Ornithorhynchus_anatinus Locus Mono:SNORA69
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA69
Ornithorhynchus_anatinus
Mono:SNORA69
Ultra3
SNORA69
1001..1134
2134
GGGGGGAGGGCGTGAGGGTGGGGGGTATACAAATTTATCAGTTTGGGCACAGTCCCTGT
CCCTCACCAAGTGGGAGGTAGGATTTAATCCCTATTTTACAGATGATGTAACTGAGCCAT
AGAGAAGCTAAACGACTTGCCCAAGGTCACACAGCAAGCAATTGGCAGAGCCGAGGCCTG
TGCAATTTCCCCTAGGCCACACTGCTAACTGGGCATGTATATACTTGTTAGCCTCCCTGT
TCATAAGCAATGCATGCAGTTTTTGGTACTGGCCTGGAGTAGATCTCTTGGCTAGTTTGG
CAGACATCTGACTCTTGTGATGTAGAAATTGTCCTCTTTGCTGCTTGGCCTGCTCCTCAT
CATGGTGAGGTCACGGGTCAGCAATTGGTAGTCAGGTTCACCTCCATCTACTGACCTCCA
GGAGTTCTCTTGCATAGTCAAGAGGGATCTCTGTCGATCAGTATATATATCGAGCATTTA
CTCTGCGGTACACTGTATTGGGAGCCTACAGTAAAAAAAAGAGTAGGTGTCCTGGGGTGG
CTGCCCGCATTGATTCCCCACTTCAGTGTTAACCCTTTCATTTCCCCAGCAGCACTCTTC
CATTATAGTGAGGTTTAGAAACCAGTTGGAGTGGTTGCTCCAGGGTTACTACTGGGAATC
ATAACCTCTGCAGAAGCTGTTGGCTGCCTGTGGCAAAACGAATGGCCTACTGGATAGAGA
ACAGGTCTGGGAGTCAGAAGGACCCGGCTTATAATTCCCTGGCTCCTCCACTTGTCTGCT
GTGTGATCTTGGGCAAGTCACTTCACTTCTGTGTCTCAGTTCCCTCATGGGTAGCATGGG
GGTGAAGACTGAGCCCCATGCGGGACAGGGACTGTGGCTGACAACAAAAAACCTACCTTG
TTAGAAGTGATTATTTGATTTGTTCGTGTAAAACAGCACGGCCTTGTAAACTGATCGGGC
ACACTGTGAGGAGAAAGCCAAGGAGGCGGTATCTATTGGTTAAAGCAGGTTGCAATTACA
GTGCTTCATTCTGTGGGAGTACTGCCATTACCCTGCTGAGAGTAAAGCTGTGTTAAATAT
TGCTTTGGTCTTCACATTCATAGAGGTGAAGCCCTCCAGTTTAACATGTACACATTATAA
AATTTGAGGACACTCTGGATCCTAAATTTTGCAAAATTAGTTTTCCAGAAATAAAGGTGG
TAACTGGATGTTAGCCATTAATAAAATCAGAGGTGTGGGTGTTGATTTTTCAGGCGTATT
TACTTGGAAAGAGCTGGAGTTTTCTAACCACGGTAAGCGGTGGTTCCTCAGTGATCTAAT
CTCATGGTAAAATAGGTGCAGGCCACATTGGACTGTGATATAGCATCAGCAGAAAAGAGA
TTTTCTGGATTGTGACTGCAAAATGAATAGTGACTACAAAAACAGTTACAATGAAGCATT
CAGTGACTTCAGTAAAACTGGGCCTTTTTTCTTATTTTAGGTACAACTCCAAAAGAAGAC
ACTGGAGAAGGACGAAGCTGGGCTTGTAAAGAACAGCTCATCTAATGACACGCATATTTG
TCCTATCCCGAGTTCGTCATTTGTCTTTTTCAACAATTTCGCAAAAACACAACTAGTGGC
TGAGACGTTCTGGCTATCTTATCAAGCGTTGGTTGTATCAGATTTGGGAAATAAATGTGT
GTGATCTTTTTGAAATGTTCTTGTATCAACTTTATGCACTAATGTTGGAAACAGATCTAT
TGAAAGTTCATCAGGGATATAACTTTCAAGAGACATTTAGCCCCGTGATTATCACCCATC
TAGTCTCAATTGAGTTTATGATCTTGGAGGGGTGGTGGAGAAGCTGTTGGCCCCATCATA
GCAGTGCTCTATTTTGGCTGGGTTTGCCTCAACCCGCCAACTTTGCATTTGGATCTGTCG
ATTGGTCTCGATTATCCCCAAGCAAAGATAACAAAAGAAGTAATCTAGTAATAGAAGTGG
CAGGCAAAGAAAGATATGAAGAGTATCCATAGAGCAGATTATCAGTGAGGATTTTTTCCA
TTAAAAGGTTTGGATATTGCCCAAAATCTGGATCTTATTCAAGGCAGGTGGTGTGGAGAG
AATTGAGGAAAGACTGTCAAGTTCCTGTTCAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved