Ornithorhynchus_anatinus Locus ENSOANG00000008713
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000008713
Ornithorhynchus_anatinus
ENSOANG00000008713
Ultra519
SNORD17, SNORA36, SNORD17, SNORA56, SNORA56
3994..4237, 5094..5227, 6427..6669, 7179..7311, 8805..8936
12780
GCTGCCCCCATCACGTGGCGCCGCGGCCTTGCAAATGGCCTTTTCCTCCCTTTTCCAGG
CCGTTGCCCCCCCGCCTTAGCCGTTTTATGGGTTGCAAGAGGGAGCGAGCAAGGGTGGGG
AGCGCGTTACGAGAAAATGCTTCGGCAATTCCCCCCCCCCCCCCCCCCCAAGCAGGCCCA
CCCGGATGGATTTTAAAACGGGGAGGGCATGGTGTGCCCTTGAATTGTGCCTGAAACTGA
CCTTAAGAAAAGGCCCGATGGCGGGAGGAGAAGGAATTGCACCTAAATGCACCTAAAACC
CCGCCAAGAAATAGGGAGGGAACATCTTGCACTTGGCCACGTTTTGTGCCGGCTCCGCTC
CCCTCGTGATTTGGTTGTAGGTGAAATAATAATAACGATGGTGTTTGTTAAGCGTTGACA
ATGTGCCAAGCACTCTTCTGAGCACCGGGGGAGATGCAGGGTAATCGGGTTGGCCCACGT
GGGGCTCACAGACTTGACCCCCGTTTTGCAAATGAGGTAACTGAGGGGCAGAGAGGTGCA
GTGGCTTGCCCAGGGTCACACAGCAGACACGTGGCTGAGCTGGGATTAGAACCCGCGTCC
TCTGACTCCCAGGCCCGTGCTCTTGCCACCAAGCCACGCTGCTTCTACCTGTGCGGTTAC
TCCGGACTGGGAGCCGTAGCGACGATCAAACCACATAGCAGTCCACCGTGTCGGTTGATT
GGTAACCGGACCGGATTTAAGGGTCACCCACGGCCCCCCCTTTCATTTTCAAATTCCCTA
GGAGTTGAGGTCGGAAAGGGAGTAAGGAATCGTTGCCCAAGTTAAGCCCATTTGCAGAAA
CCTGCAAGCCAAAATAACGACCTGGAAAAAAGCCAGAGTGGGGAGACGATTTGGGCTTAA
AAAAAAAAAATCTCGGATGAATCGATACAATGATTATTTCATTTAATTCATGTTTATTTC
ATGTTTAAATCGATCCCCGTGCCACGTGGTGACTGAGAATGTGCCATGAAGCACGTGCTC
AGTCCGGAGTGAGGGTAAACCCCTGCGATCCTTTATCCCTCTAGTGTATGTTTAAGGGAA
AGCCGGTGCGTCTGTGGTTGTGTGGTGGTTCGGCTTTATGGAGAGTAATATTGAGATTTT
TTTTTTCTAAATAGTTTCTCTAGCGAAGAAGCACAAGAAAAAAAAAGACCGGAAAGAATT
AGCAGATGAAGATGTTGCTGTGAGTATTTGATTTCCAATTCCTTGAATCGTGTATCTGTT
AAAAGTAAATTTATTGACTCACTTCCCCAGTAGTTGTGTTTTGTTCAAGTGTCAAGTCAG
TTGTTTATTCCCACACTTGGCCCCGGACACATTTGTGCTTCTACCTTCGTGATCCATGCT
CCTTTTTAATGATATTTGAGTGCTTGTTATGTTCCTGGCACTGTTCTAAGTGCTGGGTTA
GGTACAAGGTATTGAGGTTGGACACAATCCGGATCTCATGGGGCTCACAGTCTTCCCGTT
TTACAGAGGAAGTAACAGGCGGAGTTTGTAGTACTATTTTTGAAATAACCTTGTCTATCT
GTGGACTCCTTGCGTCTAAGGATTGTTTTTGCTTCAGTTTTGAATCAAGTGCATAATAGT
TGATTGGGATTCAAGTATTCAGTAAATACTACTATTGGTTGTTTAGTTTTCAAAATTAGA
GGGGAGAGACTCCTTTATAAAAAAGACAAGAACTGGAAAAGGAAGCATGTTAAAAGTGCT
TACTGTGTGAGGAACACTGTACTAAGCAGAAGGAAAGAATACATAGGTGACAGGCACGGT
TACATTTTTTTCGTGGTATTTGTTCCGTGCTTGCTATGTGCCGGGAACTGTATTAAGCGC
TGGGGTAGATACAAGCTAATTTTTACCACCTGTAAAAAACAGGGATTTTTTTTTTACAGG
TTGAGGTAACTGAGACACAGAGAAGCGAAGTGACTTACCCAAGGTCACACAACAGACAAG
TGGTGGAGCTGGGATTAGAATCTAGGGCCCTGCTCATTCCGCTAAACCATGCTGCTGCTC
AATAGCTATCATTAGTATCATGTATCATTGATATTGATATCAGTTCTATCAGTATTAATC
CCAGTTCCCCTTAGACCTCTTGCTTGACGCATAACCTCTATAAGGTCCTTTTTGTATTGG
CCCTCCTACCCACTTAAGAAATGCTAGGCATAACCAGATAATGGAGTTTAGGATAAAATG
AAAGTTCCATGCTTATTGACGTGGGCCTGTTTTTGTTCCCTTTTCAGGAAATACAGCACA
TGGGTGAATTCTTCATCAAGCCTGAATCCAAAGTGGCTCAGTTGGACACATCTCAGTGGC
CCTTATTGCTAAAGGTAGAGAATTATGTGGAATTTGTGTTTGAGGTGCACAGATGGTCAT
TCGGCGGGGTGGGACGGGCGGTTTGTCATTCTTAGGTGTTGGGCCGTTACGCAGTCTAAA
CTAAGACAGGTGATTCGGGAACAAAAACTAGTATCAGTCTGTCTCGATTTTTTGCATCGT
GTCTTGCTATGTAGTAAGTTTAATCGCCTGGCATTTTATATGTGGAATGTACAGTGGATG
GGGAGAGTGCTACCGGAGAAAGAGAAAAACAGGCTTTTGTCAAATTTTAATTTATGCCTC
TATCATGTTTTTTAGAATTTTGATAAGCTAAATGTACGAACAACGCATTACACTCCCCTT
CCATCTGGATCCAATCCTCTCAAGAGAGAAATTGCTGAGTATGTCAGGTAAGAGAACTTC
CTTTCCCCTCCCGTGTTACCTATTTACAGTCATAGGATCTTGCGCTCAGCATGACCAGTA
ACTGTAATCTTGCCTTAGCTAAAAGAAAAAAGTGAAACAGGATCAGGGCTCTTTATATTC
GCTGACCCAGACCTGGCTTGAGGAGTAATTTCACAAGACTGATGTTCTAGTCGTCATCCT
CGGACGATCTTTAGATCTTATGCCTGGAACAAGAAAAGGCTTACCGATCTCTTCCAAATA
TCACTGCAGGACCGGCTTCATTAACCTCGACAAGCCCTCCAACCCCTCTTCCCATGAAGT
GGTCGCTTGGATCCGGCGAATCCTGCGGGTGGAGAAGACAGGACACAGTGGAACTCTAGA
TCCCAAAGTGACGGGCTGCTTGATTGTCTGCATAGAACGAGCTACCCGCTTGGTCAAATC
CCAACAGAGTGCAGGTATGTCGACAGTCTGGTTGCAGAAGTGGCTTTCTGAATATGGCAT
CGTTACTGGAGACTGTTAATCGGATTTCAGAGAAGCAAAGTTCCACTCCGGTTCTGTGGA
ACTCTCAAAAATCAACTTCTTATCCAGTAGAGCACAGGGTAAAGTATTTTAACAGTGGCC
ACTGTTGGAGTGGATTTGCGTGTTTAATACGAACGCTAGTTATTTAGAGTGATAGTTACC
CAAATTGATGTTTTTAGTGTTCAGGTTAAGATCTTGGTCACGCTAAATCTCTTGAATGTT
TGCTGCGTGGTGAGTAAACATTAAAACAAAAACTCGAGTGGCCACTCCTGACTACTCTTC
TGTCGTTTTTCAGGCAAAGAGTATGTGGGAATTGTTCGGCTGCACAATGCCATTGAAGGC
GAGATTCAGCTTTCCAGGGTAAGTCCCGATGAAATGGCGCTTAGGTTTTCCTCCGTTCCC
GGGAAGTGTGAGAGCAGTGCAGGGTGGCCACCTGTCATTTCTGTAGGAAAATATCTCCTT
TGTGTCCGTGTCCAATTAGCCTGGCTGTTAGCTAGCGGGCAGCTGAGCAGCAGTGAAAAT
CAATCAAGCTTAACTTTCCCAGGAGCCCCTTCCCCACCACAGACTGCCCTTTTTGCTGAG
AAAGAAGTGCAGTGTTTTGCACACAGTAAGTCCTCGACAAAAACGATTGAATGCAAGAAG
GGAGACCGCCGCTTAACCTAGGAGCGATTAGCACCAAGTTAGAAAGGTGCCATGGAGGAC
CGAGCGTCTTTATTCACATCCTTCCTCCCTGTACGTGACATGATGATGAAGTTTATCCAT
TCTCTGAGCTTGCAGACTCTGCCCTCCTTCAGCATCGAGGTTCCTGTTCTAGGGCCTCGG
TGTTTCGCGGCCTTCTGTGCACTCCAGCCTTCCAGTGTTCTACTGGGGGTGCGACCGTGT
CCGGTTGACTGCTTGAGGGTGTGGTGGAGTTAGCAGGGTGGGAACCCCTTCTGGGGGGAT
CCCATCTCGGCAAAGACGAATGATGGGAGTCTGATCACGTACTGTGGGTAGGCTGGATTT
TTGCGAGGGATATGACTGCGATGGGGCATTATGGAAATGCGGCGGAATATATTTGGCCCG
GATCAGGGTTGAACACAGAGCTGGTTCGGAGATCCACCTGAGCACTTTGTACTCTGCTTA
TTACCCTAGCAAACCCATCTTATGCTTCGCTTAGATTAGTCACCTCCTTACACATAGTTG
TTTTCTCAGACAGATCTGGTTTTTGCAGAATGATGTTTCTCTTCTTCCTTAGGCACTGGA
AACTCTCACAGGTGCGTTGTTCCAGAGGCCACCGCTCATTGCTGCTGTCAAGAGGCAACT
ACGGGTCCGAACCATCTATGAAAGCAAAATGATCGAGTATGATCCTGAAAGGAGATTAGG
TAAAAAGGCCCGTTTTTTAGGAGAAATTAACTTAATGGCGCCACAAGATGCATCCCTTCG
GTTTCTATTGCATGTAGTTCAGAGCCACATGATGAACCCTGAGACGTCACTAGCATACCG
TGCAAAGATGACTCACATCTATCACCCAAGACTGATGGTTCAAGCTGGGAACGTTGGGCT
CGTTTACGCTTGTGAACTGGGAGGAAATATTCAGCCTTAATTTTCTGTGTCTTGTCTACA
TCTGCCTAGGTATCTTCTGGGTGAGTTGTGAGGCGGGTACGTACATTAGAACCCTGTGCG
TCCACCTTGGCTTGCTGCTGGGAGTTGGAGGTCAGATGCAAGAACTCCGAAGGGTCCGCT
CCGGAGTTATGGGAGAAAAGGTATGTATCGAAGTCCCCTAAATTCCTTTTCAGAATCTTT
AGGAAATTCACATCCTCTTGGTATGTCATTCCAAGTGGATAGTGATTCTGTAATCTCCAA
AGTGTTGAGTTCAGGTCAGGGTTTCTCCCCTGTTCTGGTAATTTAACTTTGGAACATTGG
TAATGGCTAGAGGAAATGAAAGGGTGGAGAGTGTTGCTCTACCCGTTTTTACCACCTAGC
GTACAACCGTCACTTTTTCCTTATTTGAAATAACTGGGAACCGTTGGTTGAAATGGCAAA
AGCTGCTACTCACTGAGGCTGGGAAGTTTTCTTCCTCCTAACTCTAGCACAGTTTTACAT
GTCCTCCCATTAGAAAGCCACCAAATTTCTCTTGGTTTCTGTTGGCAGGATCACATGGTC
ACCATGCATGATGTTCTAGATGCTCAATGGCAATATGACAATAACAAGGATGAGAGTTAC
CTGAGGCGGGTCATCTACCCTCTGGAGAAACTCCTGACCTCCCACAAGCGACTAGTCATG
AAAGACAGTGCGGTATGTTCTCCAAGGCATGTTGATTTAGTCAGCTAACTCAAAAAAAAA
AAAATCCCATAAGGCCGTTGCGGTTGCTGATCAGCCCTCAGCTCCAGGTTTAAATCAGAC
TATTTTGATCATTCTTTTATTCCTGGGAGATGAAGGAATTTATGAGTGAGTGTTGGATGC
TGCTAGTGTGCGTCCTTTTGAATTATAAACTGCTTATATTGATGCCTGTCTCCCCCTCTA
GACTGTAAGCTCGTTACGGGCAGGGAATGCGACTGCTAATTCTGTAGTAAAGTAAGTGCT
CAGCACAGCACTCTGCACATAGTAAGCGTTCGGTAAGCACCACTGATTGATAAAAGTAGC
TGGGCTGTGTCTAGCCTCTGGAATTCCTTTGCACAGAGGGAAGCTCAGTTTTCTGGCAAC
CCAGTTACTCCTCCCCCACCCACCAGTTCCAATAGTGTCTCGTGAGGTAAGGGGGATTTA
TGCTTTTCTCATTTTAATCCACAGGTCAATGCAATCTGCTATGGGGCCAAAATTATGCTT
CCTGGAGTTCTGAGGTATGAGGATGGAATTGAAGTCAATCAGGAGATTGTGGTCATTACT
ACCAAAGGCGAGGCCATCTGTATGGGTAAGAGGACATATTTCTTGTGAACACCCAATTCT
GCAGTACTCTGCAGTGTCAAATGAGCAGAGATGGTGTTAAGCATTTTTTACACAAGTTCA
AAATGAAACTTAGAAGGCTCTTCTGGAGAACACTTGACAGTTCTGTAAACTGAAGCCCTG
CTTAATGCCTAACTTGCCTGTGCATTTGGGTTAGCAACCCCCATTAGTGATCTTTGCTTT
CCATTCCCCAGTAAACTCTTCTCTCCTGGGTGTCCGCTTTGGGATTTGAAATCATGTGGC
TCTCTGTGTGGAATGACAGTTGAAGTTTATCCATTCTCGGAGTATGTCATGCTACTCTTC
TGCAGCACCAGGTTCCTGTTCCAGAACCTCCGTGCCATGCAGTTTCCAAATGCCCCTTGT
GTCTTGTGGTGTTCTGCTGGAGACGGCTGGTGTGTGTTTGGTGTCTGCCCGCGGGAGAGG
GTGGTGACAGCAGGAGTGGATGCAAAGATCCTGTTCCATCTGCAAAGATGAACGGTGACA
GTCGGATCAACCTCCTGCAGCCTTTAAGCTACTGTTGAATCTAGAGACCCCAGCCACAGC
TTTTTAGGGCAGGTTTAGGGTTCTCAGGAGCCACCCCCACCCCTTTTTTTTGATACTGAA
TTATAGACAATGAAATTGTTTGGCTGCAGTTAGTATTCTGGCATCATTGGGGCGGCACCT
CATCTCGAATATCTTTGTTTTTCTTGTATAGCCATCGCCTTGATGACCACAGCCGTTATC
TCTACCTGTGACCATGGCATAGTGGCCAAGATTAAAAGAGTGATCATGGAGAGGGACACA
TATCCTCGCAAGTGGGGCCTGGGGCCAAAGGTGAGTGGATCAGATGAGTTCAGCTGAGTT
CATTTGGTTCTTTACTGAAAACGATTTGGTCCGTGTTTTCAGTGGCCTCTTGTTGAGTGA
CAACCGGACATGTGCATGTTGGTACACTGGATTTCTCTGCCAGTTGTGGCTTGAAGTGCT
TTGGTGACTTGGCTCTTGAACTCTGGCTCTGTCTGGTGGAAGCAGGCGGTTATCCCTCTC
TAGCTTGATCGGGTGGCTCTAGAGGGAGTCAGTCTGCAAAATCAAATGGAAGGCCCTGTT
TCTGTCCAGCACCACAGTGCTTTGGTGGTGGTTGCAGACCTGCCATATATGGTCAAACAC
CATAGAGAAATTCTGCAAATTTTTCCCATCTAACAACGCCACGTCGTCATTTTGCATTTA
AGCGCTTACCAGGTGTCAAGCCCTGTCTGCAGTACTGAGGACGATAGACGATAATCAGGT
CAGGCAGAGGGCTCACTAAGGAGGGAGAGCGAGTACTGAGTCCCCATTGTGCAGATGAGG
GAATAGAGGTCCAGAGAAGTTGAGTGAGTGGCTCAGGGTCACACAGCAGGCATGTGGTGG
AACTAGGATTAGATCCTGACTCGCAGGCCTTCCTTTCCACTGGGCTACGCTGCTGTTTTA
ACCAGTATCGGTGTGTATGTTACTAGAGCTTTCAGGATTTCCCTGGTGGGATCTTCTGAG
GGTGCCATTCCATTCTTCCCATAACTGACCCCAGGTTGGCTGTGGCTTAAAAAGACTTAT
ATGGCTATTGTCATTATTCCCTAAGGCATTCGGGGGATCCAAGGGTTAGCTTACTCATTC
TGAAGGCCGTTTAATCTACGAAGCCTTTGTCATGTTATTTAGGGTGTATGTGGCACCCTG
CCCAGGCCCTTTTTTTTAGCGTTTTTCTCCTGAGTACACAATCTCTGTTACTTTAAAGAA
GAAACTTTTCCAGTGCTTGCATTTAACTGAAATGTCTTTGGGGTGACATGTATGGAGATG
GATGTCACAAGTAGGAAATCCAAACAGGTTTTCATGCCAAGGTCTTCTAATGTTTTGGGG
CTTTTCAAGTGAGAAACAGGCTGAGCGTTCAGTTAATACTAGTGAATATTGAATGAATGA
AAGGAGCTTATGGCCTAGAAAGGGAGAGGCTCTCTATTTAATGCTCAGAAAATCGTTTTG
AGTCCCTCAACTGTAAAGAATTAAAATGAGAACATGATGTTCTGTGTTTTTCAGGCAAGT
CAGAAGAAACTGATGATCAAGCAAGGTCTTTTGGACAAGCACGGCAAGCCCAACGAGAGC
ACCCCAACAACTTGGAAGCAGGACTACGTGGACTATAGGTAACGGCCTGCCTTTGGCTTG
GTGATATTGTCAATCAAAAATGTAAAGCTGAGGTCAAGTCTAGAATTCAGTGGGACATCA
GGGCATTTCGATGAATTAAGCAGCCGTTGAAGTGATTGTGTTGAGTGCAGGGCATATTAG
CGGTAGCTAAAGGCAGGAGGGTGTTCCCGTCGGCGTGGCTTAGTGGAAAGAGCACGGACT
CGGGAGTCGCAGGCCGTGGGTTCTAATCCCGGCTCTGCCGCTTGTCTGCTGTGTGACCTT
GGGCAGTCACTTAACTTCTCCATGCCTGTTACCTCATATGTAAAGTGAGGATTAAGACTG
AGCCCCACATGGGACAACCTGATTACCTTGTATCTACCCCAGCACTTAAAACAGTGCTTG
GTGCATAGTAAGTGCTTAACAAATATCACCACAGATACCACAGATATTATTCTGAGGGTT
TGGGGTGGGTGGGCAGTGTTCATGGGTGTGTATTGGGTGACAATAAGGCAGATGGTTATC
CCTCTCTAGTCTGATCCAGTGTCTCTAGAGGGAGTCAGTCTGCAAAATCAACTGGGGGCC
CTGTTTCCGTCCAGCATCATGGTTCTTTGATGATGGTTTCAGACCTGCCATACATTCCCA
AATGAATTCTGGACTGTATAGGATTATCCAGTGATGGGATTTGGCTTCAAGAAAGTGTTG
CATTTTTTTCCCCCCAGAGCAACTGTGAAGAAAGAACCAGTAACCCCAGTCACTCCAGTT
GCTCCAGTTGAGGTGGCCAAGGTACAGAAGGTGAGTGTCTTTAAGTGACCTCTTAACCGA
GCCATTGTCTTTCAAATGTGGGTGTAGGGCTAGAGCAGGGGTCAGCAATGATTTTTGACT
CCTTGACTTGTTGGAGACATCTACTGGCTTACGGTCAGGGGAGAGACCTGGGTAGCTTGT
GGCTACCTTGGAGACAGATAGATCTGTTCATCTCTAAACTAGGAGATAAAAGGGGCAGAA
AGGTCACCTGATCAATCCTCCTTCATCTAAATACACTTGGGACTCTAGAATGGAGTCAGT
CTTTAAAAGGAAGTTCCATCTCTTCATTGTAGTTACCTGACCAGGCTAATTTTTTTGATT
CACGTCTTAGATGTAGATTTCTGTGGTGTAGATTTCTGGATGTGGTTGTATCCGTAAAAG
TTTAGGGACTTGGCGTGAGTAAAGTTGAAATACATAAACACCTCTTGGGACAGAGTCCCT
AGGTACTTTTAAATAAGCCTTCCTCAATCATCTTAATGTTGGGATATATTACAAGCAGTA
GTGTTAGATGTTTTTTCAGAACCTGGCACTTTGGGGGAGTCAGCACATGCTATGGGTTGG
GATTTTTTTTTTTTTTGGTCTGACCGAATCTATTGATCTGTTAAAACAGAGAAAGAGGGA
GAGCGGAAGTGAAAGTGATGAGGCAGCTCCATCCAGCCCAGTTACTCCAAAATCAGAAGA
AATGAGTAAGAAGGAAAAGAAAAAGAAGAAAAAGGAAAAGAAGGCTAAAGAAGCAGTAGA
GAGTGGAGGCGAGTCGATGGATGTGGTATGTATTATGATGAAGTGGTTAAGTAGTAAAGT
AAACTGAAATTAGAGAGGAAACAGGGAGAATGAGGAGGGCCAAATGGTAAACCGTAACAC
ATTCCATTTGTTATGTACAATTTTTTATATATGCATATATACGTGAACTTAAATGTGGCT
GAAAGTGAAGCCAGTGGTTTAGAAACCTTGGCAAAGAGGGCCACAACGGTACTATTGTAA
GCACTATCGATTGTCAATCGAGAAAAGTAAGTCTTTGTTGAATTTATTCCTTTCAGGGCA
GCGATAGTACCAAAAAGAAGAAAAAAAAGAAGAGAGCAAAAGAAGCTGACAGTTCCGAGT
GATGGGGAGAGATCATCCATCACTGGAACGTATTGTCTGTTTGGATGAAACGAATTTTGA
GGCCTTAACCAAGGGTTCGTTCCCACAGGAATGGGGAAAGATGCACCACAGGAATGGACA
AGGAGGTGGCATGTTTTTTGCTCTGCTACCTAGATTATATAGAGCATTTGGTGGTGTAGT
GCAAAATGGTCATCCCCTCAACATCCTGTTTTAAGGATCTCTGAGGGGCGGGTGAGAAAC
GTCCCATGTGTTGGACATGTCCGTTCTCCAGTTTAGAGCAGCTGGAGAAATCTCACATTT
TTTGAAATACCCTGAGTCATCCAACTGCTGCAGCCCGTTGTCACTTTTAAATTTACTGAT
ATTTTATTGCATTTCCATTGAATGGGAGTATTAAAAAAAGATCTCACCTGCCTCTCTCTT
CTATTTTAAAAGATTTGTGAGGTAGATCTGCAAAGGTTGTGTTTTTGTGTGAGTTCAGTT
TAAATGAGCTGAGTCCCTCACGGAAGGGGAAGAGAAAAGGTGATGGGCAGCACCAACCAT
ATTGTTTCAGGTCAACAAACTATTACTTCTACAGGTCTTTGCAAGAATAACGAACCGGTC
CGGACTCGTGTATCGAAAGTGACAAAGCAGTTGTCATTTTGGATGATGATGTTTCACTGT
CACTGTCCTCATGCTTTGTTCAGATCGCACCTCCTGGTGGAAATTGAGGGTCTTTTTTTA
AAGAGCCATTTTAATGCATCCTACAGAGCGAATAGGAATTTACATCAGCTTACTCGTAGT
TCTGACCACGATCTCTCCCAAGTGTGTCGACAAGAATGCACTACTTTTGCATTTGGGTAA
AATCCTTTATGTCTGGAACTGTCCAATGTAATCCCCTTAGTCTATTTTTGTTCCTGTCCA
AGTCAAGAGGTGGGAAACGGCTAATAATGGTTGTCCCATATAGGGGGAAATTGGTTACAA
TTTTTGTTTACTTTTTTATAAAAAAAATAAAAAACCTAATTTGTAAAAATTAGCGTGTCC
AGCTGTTGGGAAACAGTGTGTTACGGTTTTGCTCGATGAGCGGTGTGAAAATGAGGCTGT
GGTTTTCAGTTTTATTCTTGGGTACTTGACACACTTGTGTTTTGTTTATAACCTACAAGC
CTTCTATCCTTAATAGTTAAAGGAAACGTTTGCTTTTGTGGGATGCGGCCATATTCTTGC
AGAGAGCACTCAGAAGGAACTGAATTTTTTCAGTCTTCATTCCTGGGATCTTATCACCTC
GTATTGTCAAAGCAGTGAGTAGGACCCCTCCGTCGGGGCTTTGGGTAGCCGGTGGCAAAG
ACTTTACCGATACTGAAAGCGCTAAGGATGAGGGTCAGCCAGTTAGGGAGTGAGGTAAGA
TGGAACTGTGGTTTATCCTCTCCCGGAACAGCCTAGCCTCTGTTAGTTATGGGTGGTGGG
AACTGGCAGCGGAAAGGGAGACTGGGTTCAGGACTCATTCTTCATTCAGTCGTATTTATT
GAGCGCTTACTGCCTGCAGAGCACTGACAGGCGCGGGGGAGAGTATAATATATAGACACG
TTCCTGCCCTAACTAGCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTATGTAGG
TACAGTGATAGAACTGCTTGGTGATTCTAGACCATAGCGGTCCGATGGCTGTTTGCAGTC
TCCTCTCTGCCTGTGGAAACGTGACTGCAGCCGTCGGGCCGGAGGGCCCGGGGCTCACCC
GCTGCCGGGCCACTGGCTCTGGGGGAAGCAATCATCTGTAGAACAGTGCTTGACCCATAG
TAAGCGCTTAACACATACCATCATTGCCACGAGAGGAGGTATTTTGATCATTCAATAGTA
TTTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGCGCTTGGAATGTACGATTCAGCAA
CAGATAGACAATCCCTGCCCAATGACGGGCTCACAGTCTAATCACCAGCCATTCCTCATA
TGAACACATCCAGCCTTTTCTCCAACTAACCACCACCCACTTCTGGGGAAAAAAGGGGGT
GCCACATCTCCATTAGCTTTTAGACAGCCACATTTTTATTGCTACTAAAGGTTTCCCTGC
AGTGGACTACAACAATGTCCTATTGCACATCGTATGGTTTTTTGTTTTTTTTTTGGCATC
CTTAAAAATTGCACAACACACATTTTGCAACATCTCACTGGAGCCACCACCCTTCCCGAA
GCAAAAAGACACAAATGGAGTCAGGTGCCTTCGTTCCCAACGAATTGGAGTTTGAGCAAG
ATGAGCCATGGTCCACTGCAATTGCTTAACGGCATTTGAAAACACAAAGCAGAGCATGGA
TCATAGAGGATGTGTTAAGGGTACTGTTGGACTGTTGCATCGATGTGAATTCTCATGAAG
GATGGGCAGCTGTCCTGCAGTTGGTAAATTGTGCGTGGATCATCTCTCCTAAACTCATTA
G
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1218, 2267..2353, 2655..2746, 3009..3193, 3553..3617, 4492..4621, 4872..4999, 5388..5531, 6024..6144, 6871..6989, 8214..8317, 9017..9089, 9709..9864, 10136..11780
2279..2353, 2655..2746, 3009..3193, 3553..3617, 4492..4621, 4872..4999, 5388..5531, 6024..6144, 6871..6989, 8214..8317, 9017..9089, 9709..9864, 10136..10201
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved