Ornithorhynchus_anatinus Locus CLPTM1L
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus CLPTM1L
Ornithorhynchus_anatinus
CLPTM1L
Ultra43
SNORA13
5565..5697
28560
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCCTGGTTTCCTTCTAT
CCCGCGCTACTCCCCCCTCCCCCACCCACCCACCTCATCGCACGCTGCCTGTCAATGTCG
GTCAGTCGGGAGCATGTATTGAGCGCCCACTCCATGCGGATCACCACATTTAATGTTTTC
TCGCTTCGTTGACGTTTGGACCCTGCCCATCCCACCACCCCTCCTCACCTCCCCAACCCG
CCCGGGTCTGCACTTCCATTGAGTGCTTACCCTGTGCAGAGCACTGTACTAAGTGCTCGG
GAGAGTACCTTAAAACAGGGATGAAAGACAATCCTGCTCTTGGGGGTCTCCGTCACCTCG
TTTCTCTCCCAGCCCACCAGCCCAACTGTTGCATTTTCCCTGGGGAAAACCCCCTCTTCC
CGAGGGTCTTTCCTCCACTGCCTCCCACCTTCTTTCACTCCCCCAAAGCCCCTGTTAAAA
CACCAGCTTCTGCCAGTTGGGTTCCAGAATCCGTATGAGTTGTCAGAATGCCAGATGCGT
GCACTCCCTCTCTAAGCACACACACACGTGCGTAAATATCAATCATATTCATATTTAGGG
AGCGCGTCCTGTGTGCAGAGCACCGTACCGAGTGCTTGGCAGGGTACAATGTGACAGAGT
TGGTAGACACGTTCCCTGCCCACGCGTTCCCTTCAAATATTATTATTTTTAAAATTTGGG
AGGTCGTGTAGATTCTTGCCTTTACAGCGAATCTCGGCCAGATCTCAAGCGTCCCTCTTC
CACGGCCCTAGGTGACTCGTTTTAGGCGGATCTCCAAATAAAAAAGCCCTCATGTCCTGA
TCTGCCTCTGTCTGCCGTTGCTTTTCAGCTCAGCGTCTACACCACCACCCGATCGAATCT
CGGCGCTGAAACGAATATAGATCTGGTTTTAAATGTGGAGGATTTTGATGTCGAGTCTAA
ATTTGAAAGGTACGGTCGAAGTTTCAAACCTTTTTCTTAGTTCTTGTTTAACAGACTTCC
TGCTGTGTGACCTTGGGCCAGTCTCTTAACTCGTTTCAGTCTCAGTTTCCTCATCTGTAA
CATGGGGATTCAATACCCGGTCTCCCTCTTATTTAGATTTCGAGGCCCAAGTGGACTAGG
GACTGTGTCCGACCTGATTATGGGTCGAACCTCATGGGTTCGAATCCCGGCTCTGCCACT
TGTCAGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCTGGGCCTCAGTGACCTCATCT
GTAAAATGGGGATGAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTCTAC
CCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACATTATTA
TTATTATTATCGTGCATCTGCCTCGGCCCTTAATACAGTGTGTGACACATAATATGCACT
TAAATACTTGAGAAAAACAAGCCCGATTGTCATTTTCTCTGTGGTTCACTGTTGCTAGTG
ACCGGCACATTGAAAAATGATAAACCGTCTTCTGAAAGGCATTTAGTTTTGTTTTACCAC
ATCATTCAATCGGTTGAGTGCTTACCATGTGCAGAGCACTGTACTAAGTGCTCGGGAGAG
TACATTAAAACAAAGATGGAAGACAATCCTTGCTCCCAACAAGCTTGCAGTCCAGAGAGG
GAGACGGACAATAAAAATTACAGATATATACGTTAAGTGCTGTGGGCCTGAGGGAGGGAC
GGATAAAGGGCATAACTCAAGTGCAGAGGTGATGCAGAAGGGAGTGGGGAAGGCAAAATG
TGGGCTTAATCAGGGAAAGCCTCCTGGAGGAGGTGGTTAGTAACTTTCTAACTCCTGTAA
ATATTCACGTTTTACATAAATCAAGATGTATGCTTAAAGCAGTAAGCCAGAGTGCAAGGT
AGTAAGGTGAACGATTTAAAATGAAACTGCCACCCAAAGTTGAGAGTACAGTCGTGATGT
CGATGCAGGTTACCTACGAGAGAGTTTCTGGGATAGATGAGAGCTAGATTTTGGGGGGTG
GAGATCAATGTTCTAATACTACTAATGTTTGAGTATGGGCGGGACACTCTGCAGAGGGTG
GAGACTTGCCTTTTTAATGGGCTGGAGTCCATTAAATTATTAAAGATCATTCTAGAGTTA
CTTTCTTTAAGGAGTGTGGGATTAGGAAACCAAATCGAAAAGAAAACCGGCCACCAGAGA
ATCCCAGAGGTTCACCGTATTGTTGCAGTTGGGTGGACAGCAGGAAGGACTTCTTCATAT
GAGCGCAAAATTGTTTAAGGACAGTTGATTAGTTTCCTTCCATTCAAAGCATCAGATTTA
AGCGTGTTATAAAGAATCCCCTTTTTCAAGAATACTAATTACCTTTCATTTTTCTCCCAT
TTCAAATCTTTCTCATCTGTGTGTAAATTCTCAATCCTCCACGAATTTCTACGATAGTTT
AAAGAAGTTCGAAGTCTTCTCTCGTGGCTGTTAATATGGTTACCGTAACTCATCCTTTTG
ACCCAAAGGTGTTTTCCTTTTGTGGCAGAGAATTGATCACCACAAGTAGAAGTTCAAGGT
GATGTTTTAAGCCGTGTGTAAAATTGGGTTTCTCTAGTTTTACGTAAGTAATGCAGTTTT
CAATGCATTGGCCAATTTAAAGGGATTGCTGGGGGAATACCGGCCCTGGAAATTAGAAGA
AGCTTCAAGGTATATTTTCCCTTGAAATTGCTGGAATGGTTGTTTCATTCATTCAGTCGC
ATTTATTGAGCACCTACTGTGTGCAGAGCACTGCATGTTAGATCTGTTTTACTGCATAAA
ACATCCAGCTCACTCTCATTGGTTTGGCCATAATAATAATAATGATGGCATTTGTTAAGT
GCTTACTAGGTGCCAAGCCTTTTTCTAAATGCTGGGGTAGATACAAGGTAATCAGCTTGT
CCCCCGTGAGGCTCACAGTCTAAATCCCCATTTTACAGATGAGGTAACTGAGGCACAGAG
AAGTTCAGTGACTGGCCCAAAGTCACAAAGCTGGCAGGTGGCGGAGCCGGGATTAGAACC
CACGACCACTGACTCCAAAGCCCAGACTTTTTCCACTAAGCCACGCTGCTTCTCAGCATC
AGACCGAAGCAGTTTGCAGGTTGCCTTTGGGACTGCGTCCAGAGCAATATCACAAATCTT
TGCAGGATATAAAGCCTCCTGACGGAACGGAGACGGACCGGAGATGAACGGGCAGGAGAT
GAATGGAGAGGAAAGTTGGCTTCTCTGGGAACAAACTGCAGATTGGAGTCTTGCTTCTGC
CCCCATTTAATCAATGGTTTTTAATTGAGCACTTACTATGTGCAGAGCACTGAAGTAAGC
GCTTGAGAGAGTATAATGGAATTAGCAGACACTTTCCCCGCCCATAACGAGCTTACAGTC
CAGAGGTGTCAAGCTTGGCATCCTCACTGACACAAAAAGAGAACATGCAGAGCTATAGTT
GGCAAAACCGAAAGCGTGACTTGCTTTTTGAAAGGCCTCTTAGGGGTTTGGTTGGTATGA
AGTTTTGTATCTCACTGTGTCTACAGATGATTAGGTGGCCAGGAGTTGTGTAACAGAAGC
AAAGTGGTCTTATCTTGAATTTATGCGTTCAAGGGTATTAAGTGGATGCGAAAGTGTGTC
AATGTGCTTTCACTTTTAGTGAAAACATGCAGGTGGAATCCAGTGCCTTGTTGAAGCCAT
GGTTCTCAGCTAGTTGATTTGAAACTGTCTAGTTTATGAACATTTGCTGGAGTCGTTGCT
AATGTGTTGCAGAGAATAGGACATAATTGTCAATCGAGGTTTTGATTTGCCTTTTAGGAC
CGTCAATGTGTCCGTTCCCAAGAAAACACGAAATAATGGCACTCTCTATGCGTACATATT
TCTGCATCATGCTGGGATTTTACCTTGGCATGATGGTAAGCAGGTGCATATAGTAAGTCC
TCTGACCACATATATGATCCCCAAACCAGAAGAAATCAATCTTCTCACTGGAGAATCCGC
TACCCAGGTAAGTTTACTACTTGAGTTTCTTAGTCAAAATGTAATATGCCTTATATATTT
TATTTTTTTTTGGTTCACCTTGACAAGTAAGAATCCTGGAGCCCACCTAAAGAAACGTGA
AAGCATTAAGTAGTTAATGTTGTGAAAGTATTACTGTTTAAATGGCATTCTTTCCTTAGA
GGGGGTTGTTCTTGGGGGCGGGGGGGTGGCGGGCTAGAAATCCTCACTAATTGGCCGTGC
ACATATTAGCACCCGTGAAGGGAAATTCAGTGAATTTGAAGAAAGCAGCAAGGATGTCTC
CCAGACATCTCCTAACCCTTCCTTTCTTATCCCGATGAAATCATCATTTTGGACTGTGTC
AATCACTGGAATCCAAGGTGATAATGACTTAGAGATGTGTTTAGGCCATCTCCCTCTCCT
AGGGCATCACCTCATTTAAAGAGGTAAGATTTATCTTCATTTTTAAAGCCTCCAAAAAGA
GGAAGATTCCATCGCTTACTTAGCAAACCCATCCCATTTCTTAAGATAAGTTTATCTACA
TCTTAAATGCTAAGTAGGTGTAAAAACGTAATCTTAATCCCTTTCTGAGGTTCCTAAACA
GGACTGCTTAGATGCCCAAATTCGGAATGGCCCTTGTAATGCCTTTCATGGGGCTGGAAT
TCATTTGTATTTCTTGAGCGGTCACCATGTGCAAAGCACTGTACTAAGCACATGGGAGAG
TACAATACAGCAATCAAGGCACATTACGTTCCCACAGAGAGCTTACTCCCGCTGTCAGGA
AAACATGCATTGGAGTTATTTTTCCATCAGGATCGATGGGTTGCACTAAACCACCCACAG
TCTTCATTTTATCCCCCATCTTCCCAGTTTCACCATTCCCCTGTTGTTTAGGCTGGGGTG
AACAGCCCAACCTAGCACTTACAACCTGTAGCAGGCAGCAATTAGGGGGTTGGGGGGTGA
CCCTGATTTGGAAAAACTTAAAAGGAATTTGCAAGGAAATGCAGAAACTCTGAATTGATC
CGCTTTACAAAGGGGGCTGATGGGAGGCCAGCCAAGAAGGAAGTATAAAGAGTCCTACCT
CCTGAAACAATGGGTCACCCTGCCCTCGAACTCTGGAAGGGTGACCGTAACAATGGGAAA
TGGCTGGAGAGAGGTGAGGAGAGGAGAATGTGGAGAGAGGCCTGGGGGCCAGGTGTCACG
GGTTCTAGTTCTGGCTCTTTGGTGTGATCTTGGATAAGTGTCGTAACCTCTTTGTGCCTC
CGTCTCTTCCTCTGTAAAATGGGGAAAAGAATTCTCGCTCGTCCTCCCCGCTTACCCCTC
GTAGCCTGGGAGTCCCCTTAGGACTGAATCCGCTCTGGCGATTTTTGCCTTTTGTGTTGC
CCGTTCATTTTTGGTTACTGATGAATGTGGTGTCAAAAAAGGCGCAAATGAAACTCTTGG
CAGCTCTGTTTCACCCTAGGTTTCCGTTCCTTTGGTGCTTTTGCTGCGAGGAACATATTG
CAGAGCAAGTGGTGTGGCGAACAGGGAACTCAACACCCCCATATGGCGGAGGGAACCTGT
GAACCCCACAAGGGACAGGAATTAGTCTGAGTACACCGTATCTACCCCAGCACTTAGCAC
AGTGTTCGGGACATAGTAAGCACTTAACAAATGCCGCTATTATCATCACTGTCTCTACCC
CTAAGCCCGTGGGAGCCCCATGTAGGACAGGGTCTCCACCCCGGCGCTTAAAACAGTGTT
TGACCCGCAGTAACTGCTTAGCAGATACCTTAAAAAAAAATCACTTAATAAATACCACAA
TGGTTATTTTTTAACAGTGTAATGCAGCTATTTTTATTGGAGGTCAGTAATAGCGTTCAG
TGAACAATAGTACCATTTAAAATGGCATACTTCCAGAAGCTGAGGAGCAACAAGTACTGA
GCTTCGTGGACAACTCTAAAAAATGAAGAACGGAAATCAAACGATGCCTGCAAGTGGACA
GCAGGCGTATTGTAATTAAGCGAGTAATTAGGCCAAGAAAATAAGAGTAAATAATGTATG
CTGACAACTGGAGACTTTCTAAGCACTAAGAAAATCCTTGAAAGAAAATCAATTGTGAGA
CAAAAAAAATCAATCGTGAGAAATGACCAAGTTAGGAAGGTTCCAGTCTAACAAGAATCT
GTAGATTGTTTTTCATCTCTTAAGTACTGACTAAAAACAAAGAGCTCTAGGGTAGAGTTA
AGTGAGGGATAATCATTCCAGTTATCTCATTCTACATCTGTCCTACTTTGTTTTCAGTCT
CGGTCAAATCTGTGCAGTTAAGCACGCACTCAGCTGGGTTGTTCTGTCTAGCCAAGTATC
CATTCTTATAAACTTTGGAGAATGGATGGAGAAGGTCAAATGTGGAATGAAAGTAATTTG
AAAATTCCAACCCCCACAATTGCCCACAGATACTTCCATTTAGCTGGTTTTGCATTTTGT
TCAATGCAGTGTTATTCTACTCATCTTATGTGTTAAAGCGAATTCAGACTTATTTTGGAG
GGACTCTATGACAAGTTGAACACTTTACATTTTTAATTGCGAGGAAATTGTATTTCTCGG
TGCTTGATGACCAGTAAATTGTAGCAAGTTTTCTTCTGAGCTTTTATCACTTGCGGCTTT
ATTCCTGAACTCTTCAGCGGCCCCGGGATCTTTTGCCTGATCTTGATTTGGCAGAGCTTA
AGGTCTTTTTTTTTTTTGGTAAATGAACTTCGTAATTTGTCTTCGACTATTAATCATATA
CCACTCGTTTTACTGGAAAGCAAATTGAAGCGGAGAAGAAGCAGACGAATGCTCTCGACG
AACCGGTTTCTCACTGGAGGTCAAGGCTGACGCTGAACATTATGGTAGACGATTTTATCT
TCGACGGCTCCTCTCTCCCTGCTGACGTCCACAGATACATGAAGATGTAAGAGGCGGTCG
TTAAGTATATTCATTCGTTCATATTTACTGAGCACTTAAGATGGGCAAAGCACTATACTA
AGCACTTGGGAGAGTACAATATAGCAGTAAACAGACACATACCCTGTCCACGCTGAGTTC
GCAGTCTAGAGGGAGCTCACTGAAACTCTTATCTAGAAAAGGCATTTATGTTATTTATGA
ACTGGGTTTTGACTTGTTTCGACGTGTCCCTCGTTATCACGGATAATTGACAGCTGACCC
TAGTGAGAATATATTTTTCTGCTAACGGTGGTACCCCTTAAAATCGATGCTCTGTTTTTA
CTGTTTTAGAGAGATGGATTCTTCTCAACTTGAGAATTTCCTCCTATTTTCTTCCCACCT
CAGTTATTCCTCACAGACGCACCTGTGAAAATAAATAGAAGCCAATGAGGAATTTGCCTC
TGATAGTTGCCCTCCAAATTGAACTTCGAAGAGTGGACGTTGTAAGATAAAATTTCCATG
TGTTGATTTTTCAAAAGATACAATTGGACAGAAGGGTAGAATAATAAAAGTCTGTAACTC
TGATGACACTGAGGGGTGATTCCTGTAGGGATCCCTGCCAAATCACGAACCTTCTCGGTA
ATCAGAGTAAAATCAGTGTTTTAATCCCACAGGATTCAGTTGGGGAAGAGCGTGCATTAC
CTGCCGATTCTATTTATTGATCAACTAAGCAATCGAGTGAAAGACTTAATGGTAAGTGAT
TGCCCATCACTTTCCTTTTGGTGATTTTTGAAAAACCACATCATATGTGTTCCAAGAGGG
GTGGGTGGAATTTGAATTTGTATTTGTTTCCTCCATTTTTGGTGTTTATAAGTAATTTAT
ACAGAATAATCCAAAGTAGGAGCTCATCACTGTGAGGCAATAATAATTAATAATTACTAC
TATAGTAGTGTTACTATTCCTGTTATTGTGATGATGAAGCAGCATTGCCTAGTGGATGGA
GCGCAGTCCTGGGGGTCAGAAGGACGTGGGTTCTAATCCTGGCTCTGCCACTTGTCTGCT
CTGTGACGTTGGGCAAGTCACTTCACTTCTCTGTGTGCCTTAGTAGCCACATCTGTAAAA
TGGGGATTAAGACTGTGAGCCCCATATAGGACAGGTACTGTGTCCAACTCAATTTGCTTT
TATCCACCCCAGCGCTTAGTACAGTGCCTGACACAGAGTAAACACTTAAGAAATACCACA
ATTATTAATAATCACAGTATTTAAGCCCTTTCTGAGCACTGGAGTAGATACAAGGTGATG
AGGTTGAATACAGTCCGTGTCCCACATGGAGCTCATAGTCTTAATTCCCATTTTACAGAT
GAGGGAACTGAGGCTCAGGAAAGTTAAGTGACTTACCCAAGGTCACACAGTAGTTCAAGT
GGCAGAGCTGGAATTAGATCCCACGTCCTCTGACTCCCAGGTCCCCTCTCTTTCCACTAG
GCCACACTGCTTCTAAAATAAAGTGAGGTGCCTTTTCAAGGCACCCTGGGCCCGAACTCT
TTAATTAGGTTATAATTTTATTTTACAGCTATAATTAACTTACTACTCTTGCCAAAGCAG
TTTACAGTTTGGGAATGTAATAGGCTACTTAGGGTAAGGATGCGAGGGTAAGGATAGAGT
GGAATTTAGTTATCCTATTCCTCTCTAGGGTTATTTTCAAATTGATATAGGGTCATACTC
AATAAAAACTCAGTATATTTAACAAAATGGCCAGCCATTCATTGATTTACTCTTGCAACC
TTCAGGAATTCTAAGGCTAACCCTCACCGGTTCATGTGGTTTATTTGTCTTCTCTGGCCG
ATGCGCAGGTAATAAATCGTTCGACAACCGAGCTACCTCTAACAGTGTCCTACGATAAAA
TATCTTTAGGGAAGCTCCGCTTTTGGATTCACATGCAAGATGCCGTCTATTCTCTACAGC
AGTTTGGTACGTGCTCCTTTTGAAATATGAGAACAGCAAAACTCAAGCTTAGTTTTAGGG
TTTCTGTTGACTAGAAATAGAACTGCAAGTTTATCCCTAACTGTGTTAGAACACGCAAAG
CCGTTACTATTTCTGATTAAATGATTGTACACATAAGGGATTCTTTGAAAACTTTCACCA
GTTTGACTCTACATGAATATCTCATTGTTCAACAGCTTAAAGAGTTTTGATCAGATGTTT
TTTTTAAGCCGTGATGAATTACCTCCATTGTTTCCCACCCTACCCCCCTTTAATTATACA
ACTTCAAATCTCCTATGCCTGTTATAATTTTAATCAAAGGGAGCAATGATCAGGAAATTA
CCCTGGATAATATGTTTAAACCGTGAAGAGACCTACGTGTCACTGAGTGAAATGGAACCA
TATTTGTTGGTAGTGGGACATACAAATCAGTCTGCACGAGTTTTACCTTTACGATTTAAA
TTTGGGGCCTTGTATTTTATATTTTAGGATAATTTGGCTTCCTTTCTTTTCTTTAGGATT
CTCCGAAAAGGATGCAGATGAAGTGAAAGGAATTTTTGTAGATACCAACCTGTACTTCTT
AGCTTTGACCTTCTTTGTAGCAGCATTTCATGTAAGTGAATCACTTGTTCTTGAGCAGCG
CTTAGCTAAACGAGCAAAGACTTTGACGTTGTTGAACTACTCAAGGCTATGAGTTGATCA
AAATGCCTGTGCACTTTTGTTTCCCAGAGCATTCCTGTTCTGGGAACACATAGACCAAAG
GCAAAATTCTGGGTTTTTTCCTCCCAGGCGGCATCTGAAGCCTTGTACTTTAAACCGTGG
GTTTTCTACTCATTCTTTATGTCCTGAGACTTTGAATTTTGAAAGTTGGGTTGTGCATTG
GGCATCCATTCTTGGCCCTATTGGTGATCCATGATGCGTGTTTGGGAAAAATGACTTAGC
TCAGCTTCTTCCTCTAAAAGATGTGATTAGGACTTGACGGCTTAGCCCAAGGCTATTGTC
CCTAATCCATAAGTGCCGCCTGGGGATGATGATTACTTCCATGCTCACTTTATGAGGATG
AGAAGATGAACAAGATAGAGTATTGGTAAAGCACTCTGAGGTCTAAAAGCCATCTTTCTT
CCAACAATCTAGACTGTAAGCTCATTATGGACGGGGAATGTGCCTGTTATATTGCTGTCT
TGTACTCTCCCAAGCACTTAGTTCAGTGCTTTGCACACAGTAAGGGCTCAATAAATACAG
TTAACTGGCTGGCCTCTAGCCCTGGACCTGCTAAACTGCCGCCCCTTTCCCATTTCCAGC
TCACTCGCCTACCCTTCTTTTTTTTAATGGTATTTGTTAAGCACTTATTATGTGCCAGAC
ACTGTTCTAAGCAGTGGGGTAGGTACAAGATGATAAGGTTGGGTACAGTTGAGAAAGTGC
AGGTGGCTCTGCACCACTACTGCAGGATGCCAGTCCTACTGATGGTAGCCCAAACCTTTC
CCCTGCCCCATCAATCCGGTGGCATTTATTGAGCGCTCACTCTGGGCCGAGCACTGTCCT
AAGCATCTAAGTAATGTTCACTTGAGTGGCTTAGGGCCAGAGAAGTCCACAGAGATTTCC
GGGAACAAAGCGTGCAAGAGATTGTCTCACACACTCTGGCTGCAGTGCCACCATTGAGAG
TATGTCTTCAGACCGAAGGAGAACAACTAAACTAAAGCTAGTTGACACACTTGGTGTTCC
GTCTTTCTAGAGTAAAAATTTTCCCTAGCGTGTCCGAGTAGTATAATACTGCCCAGTGAA
AAGGCAAGAAGGGACACCCTCCATCCTCAGCCGAGTGAGTGGATTTAATAATGAGACACT
ATTTCTGCTCCCTGGGACGGGGCTCTTAATCATGTTGTGAGAACTCCCACATTGTTTAAT
TGATGTGCTTATTTCCAATATCAATCAAATTTCTGTCCCTTTGGTGTTGGCAGCTTCTCT
TTGATTTCCTGGCATTTAAAAATGATATCAGCTTCTGGAAGAAAAAGAAGAACATGATTG
GAATGTCTACTAAAGCAGGTATTCCTGTACTGTCCTTAAAGAAGGCGAAATGATTTGTGC
AGCTCTCCTATTTCATCATATCAATCAGGACCCAAGTAAATTGTCTGTAAGCCTTGGGTG
AAATAGCAGTATGAAGCCATTCTTGTTTCCTGGTAAAAGCAATACTCAGTTAATTAGGCC
TTCATTATGTAGCCTGGATGAAACTAATCCAAAAGACAGGAAGCCTTTTCAGATCTTGTA
ATTATGTATCTCAGTGCTTAGGCATATGTGGAATAAAGATCTTTCCCATCACTTGGATCA
CTGTCAAATCAGAGAATATTGTTTCTGAGATCCTCTAATGTCCTGTACTTTGAGTGGAGC
AAAAATTAGCCGTAGTTTTAAAAGAATGATCTGACTCCTTTGGTTCAGCGCCCAGGGAGA
AGTAAGGTTTGACGCGTTTTTGAACTTCACATCTGTGCCTTATTCTGGTAGCTGCACTGG
TCAAAAGGCTGTTTTATTGTCTTGTGTACATAATGTGAATGCAAATTTCATCTGGGACCC
ATGTAGTCTTTAATTTGTTGTTTCTAAAATGATCTTGTGGAGGAGAGATTATCTTGATTT
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTAATATCTCTGGAAAAGAAGATTCCACTGAGT
CACTGTGGAATACATTTCATTGCTTAGTAGTCTTCACTGGCTGGAACTTTTTCCTTATTT
AACTAAAAGCTCTCCCACATGTTACAGTTTAAGCCCATTTGTGCTTGTTCATTCATTCAG
TCACTTACTGTGTGTAGAGCACTGTACTAAGCACTTGGGAGAATAAACAGACTTATTCCC
TGCCAACAGTGAGTTTACAGTCTAACTTGTTTCCTGTTCAGTGAAGGTGTGGAAAATTTG
GCTCCCATCCTTTTTTTTCATATGCTTAGTGAACAGTAAGTCTGATGAGTTTCACCTAAG
CATTTTCTAGCAGTGGATTGACTGTCCGTCCAAGCTGCTTTATCTGAAGAGGCATTGCCA
GGGAAGTGGATAATATCTGAATTATTTTGCAATAGGTTGAAAGTGGCTGTGCCAGAATAT
CTGCTATTAGGATCTACTGAAAGGCGTACTTTGTGTCTTTCTCAAATATCTGCAACTATT
TTTAATCAATGGGGTGAGGGTAGTTTAGGTGTATTTATACCACATTCACCTCATAGTTTG
CCTGAGTCAGGATAATCAGTTACCAAATAAAAGATGGAAAATTCCTTTTTAAATACCAGG
AAATAACTGTGCTTTATGATGGTGACTTTAATCGGTATTTGTTCACTAGTTTTTCTGATT
CTCTGTGGAGCTAAAGTTGTCATCTAGTATTCGTTTGATTTTTGTGGCATTTTCTAGACT
TGTGAAGAGATGCAATCAAAAGTTGGTCCAAATTAGTTATGATGTTTAACAAGTGCTGAC
GATGTATCAAGGATGGCACCACTACAAGATGATCAAAGTCACACATATTTTAGATTCACT
TCTGAGCTACAAAACTAACTTTAGTTTAGGAACTTGTGCTTCATGCGTGTTCTTATTTTC
TGGGTTTTTTCTTTTCGCCGTAGCTGAAAAGGCAAATGCTGTGCCTCCAGCCCAAACCAC
ATCACATGCACACACACACACACACACAAATACACACACTTTCTCTCACTCTCCACTGTT
GGGTGGTCATGTTTGCAGCCAGCCTTGACCTCAGGTCATTGGTGCTCCCTATTAATTTTC
TGATTAAACTAATTGGTGACTTCATGAAAGGATCTTGTCTTCCCTTAAAGCAGGTGGGAA
TTAAGTCTTGACTTTGGAGAGAGGTTCAGGCCCTAGGTGAAACTGAAAGAAATCAAAAGA
AATAGAGCCTCAGAGTTGGGCAGTTCAGCAAATCTGTGCAAGGGGCTTAAGTTATTTTAT
GTCGTTCAGGGTGTGATAGTATATTAACGCGAACGTATTTGTCTCTTCAGTGCTCTGGAG
GTGCTTTAGTACTGTGGTGATCTTTCTTTTCCTTTTGGATGAACAGACAAGTCTCTTGGT
TCTGGTCCCGGCAGGCATCGGGGCAGTGATCGAGGTAAGTTTTGGGAAGCTCCTTAAGGG
CTCGTTCTGGGTTTGGAACTCCTCCTCTCTGCAGAGGCCCACACGGTATCCTGGGCTGCC
CGTAACGCCGGGTCAGTTGTGATATCCCACTGAGTTCTTCCCATCCTTCTTTCCCTTTCG
GCTGGAGAGTAAGTAGCATCACTTAGTGGAAAGGGCCCGGAGTCAGAGGTCGTGGGTCCT
AACCCGGCTCCGCCACTGGTCAGATGTGTGACTTCGAGCAAGTCACTTAACTTCTCTGTG
CCTCCGTTGCCTCATCTGTAAAATGGGAATGAAGACTGTGAGCCCCTTGTGGCGCAACCT
GATTACCTTGTATCTACCCCAGTGCTTAGAACAGCGCATGACACATAGTAAGCGCTTAAC
AAACACCAGCATTATTATTATTACCCCCTTTGGCACTATTCATGAACTCAGAGTTGGGAG
CCACCTGAGGCAAAAGAGGGACTTCAGTTGTCCACTTGTGCACTTGTCCACTGAAAGTGT
AAAAGTTATGATAGGAGAGGACGGGTCTTCCCTTCCCACTAAGTTTGGGGAGAGGTGATG
CGTGAAGTGGAGTGAAGGGTAAGCCCTCACTTTGTCTTCCTAGCTGTACTGGACTCCCTT
ACCTCTCCCACCGCCTGCAGATTGCAAACTACCTTCTGCATGAGGATTCGGCCCGTTCCA
TAATGCCTGCTTCTGTTACGCATTCTCTTTGGGAACGGGCATCTTCCCCAGAACATACGT
CTGTCTGAATCGCTGTCATTTATTTATAGTAATATCTGTCTCCCTCTCTAGATTGTAAGT
TTGGCATGGACAAGAAATATGTCAGTTTGTTATTGTACCCTCCCAGCACTTAATAGCGTG
CTCTGCACATAGTAAGCACTCAATAAATGCAGTGGAATGAATGGATGAGTGAATGCAATG
TGATGCAGTATTGGAAGAAGCAGTTTTATGTACGCATGATGCATCAGACGCGTTGTGAGC
TCTCTAGCTCAAGATTTCAGTAATCCCCACCTTATTGAATTGTGTACCAATCAGTCGCCC
TAAACTTTGAAATCCCCACTTCACAAGATGTACTCTGCTAGTGAATTTAATTAACCAGTT
GGACAATCAATGGTATTTGAGCGCTTACTCTGTGCAGAGCACCGTACTAAGCGCGTGGAA
GGGTACACTATGAGAGAGGGAACGGTCATTGCCTGACGAAGATGAACGCCCCCCGTTACC
TTAGAAGTGTTTCCAGGCGGTACCCATTTTTGAAAAGTATTTTGGAAGTATAAAGAAAGG
ATCCTTGATAATAGTCTGAGGAGGAGGAGCTGTTCCAAAGCGGATGCGATGGGACCGAGG
AAGAAATATTGTTCCCGAGGGGTTCCTACGGCCTTTTGGAATCCGCATGTCAAGTGTCAG
CCAACCATAAACTAGGTGTTTGTGGGATTTTCCTCTTCTAGTGCATCGTCATTGGTTTTT
CGTAATGTCTCAAAATACTCTCATCTTTTCCTTCAGCTATGGAAAGTAAAGAAAGCCCTG
AAAATGACCATTAAATGGAAAGGCTTGAGGCCCACATTCCAGGTAAAATTTGTCGTTTGT
GAAGCCTTGCAATTAGATTTTTCTCATTCTAAATGAAAAACACAAATATTGTTTATACCA
CATAGCCTTCTTTTAAATTAAAACTGACATCACCTTGGAAACCGCCACTAAGGCAAGGTG
GTGTATGCTGGGGGAGCAGAAATGGACCTGTTAAGCTTAATTAAATGAGAGTGGCTAGAG
TTGAAAAAAAAAATAGACCCATCCAGAAGTATTTGGCATAAGTTGATTCTTGGTGCTTCT
TCACAGGCCTAGTAGCAGAGGGAGGTCAGCAAGATTCATTCAGCTCTGCTCATCCACTCT
CCCCTGTCCCCCCCTCCAGTTTTTCTCCTTGGGAAATGGCTGGGTTTTACGGTGGGTTAC
AGCTGGGTCGCATTCAAATGCCTCAGTGCTACCGGGGGATGCCATGGAATCAAAGAATGC
CAAAGAGAAGCAGCATGGCCTAGTGGGAAGAGCATGGGCCTCGTAGTCAAGAGTCTGGGT
TCTAATCCCGACTCTGCCACTTGCTTGCCTTGTGACCTTGGGCAATTCATTTCATTTCCT
CTGTGGTTGAGTTCTCTTACTGGTAAAATGGGAATTAAGGCTGTGAGTCACATGGGGAAC
ATGGACTGTATCCAAACTAATGAACTTATATCTACCCCAGTACTTAATACAGTGCCCAGG
GCATAGTAAGCATTAACAAATACCACAATTATTAGCATTATTATTATTAACCGGGCTCTG
AACCAGAGTCACTTCTAGAAATGTGTCAGTCTCTTGTGACAGTGGGTGTCTTCCCTTTAA
CTGGGGAGCAGCCATCCCAGCAGCAGGGGAAGACTTCCCAGATCTACCTGCAAATGATTG
GGTCTCCGGGAAGCTGTTCCCAAGACCTGGAGCCCATTCGCCACCACAATGGCCCCCAAA
AGCTGCAGATACATTGTCTTTATTAGAGAAGAGACAACTGATCGACTGTAAGCTCATCGA
GGGCAGGGAATGTGTCTGTTATATTGTTCTATTGTCCTTTCCCAAGCACTTAGTATAATG
CTCTGCACACAGTAAGAGCTCAGAAAATACGGTTGACAGACTGACCGGTAATGAAGTTCA
GTGACAGGGAATCTGAGGCAGAGCCAGCACTACAGAAGTCCACTTTCCCCTACATAGGGC
ATAATCAGTAGAATGTTTATTGGACAAGTCAGTTTCTCTTTGCATCAGCTACCTCATTGT
GTAAAATGGGGACAAAGACTGTGAGCCCTACATGGGACAGAGATTGTGTCCAACCTGATT
ATCTTGTATCTACCCAGTGCTTAGTATAGTGTCTGGTATGTAGTAGGTGCTTAATAAGTA
CTGTTTAAAAAAAAAAAGCCTTAAATTCTAGCCAGAGGAGGTATGTGATTGTGTGAATCC
ATGTAGGAAAAATGTAGTATTTATATTCTTTGTGTACATTTTCCATTTAGTTAGGGCATA
GTATGGGCAATAGTCTGTTTTCCTATGAATTTGATGAAATCCACTACTCGGCAGAGTAAA
AATCTATTCATAATTAAACTTACACTAAAACGGAAACCTGAAAACATAAATGCAGTGCAA
AATGTAATATTCCATAATTGTGTCAACTTGGCCCTAAGTGTAATTGTTTGTATCACGTAG
GCAGCTAGACCTGAGATAAGAAATTAAGTTGTCTTTACAACAAAGAATGTATTACTGAAT
GTGACATTGGTTTCCTTTTAAACAGTTTGGAGCATACAATGAATCTGAAAGAAAAACAGA
GGAATATGACACTCAGGTAAGATGTGGAGAAATGATTGCAGTGTGTTAGATTTCAAATAT
GGCATGCTTAATTTTCAGTACTTCATAAGAAGCCTTTATTTTTCCTTGTTGGACTGATCC
AAGCCGAGTTCCCCACACAGCTATTAATGAAATTCTGTGTTCTCATCTTTACTGGAAGAT
AATGATCGCTCATCCCCTTTAATCAGTTGATTTGTGATTGCTGGGTTTGGATAATATATT
GCGCTTTAGGTACCCTGAAGGACTGTGTGGTCAGTCCATCGATTGCAGTGCTATTGATTA
GAGAAGTAGCACGTCTAGCTGGTAGAGCACAGGCTTGGGAGTCAGAGGATCTGAGTTCTA
ATCCCACCTCCATCACTTGTCAGCTGTGTGACCTTGGGCAAGTCACTTCACCTCTCTGGG
CCTCAGTTCTGTCATCTGTAAAATGGGGATTAAGATCATGAGCCCCATGTGGGACGGGGA
CTGTGTCCAACCGTATTTTCTTGCTTGGATCCTGATTTGCTTGTAATAATAATAATAATG
ATGGCATTTGTTAAGAGCTTACTATGTGCAAAGCCAGCCCTTAGTACACTGCCTGGCACA
TAGTAAGCACTTAACAAATACCGTTAGTGGTAATAATAATAGGCAGAGCACTGGTCTAAG
CCCTAGTGTAGAGATCATGTGATAAAATATGGAGCCTGGACCATATGGAGACCTCTCAAT
CTTAATGGAGGAAGACAGACACATGAAGAAAATTTGACCATTCAGAAGAAGAAGTAGCCA
GATGATGATGATGATGGGATTTGTTAAGCGCTTACTATGTGTCAAGCACTGTTCTAAGCA
CTAGGGGAGAATTCAAGTAAAGCGGGTTGGACACAGTCCCTGTCCCACATCAGGTTCACA
GTCTTAATCCCCATTTTCCAGAAGAGGTAACTGAGGCCCAGAGGAGTGAAGTGATTTGCT
AAAGGTCACGCAGCAGACAGGTGGCGGAGCCGGGATTAGAACCCACGTCCTCTGACTCCC
GAGCCCGGGCTCTTGTCACTAGGCCAAGCTGGTTCTCTGTACCAGTTCCATTAGTGCTTT
GCAGGGAGTGCTGCATCTCCTGGCTCCAGGCAGGTCATCCGTGGATACCCTGTCGCAACC
TTCTCAGCATTCCCAGGTTTATTCCCAGGTTTATGGCATCGGCTGCTGTTCACCCTCAGC
TCCTGGCGGGAGGGGTCGGGGCTTCCCCGTGGGGGCGGGCCTACCAGAACCCTGGACTGA
AAATCAATCCATTTCCTTGCAGGCTATGAAATATCTGTCATATTTACTGTACCCGCTCTG
TATCGGAGGGGCAGTTTATTCACTCCTAAACGTTAAGTATAAAAGGTAGGATTCTTTACT
CTTTTTTAAAAAAAAAAATAAGCCCTGTCGAATGGCAGGCAGTGGAGGGTTTTTAAATTA
TTTTTAAGCTAGGGTCGTGGGAATCAGGATGGGAATCGGGCCTGTTTAGCAGTGATGATT
AGGTGGGATTAGAAAAGTTCTCCTTGGGCACATGTGTGAAAGAGCTGTCCACTAATTATC
GTCTTAGTGGGGTTGTCTAGAATTAAAGCGGTGTGATCTGGAGAATCCAGAGGCTCTTTC
TCACTGTGGTTTTCTGTGCACAATAGGTAGGGAGAGCCTGAAGAGACCTGGGTCCTGCTT
CATCACTCAATCGATCGTATTTATGGAGCGCTTACTCTGTGCAGGACACCATACTAAGCG
CTTGGGAGAAAACCACACAGCAGTAGACCAGACACATTGCCTACCCACAACGAGGTGGTT
CTCTTGAGTTTCCCTAGGATCATAAATGGCTCAGACAGGCCCCCAATTCCCTATAGCTGG
AATCTCCAGACAGAAGAGGGGCAAATAAAGGAGACAAGGAAAAAGAAATGGGAAGAGGGG
GTTAAGAATTTGAAGTAAAGGGGGAAAGTAGAGTTTCTTGGAGTGGAGAGGAGATGGGAG
ATGGGATGCAGGGGAGAAAAAGGTGTTTAGAGAGGACAGAGAGAAGATGGGTCAGGAAGG
AGAGAGACAAGAAGAGACGAGAAGAAAAATTGTAAACAGCAGGGAGAGTGAATCAGAGAA
GTAGAAGCGAACATCATGGGACAGTGGGAATATGGAATTGGGAGGAGGAGGGGCTAGGAT
CCCATGAATGTTAAATTAGGATCAATCAGTGGTATCTATGGAGTGCTTACTAATGTAATT
ATGACCATCAAAGAAAATGAGGTATCTCCTTCTTCAAAGTGAAACCTTTATTTTTACCCT
TCAGTTGGTATTCCTGGTTGATCAACAGCTTCGTCAATGGTGAGTCTCTCAGGATATTTC
AGTTTAGCATGTCAAAGATTTTCAGAGAGATTTTGGTTTTTTTGACCCTACTCTTCCAGA
ACGGGTGTCATTTATTTTGGAAGGAATGTAACTTTTTGAGTGAATGCAATTTAGAATACA
ATTTGCATACAATTTTGTGAACAAATACAATTTAGCGTATTGCAGGATGATATAGCACAA
ATTGAAGCTAGACTAGAGCTTTTGGTTTTCTCTGTTTAAACTGTAATAGTTTAAGATTTA
GAGAATCATCAACAGTTTGAGTGTGTCCAAAGCTATTTCTTCATCAGAGATATTTTTCAT
CAGAGAGACAAAAATTCTGCAAGGTAATAGCCTTGTTTAGTTTTAATTTACATGTTCAAA
CATTATTTTAAAAAACACGAATTGGAGTCGCTTGCCTTTCAAATGGGTTCGTTCATGCCT
TTTTATAAGTTGGAGATCAAAAGTGTAGGGAGTGTTTCTTAGAACCTATCACAAAATATT
TGTGTTTTCTCCTCAGGGGTGTATGCCTTTGGATTTCTCTTTATGTTACCACAACTATTT
GTGAATTATAAGGTAAGATATCAACATGTCTTTTAGGGGGTCATCATTTCTTTTTTCTGC
CCTATAGTTATGTCATCTTTTTTTTTGTCAGAGAGGTCAGACAACACCAGGCTCCATAGA
CAGCAAATACAAAAGCACAACAAAATACAGTCTTTGTCTGTGCACAGTGTAGTTAGAACT
GGGAATGATGAGGGAGAAAAATCAGGGGAGAGATTCTGCCTTGGCTTTTTCAGCCACATA
AGCCCTCCCAATCGGTAAAGTTCACTGACAGTGGCATCTTCAAGTATGAAGGGAAACTCT
GTAATCTTTTTTTCTCACACTCCCCTACCCTAGAATAATCTTTGTGACTCTCTACTTCCA
GATGAAATCTGTAGCACATTTACCATGGAAGGCGTTTACATACAAAGTAAGTAAGTCTAT
AATTCCCCTTTCTCCCAGCCCGCCCCAAATTAGTGGTACCCAGCACTGAGCATTCTTGGT
GTAAAGCAAAAAAATTGTTTAGCTAAAGTATTAAAACTCACTTGTGCTGGGCAGCAGCGG
AATGGGAGAGAGTCGAGAGTGGAGGCTCAGGTTTACTGCGCAGAAGGAGGCAATACGGAT
GCAAACACTTCCATATTTTTATGAAGAAAACTCTCTGGATCCACTGCCAGAACGATTGCA
GTTGGAGGTGGGGCGTTGCGGGAGAGATGTGTCCATGGCATCACTATGGGTCCAGACCTG
ACTCGACAGCATAAGGCAACAACGGCGAAGTATTAAATTCTCAAGGATCAGTAAATCACC
TTAAGATTTCAGTTCATTATCCCGTGAATTTTCTTAGGGACTGATGTCTCTGCCTTTGAA
GAGTGATTTTATAACATAAAAGATAAAGAAAAGTACTTTAATTTTGTACTTTGGTTGCAA
GTGTTCCCCGGGTACAGTGAAAATATTTGTCGGGCGTAAGGATACATTTGTTTCACTGCC
ATTTTTTAAATCCTTCAATTCTAACGTTAAATCACCGACATCATAAGAATGTGCTCTGGA
TTATTCTCTGAGTGTTAGAACGATCAAAAATGCATGAAATAATTAAACGCGTGAATTGCT
CACGGTTAACGAAAGAAAATTCAAATGCCGAAATAGTTACAGAAATTAGTTATGGGAAAT
TCGAGAGAAATAAAGTGCCCGTGAGTAGTTTTCAGCGTGGTGANNNNNNNNNNAGTGGGG
CTGTCTAGAATTAAAGCGGTGTGATCTGGAGAATTCCAGAAGGCTCTTTCTCACTGTGGT
TCTCTGTGCACAATAGGCTAGGGAGAGCCTGAAGAGACCTGGGTCTGCTTCATCACTCAC
TCGATCGTATTTATGGAGCGCTTACTCTGTGCAGGACACCATACTAAGCGCTTGGGAGAA
AACCACACAGCAGTAGACCAGACACATTGCCTACCCCACAACGAGGTGGTTCTCTTGAGT
TTCCCTAGGATCATAAATGGCTCAGACAGGCCCCCAATTCCCTATAGCTGGAATCTCCAG
ACAGAAGAGGGGCAAATAAAGGAGACAAGGAAAAAGAAATGGGAAGAGGGGGTTAAGAAT
TTGAAGTAAAGGGGGAAAGTAGAGTTTCTTGGAGTGGAGAGGAGATGGGAGATGGGATGC
AGGGGAGAAAAAGGCGTTCAGAGAGGACAGAGAGAAGATGGGTCAGGAAGGAGAGAGACG
AAGAGACGAGAAGAAAAATTGTAAACAGCAGGGAGAGTGAATCAGAGAGGTAGAAGCGAA
CATCATGGGACAGTGGGAATATGGAATTGGGAGGAGGAGGGGCTAGGATCCCATGAATGT
TAAATTAGGATCAATCAGTGGTATCTATGGAGTGCTTACTAATGTAATTATGACCATCAA
AGAAAATGAGGTATCTCCTTCTTCAAAGTGAAACCTTTATTTTTACCCTTCAGTTGGTAT
TCCTGGTTGATCAACAGCTTCGTCAATGGTGAGTCTCTCAGGATATTTCAGTTTAGCATG
TCAAAGATTTTCAGAGAGATTTTGGTTTTTTTGACCCTACTCTTCCAGAACGGGTGTCAT
TTATTTTGGAAGGAATGTAACTTTTTGAGTGAATGCAATTTAGAATACAATTTGCATACA
ATTTTGTGAACAAATACAATTTAGCGTATTGCAGGATGATATAGCACAAATTGAAGCTAG
ACTAGAGCTTTTGGTTTTCTCTGTTTAAACTGTAATAGTTTNNNNNNNNNNGGCATCCTT
CAAGTATGAAGGGAAACTCTGTAATCTTTTTTTCTCACACTCCCCTACCGTAGAATAATC
TTTGTGACTCTCTACTTCCAGATGAAATCTGTAGCACATTTACCATGGAAGGCGTTTACA
TACAAAGTAAGTAAGTCTATAATTCCCCTTTCTCCCAGCCCGCCCCAAATTAGTGGTACC
CAGCACTGAGCATTCTTGGTGTAAAGCAAAAAAATTGTTTAGCTAAAGTATTAAAACTCA
CTTGTGCTGGGCAGCAGCGGAATGGGAGAGAGTCGAGGGTGGAGGCTCAGGTTTACTGCG
CAGAAGGAGGCAATACGGATGCAAACACTTCCATATTTTTATGAAGAAAACTCTCTGGAT
CCACTGCCAGAACGATTGCAGTTGGAGGTGGGGCGTTCCGGGAGAGATGTGTCCATGGCA
TCACTATGGGTCCAGACGTGACTCGACAGCATAAGGCAACAACGGCAAAGTATTAAATTC
TCAAGGATCAGTAAATCACCTTAAGATTTCAGTTCATTATCCCGTGAATTTTCTTAGGGA
CTGATGTCTCTGCCTTTGAAGAGTGATTTTATAACATAAAAGATAAAGAAAAGTACTTTA
ATTTTGTACTTTGGTTGCAAGTGTTCCCCGGGTACAGTGAAAATATTTGTCGGGCGTAAG
GATACATTTGTTTCACTGCCATTTTTTAAATCCTTCAATTCTAACGTTAAATCACCGACA
TCATAAGAATGTGCTCTGGATTATTCTCTGAGTTTTAGAACGATCAAAAATGCATGAAAT
AATTAAACGCGTGAATTGCTCACGGTTAACGAAAGAAAATTCAAATGCCGGAATAGTTAC
AGAAATTAGTTATGGGAAATTCGAGAGAAATAAAGTGCCCGTGAGTAGTTTTCAGCGTGG
TGACCCATTGTCAGACTTTTACATTGGATTTGTGACTACACAGTGGATAGTAAACAGTTT
TCCTCAAGTAGAATTACTGGCCATGTGAGCAGACACATGGAAATGCATTCATTTTTCCTA
CTCTTTGGAGGGAAGCCAATTCCTATCTCCCCAAGGATGACTTGGATGGCTTTTCTGCTT
GAAAGGAAATGGGGAGGGTAAGCTAGAGGAAGGGAACTGACAAAGCCCAGGACCAGGGCC
AGGGGCATCCCTCCAACCAACCAGCGGGCTCAACAGTCTCACCCTCAGCTCAGGCCCTGA
GTCTGTGCCAGTTTGGGGGGGTTTTTATGGTATTCGTTCCACGCCTGCTATGTGCCAGGT
GCTGGACTAAACTCCCGGGTAGATGTAAACTATTATTTGGCCCAGCCAAACCTCACCCAG
GGCTCACAGTCTTCCTCCCCGTTTTACAAAGGAGGTGGCTCAGAGAAGTGGAGTTACTTG
CCCAAGGTCCTACGGCAGACAAGTGGGCAATCCGGGATTTGAACCCGGGTCCTTCTGACT
CCCAAGCCCTTGCTGTATTGTTTGAATTGTGTATATCATCGTCCTCATCTTTTCACTATT
TTTGCTTGTTTTTAACCTTTTCTTACATCTCTGTCATCAACCCATTTCCCCCTCTCACTC
CTGAGGACCAAAAAAACCCTAATTCTGAACCGCTTACTGTTTTTCTCAGTGCTGTTACAG
TGCTTCGTATATACTTGATATTCACCCCACCCCTGACCCCACAGCACATATGTATGTATC
TTTAAATTATATATTATAAATTATTTATTCCTATTAATGTCTTTCTCCCTCTCTAAGGGG
TAAGCTCGTTATGGGCAGGGAACATGTCTACTAATCCTGCTGTATTAATGCTCCACGCAG
AGTAAGTGCTCAAAAAAGTGCTCAAGAAGCAGCTTGGCCTAGTGGATAGAGCACTGGCCT
GGAAATCAGAAGGACATGAGTTCTAGTTCAGACTCCGTCACTTGTATGACCTTGGGCAAG
TCACATCACTTCTCTGTGCCTTAGTACCTCACCGGTAAAATGGGGATTAAAACTGTGAGC
CCCTTGTGGGACAGGGACTGAGTCCAACCCGATTACTTCGTATCTACCCCAGCACTTAGA
ACAGTGCCTGGCACATAGTAAGCGCCTAACAAATACCATTTAAAAAATACAACTGATTGA
TTGACTGACAGGTGGGTTAAGAAATAGTATTGTCACCACCACTATTATTATTTGAAGACA
ATATGGACTCTGTCAGCTATACTCATACCAAGCTATTTTCTAATTTTTCTCTCCCTTTGC
TTTGATAGGCTTTCAATACATTCATTGATGATATCTTTGCCTTTATCATCACTATGCCAA
CGTCACATAGGCTGGCATGTTTTAGGGATGATGTGGTTTTCCTTGTGTACCTGTACCAAA
GATGGTAAGTTCCTCTCCAATTATTTATTTTCTCCCGCTTTCTTTTAGTTGTCAGACTTG
ATCAAAAGGCAACTCCAGTGTGTCTTATAATCTTGGACCTCTCATAATCATTTTCGAGAT
CATCCCCTCCGGAGTGTAAGCTCTTCGTAGGCAGGGGACACATCTACCAACTCTGCTGTA
TTGTCCTCTTCCAAGCGCTTAGTACAGTGCTCCGCACACAGTAAGGGCTCAGTAAATATC
ATTGATTGAAGATTTTGGAGTAGAGGATAGAATTCATGTGGAAACGACAAATTTGCAGTC
AGTCGATGCATCGAGAGGCCTCTTTCTTCACAGCTGTTGAATCAAGTCACTCTAAAAACA
GTACTGGTTTCAGAGATTGTGGCACCATTCTTTCAAATCGCAGAAATGCGTAGCCTTCAT
TATTTCCACATGAGGCAAGGCTAATTTAGTTTACGCTTCCTAGCATGGAAATATCAACTC
ACTGCCCACCCAAAGTTGAATTTTAACCACTGAATTTTTGATCGTTTCGTAGAGCGCTAT
GAGTTGTCAGGGGCATGTGTAGGTTGTTCGATTTCTTGCTGTGTCTTGGTTTTAAAAGGA
GTACCGTGTCCTAACTTCTGTCACCATTGTCTTCTCTCAGGCTTTATCCTGTGGATAAGA
GTAGAGTAAATGAATATGGAGAGTCCTATGAAGAAAAGCCCAAAAGGAAACCCCACAGAG
ATTAACCCTTCAAATCATTCTAGAAGAGGCCTGTCTCGGGACTGCCTTGGATTTCGTGTA
TTGGATACTAATATTGTTTTTCTCCTCTGCAAGCAAAGAACAAGGTTGGCAAATCATCAA
CCAAGTATTTTGGGAAAGCTTCAGTGGACTCTTATGGACATCTCTCTTCTACATTGCCAA
AACCTCTTTTTGAATGCTTCCCGTAGATTTTCTTTCTGACCCATTTTTCTTGTCATTTTG
TCTTCGTGAAGAAGGCTGCCAATAATTCAACCAGCCACCGCCGAGCACCTAAAAGTTTTC
CAGGAAAGTTTCCATCTCAATCCCAGAGCCGTACGACAGTTTTCACCCTCGATGGCTTCG
AAAAGATCGGCCGCTGGCAACGATTTCGAGTGCGGCTGCCGTTGCCCGCGTCGGCGAAGG
CTGGCATCGGAGAGATGCGCTGGATACTGGGAAAGTAGGGCAAAGCCAAGTAGCGCTCGT
GGGATGGAGAAATGGCAGTTACCACTGCAGACAGTTTTCTAGGATTTAAATCACCACCGT
GTACAATTCCACAGACCTGTATAATAAGCACTCTGACCAACATGTTGAAGAATCGCTTTT
CCTTAATTTAAAAATGTGTTTCACTATCAGCGCGTTCATTTTCAAATAAATTTCACTGGC
TGTAGAAACTCTTCTCGCCCTTGTGTACGGGAGGGAAAACCGTTCAGACATTTGAATTGT
AGCTCTTCCTCCCAGTCAGACAGTCTCCCAGATAATGAACTCATGATATGGACCTTTTGG
CTCTTTCAACAATGATAATTGTATTTTTTAAGCGCTTACTATGTGCCAGATGCTACACGA
AGCGCTGGGGTGGATACAAGCAAATCAGGCTGGCCACAGTCTCTGTCCCACATGGGGCTC
ACGGCCTCAATCCCCATTTTGCAGATGAGGTAACTGAGGCAAAGAGAAGTGAAGTGACTT
CACACAGCAGACAAGCGGTGGGGCCAGGATTAGAACCCGTGACCTTCCGACTCCCAGGCC
TGTGCGCTAGCCACTACGCCATGATGCTTCCCGAGAAGGGTGTTTGAGGTGTAAAAGCGC
AGGACCTGTTAATCCGTGTTTACATTGCGAGAACTGGTCCGTTTCTGTCTTTCATGTAAT
AACGGAATTTATCTTTAGATCTGATTATTCTTCCAATTGCTGAAACATAAAGTGATTTAA
TTCAGCTCACCATAGGAGGGCAGAAATGCCGAAACTCCTTCGGTGCCTAGGACTAAGAAA
CTCTTATCAACATCTTTGCCAATTTTGCCCGTGTTTCCCTTGCGTGTAACTTTTATTGTA
TCCTTTTTGTCCCTAAATATCCCAAAGAACACATTTAACATTAAAAAAATTAATGACATG
AACTAAAATAAGAAATTTAGTGTGTTCAATGAAATTACATTCCTGAAGACTTTCAAAATG
TGCCTTTTATATACTGTGAGCAAGTGTGTGTGTTTGTGTGTGGGAATATACGAGTGTGTG
TGCATGTATATGTGTGCATTGTGCACATGTGCGGAAAATAAACAGCTGAGATTCCTGGTC
CAGGCTTCAGTAATCTCAAGGCAAGGTGTACAGGCAGGAGAGTCTTTGTAAAACATATAC
ATGATCAGTTTACTGATTTTGGCTAGTACGTGAAAGTAGCAGCATTGTGAATCAGAAAAT
AGCCATTATTTTGACAGAAGACTAATTTTTACAGTTAAATTATTGTATCTTGTCTCTGTT
ACCAAGGCCAGTTTCTGCAAAGGAGTAGAGAAACCTTTAACTTTTCTCAAAACCAACATT
CTCATCCCTGGGAATGCCATTTGTATATTTAATCAATCCGTGGTATTTATCATGCAGGGG
ACGGTACAAGTAGTTGGGAAAGTACAATACAGTAGTGAAGATTGAAAGCCATACCAAACC
GGAGTTGAGTTGAGCCAGCAGATTCCACTAAGAAGGGACAACTTCACCGTTTTTTATGGT
ATTTATTGAATAATAATGATAAGGTTGGTATTTGTTAAGCGCATACTATGTGCCGAGCAC
TGTTCTAAGCGCTGGATGCTTACTCTGGGCCGGGGACTGTAATAAGTCCTGGGGTTTGAT
AGGTTGAACACAGTCCATGTCCAACGTGGGGTTCGCGGTCTTAATCCCCATTTTACAGAT
GAGGTAAATGAGGCACAGAGAAGTGAAGTGACCTGCCAAAGGTCACGCAGCAGACAAGTG
CCGGAGCTGAGATTAGAACCCAGGTCCTTCTGATTCCCAGGTCTGCACTCGATCTACTAG
TCCACGTTACTTTTTGATAAAGGGAAAAATTGTCCCGTGGGTTGTGGGTTGGAATTTTGA
GTTTTTTCTTCAGAATTCTAGTTATAAAAAGCTGCAAAATCATTTTTTGTTGCTTGCATT
CAGATCTAACCTTCAGCCTGAGGCTCTCTTAGATGTTTTCAACCTTCAAATCTTCCAGTG
TGTGTTGAACTTCACTGACACCCACAGTTTCTTCAGTTTTTTTTTTTTAAATGATATATT
GAGACTTAGGATAATGGGCTCTGTTCTATAGGTAAAATTCATTTTCGGTATGCTATGATG
TCAGCAAATCAACCCCATGGTTTAAGTGAACAGAATTATTTTAGGTTTTGCAAAAATGTG
TATTGATGGAAAATATGTTCTGTGTCTATGTTTTTTTTTTTAATTATGTGCCAACAACAC
TTTAAATTAATATTACTTTAACTTGTCTCTGTCTTTACAGGGAATATGATGAATGTTTTT
TCATTTTCTGGCAGTGTCTCATGAAGAAAATTAATTTTATATTCCTGCCCAGTTGAGATT
ATACATTACACAGTTTTCCGCTGCTTTGTTAATTCTTCAGATTAGTGATTTTCAAGAAGT
CTAAATTAAAATGGATTCAGAGACCTTTTCAGCTGTCAGTCTCGTTTTATTTTCTCATAA
CTGGTTTCCGCTTCCTTTCCCCTCCAATATTTCATGAAGGGGGTTGACCGTTAAAAGGTG
CCTGCCATTTCTGCGGTGTGGTGGTTTTGTTAAGAGGAGTTTGGATTTAGGAAAGAAACA
CTCAGGGTATTAGTCTAGGTAACGGGATTCTGCAAGTCTTCAATCTCTCCAACTGCCTTA
GTAGTAATAATTGTATTTGTGAAGCACTCTGTGTGCGCCAAGCACTGTGCTAAACTCTGG
GATAGTTACGATCCCAGCTGCGCCACTTGTCAGCTGTGTGACTGTGGGCGAGTCACTTCA
CCTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATGGAGACCGTGAGCCTCACGT
GGGACAACCTGATGACCCTGTATCTCCCCCAGCGCTTAGAACAGTGCTCTGCACATAGCG
CTTAACAAATACCAACATTATTATTATAAAATTAGATCAAACTCAGTTCCCATTCTCCAC
GGGGCTCTCAGCCTAAGTGTCAGAGGAAGCTGGAATTGAATCCCCATTTTTCAGATGAGA
AAACTGAGGCACACAGTTACTTGCCCAAGAGCACATAGTCAAGTTGTGGGGTCCAAATTA
GAATTCAGATCTCCTGATTTCCAGTCCCATGCTCTTTCCACAAGATCACCCTTTTTTATG
GTATGTAAGTGCTTACTATGTGCCAGGCACTGTACTAAGCACTGGGATAGATACAGACTA
ACCAGGTTGGACACAGGCCCTGTCTCACATGGGGCTCACGGTCTTAATCCCCCTTTCACA
GATGAGGTAACTGAGGCACAGAGAAGTGAAGTGACTTGCTAGGGACTGGCTAGTCCATGA
AAGTACCAGCCCCGGGAGTCAGAAGGACCTGGGTTCCGATCCCGGCTCTGCCCCTTGTCT
GCTGGGTGACCTTTGGTCTCCCCTTTGAACCGAGGTGGTGGTCGCTGCTAAACGTGGTAT
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1148, 4017..4206, 6977..7125, 7772..7850, 8948..9065, 9596..9690, 11033..11117, 13070..13173, 14676..14741, 16465..16515, 17782..17864, 18784..18818, 19336..19391, 19741..19785, 23828..23943, 24580..27560
1045..1148, 4017..4206, 6977..7125, 7772..7850, 8948..9065, 9596..9690, 11033..11117, 13070..13173, 14676..14741, 16465..16515, 17782..17864, 18784..18818, 19336..19391, 19741..19785, 23828..23943, 24580..24664
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved