 50298..50525, 50669..50809, 52364..52543, 53928..54044, 54370..54481, 54696..54772, 55042..55219, 56582..56712, 59569..59865, 60592..60732, 60814..60918, 61341..61460, 61894..62085, 64287..64429, 64884..64992, 65096..65265, 65810..66041, 68475..68723, 71077..71240, 71528..71645, 72176..72277, 72604..72777, 72829..72840
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved