Ornithorhynchus_anatinus Locus SLC25A3b
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus SLC25A3b
Ornithorhynchus_anatinus
SLC25A3b
Ultra443
SNORA53
3422..3670
5810
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCTTGCCTCCTAGT
TTCAGTCGGCAGTTAAATGCAGGAGGGGCTCTGGAATGACACATGGAACGGTGGACAGAA
GCTAGTGTTTTTCAGCAGGGGTTAATCCCCATTTGTTTTCAGCTTCCAGTAGCTTAAATG
TTAATAACTGATGAAGACAAAATGTACTTCTTTTTAACTAAGCAGAAGAATATAGCTGTG
AATGTGGATCTGGCAGATTCTTTATCCTCTGTGGCCTTGGTGGAATTATTAGCTGTGGTA
CTACACATACAGCACTGGTGCCCCTAGATCTGGTTAAATGCAGGATGCAGGTTGGTTTTG
CATGTTACAATGAACATATTCGCGAAGCATGGATACTGGTGTGCTAAATGTATGTATGAA
CTAACAGGTTGTGAAAACCTATGACCAACAGATAAACCGTTTTCCTATAACGTATGATGT
CTTTCATTAAAAAGCATGGCGTGTCTTGTTTTTGCTACAGAATACAGTTGTGAATATGGC
TCATTGAAGTATTATGCACTCTGTGGCTTTGGTGGGGTCCTAAGTTGTGGTCTGACACAC
ACTGCTGTCGTACCTCTGGATTTAGTGAAATGCCGCATGCAGGTTTGTATTTTGAAAAGA
CAGAGTTTTGGAGTAAGATTTGGAGTATCTTAATGTGTTGACTCAACATGCTTTCAAAGT
CAGGAGGAGAAGAAAACTAAAAGAGTTCTAGGTATCTTGACTGGATATTAGTTATTGTAA
AGGGAAAATACCAAAGCATATTGTCAAGTAAGCTTTGAGTGACCTTTGTGCGGGTGACTT
CCTTTCCGGCTGCCCTTTGCCTTAATCAAGAGAACTGAATTCTGACCCTTAGTCCTACCT
AGGTGTGTGTTCCTCCCTGCCCACCATCTTGTCTAGAGTAGGATTAATAGCCAGGTGATA
ACCAGATAAGAAATCAGTCGCCAACTGTGGATAGGTTGTCCAACAACCCTTTTAGAGTAG
TGGGCTTCCTTAAAGCCCTGAGGAGCTGCAAGAGTAAGTGTTCTAGAAGTATGTAAATCT
AAAGGAAAGCTAACCCCCTTCATTACAGAGATGCTTTTCTGGGTCTCATTTCATCTTTGT
CTTGGGTCCCCTTACTGTGGTTGCCTTTTCTGCATAGTAAGGCATTTTAGATCATTTTTT
ATTTAAAAGCATCTATCCTGAAGGCAAAATAATGAATTATGAAAAGCATATTTGTCTCAA
ACAGGATTAGAAGTCCACTTACCTCTAAGAGAGGACGGAGAGGCCAGCAGTATGGAGCTA
AGAGCACTTGTTAGAGAATCAGGTTCCGCAAGCTAAAGAGACTTTTTAATAACCTTGATT
TCTTTATTAGATCAGGAGTTTTAGTGTTGAAGATGCACCATTTTAAGCAGTGAATCCAAT
TTGAGTGCCCGAACTTGACCAGTGGTGGTAAAGGTGTTAGTTGTAAAAGTCAAATTTAAT
AAACTAAGAGTAACTGGTCGCATTCAATAATGGCTGTAATTGGGAGCAGTTTATGACTGT
GGTGTGATTGCCCAGCAGCTTGAAGTGCCAACTGCTTGGTGTGTTTACTAAAATGTACTT
AGTAGTGCTGGGCTAACTGCGTAACGCTCAGCCATTAATCCCACGTTAGCAAACCACTAG
AAAACTGAGGGGACAGAAATGTGGGTGGCCTGAGGGAACCAAGCATCCAAGCTTGAGTTC
ATTACCAGTAAGAAGGAAAACCGCTTTGGACTTGGTGTCTTGCGTATGTACGGTTAAAGT
CGCTGTTTAAAAAAAATCCGATTTTGATTTTATGTATGTTCTCTGAAGGTGGACCCCCAG
AAGTACAAAGGCATCTTTAATGGATTTTCAGTCACACTGAAGGAGGATGGAGTTCGTGGA
TTGGCCAAAGGATGGGCTCCAACTTTCATCGGCTACTCCATGCAGGGGCTCTGCAAGTTT
GGTTTTTATGAAGTCTTCAAAGTTCTTTATAGCAACATTCTTGGAGAGGTAACTCATTGT
AGGTTAATTTCCTTTTGAAATTTGAAACGTTGACACCGAAATACAGCTTAAAAGTGATCC
TTAAGGCCAAAGTTTCCTCTTCTTTCCCTTCTGTTTTTCACTCCTCCTTTTTATATTTCA
GGAGAATACTTACCTCTGGCGTACATCACTTTACTTGGCTTCCTCCGCCAGTGCTGAATT
CTTTGCAGATATAGCGTTGGCTCCAATGGAAGCTGCTAAGGTTCGAATTCAGACCCAGCC
GGGCTATGCTAACACTCTGAGGGAAGCTGCTCCCAAAATGTTCAAAGAAGAAGGCCTATG
GGCGTAAGTAATCATCTGGGACTTGCAATTTTAAAAGCCTGTAGGTTTTTATGACATCAG
CCTCTCCAGATCTGCCAGCAAACCAACTGGACTGAACTGAGGGGGATTATTCTTCTGTCG
TGGTGGTCTCATTTTTCTGTACTGTGCCTGTGTGGGCTTTGTTGAAGAGCAAAACTGAAC
AGAAATCCCTTAACTCCAAGTCAATCTCTAGTGGTGTGACCTTGATTATTTCAGTAATGG
ACGTGGGGGTGAGGCCTTGTTTGAAAGGCCTCCTTAGCCGACCCTACCAGAATTAAGAAG
ATAACATGCTTCCTTAGATCCACCTTTGTGGTTGCCCACCTTGAACTGAGTTCCGCCAGT
TAAACTCTTTGTTTCTGGTAGTTCCAGTCAAGAGGCATCCGGCAACTTCTTTGGTTGTAC
AGTCAAAGGTGCTTGAGTCATTGGCATGTAAGAGAAATATACCTGCATGTTAGTCATACG
TTCTGATTGCAAGTGACAGCAGCATTGCGTGTCATTTCTCACGATCAGAGCCTGACTGGT
GTGCGGACACTTCAGGTAAAACTCGGGGCCCCTAACTCTTTTAGAACGTTATTTTAAGTT
AACCGCTTGGACTTTTTTTAGATTCTACAAGGGGGTTGCTCCTCTATGGATGAGGCAGAT
ACCATACACAATGATGAAATTTGCTTGTTTTGAACGTACCGTTGAAGCTCTCTACAAGTA
CGTGGTTCCTAAACCCCGAAGTGAATGTTCGAAGGCAGAGCAACTGGTTGTAACATTTGT
GGCTGGATATATAGGTAAGATCGGTTGGAACGTTAAACCTATTTTCTGAACTTCTTATCC
CTTAGGCTATCGCTTGTTAAAATATTCCAGGAACTCGACCGTCCGTATTTGCATCCTGCA
TAGAACGAGGCAGCAGTTTTTGATCAGTCTTACAAAACCCAAACCCACTTCTTGGAGCTA
ATTTATTTTAAAATTAGATCTTACCAATGTGCATGGAGAACTAGCCCCCTCTCCCCTTTA
CTGGCAGGAGTTATTGTCTTGAGTGACTTCAGATGAGAAGCTATGAATGGCTCATTGACA
GTTGGCTTGTTTTTTTTGGGGTTTTTTTAAGCTGGTGTGTTTTGTGCCATTGTATCTCAC
CCGGCGGATTCTGTGGTATCCGTGTTGAACAAAGAAAAGGGCAGTTCTGCCTCTCAAGTT
CTCCAGAGACTTGGATTCAAAGGTAGGGAACCCTTTCAAAAAAAGTTCTTGGGTATGAAA
CAACCAGTTGTATTTATTGCGTGCTTACTGTGTGCAGAGCACTGTAGTAAGCACTTGGGA
GAGTACAAAATGTTAGACACGCTGCCTGTTACCTCTAGATTGTATTTTGCACTTCTCACT
CTTGTCATGTTTCATTGCTCTTTCCTGGGTCCACCAGGTGTTTGGAAGGGATTGTTTGCC
CGTATCATCATGATTGGTACCCTAACTGCACTACAGTGGTTCATCTACGATTCAGTGAAG
GTCTACTTCAGACTTCCGCGTCCCCCTCCACCTGAGATGCCCGAATCTCTGAAGAAGAAG
CTTGGACTGACCCAGTAGACAGATCGAGATAAACTATGGACTGAATCTGCTTGCTGATCA
GTGTTGAGCAAAGTACTTAAGTAAAAGAAACTTTTATATATTTGAAAATGTAGGCAATTA
AAAGTCTGTTCCTGATGTGATTAATGGTTGTGCCCTTGGCAGGTGTGAGGGCTTCTAAAT
CGTAACTGTTGCAATAAACAAACTATTCACGATTCCCGGCTGGTGATTGGATATCTTCAC
TTGACTTAAATTTGCAATCCGGAAGACACAATTTAAATACTTAGCCAGAGAGAGCTCACT
AAGGGAATTGTAAGGGGCCTGACTAATTGTACCAAAGGGTAAAGGTAATTTCCCTGCATG
CTGAAATAGTTTATAATCCTTATGTTGGACTCTGCTCCTATTCTTAACTAATCAAGTGAA
CCAACAGTGCTGCCTTTTACCTTCCATTTCTCCTTACAGTCTGAAAATGGAAATCCTTGC
TCCATTTTGAACCCAAGCCTTGCAAAAAAAAAAGTTATGATTTTGTGTAGAAAAGGGCCA
GATTACATTTGAAAGTAGATGATCGCAGGAGGGATGGGTTAAAAGCAGATGGGTCTGTCA
AAGCTTTTTTTAATGATTTAGTCCTACTAAACACCTTTGAGTGAAATTGAAGGAGATGTC
CTTGAATGTGGAATTTTTTTCTGTTTGAGTCATAATAGTTCAGGTAAAAACTTGTCTGAA
CATGAAGTGGATTATAGGATTCAGTGGGAATCTAGTCTAGCCTGTGGATTTCAGGCCTAG
AGGAAGATCAATATTTCAGGTGCTTGCGGTGGAGCTAGTTGACATTCCTGCCTTCAAGGA
GTTTATCATCTAAGAAGGTAGATAATTGTGGTAGGTTAAGTGTTATGTGCCAAACATTAT
ACTAAGCATTGGGAAAGATACAAGATAATCTTCCTTTCCAAGCTGCAGTTGGGCTGGAAA
TGAATCCACTTGAACCTTTTAAGGCTCCAGGGGTTGAGTGGCAATAAGAACTAGCAACTC
TATTGTATGTCCTAGACAAAACATAGTATGGCTTAACCTTCTGTACAGATGTACTTCTTA
GTGGGAAGGTATATGGTAATAATAACTGGTATAAAGTGCTTACTATGTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 2628..2807, 2941..3122, 3741..3911, 4229..4341, 4537..4810
1004..1129, 2628..2807, 2941..3122, 3741..3911, 4229..4341, 4537..4697
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved