Ornithorhynchus_anatinus Locus Mono:SCARNA13
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA13
Ornithorhynchus_anatinus
Mono:SCARNA13
Ultra378
SCARNA13
1001..1277
2277
CCCTGGGGTAGATACGGGGAGATCAGGTTGCCCCACGTGAGGCTCACGGTCTTAATCCC
CGTTTTACAGATGAGGTAACTGAGGCCCCGAGGAGTTAAGTGATTTGCCCAAAGTCACCA
GCTGGCAGGTGGCGGAGCCGGGATTAGAACCCATGACCTCTGACTCCTATGAGAGCAGGT
AGTGTTCCTGAGCGGAAGGGGGGGGCGGGGTTATGGCAGGCGAGGGTGAAGTCGAAGTGA
ACGAGAGCGGACGGGGGCCTGGATTTCTGCCAACTGAGCCCCTTGGCATGCGGGCAGCAG
TGGAGGTGATCGAGGGCTGGACAAGGTCATCAAGTTGTCCCACATAATTATAATAATAAT
AATGGTAAGGGAGCTGTCTGGCCAAGAGGGCAGAGTGGAGGGCTTGGACCTGTGCATCCA
GAGAGGCGAGATTGGGCAGGAAGTCCAAAAAGAGCATGGCGGCCTGGGGTAAATGACCGA
GGGCCGGGGGGGGGGGGAGGATGGCAGGTCCCTGGGAGGGCACGAGGACGGTTTTGCAGG
GAGGAGGCACGTAAGAGAGGTCAGGATAGGAGGTTGCGGTCAGAGCGGGGGGATTTCAGA
GTTGGTAAAGTGAGAAATGGTATGACGACAAGTGATGATGAGATCCGGAGGTGGAGCGGG
AGGCCGTCGCAGTTGAGAGGGAGCTGGCGGCTCGGGAGCTTGTCGGGAACGTCCGCATCC
GGCACGCCAAGGAAGGCGAGAGAGGCATCGAAACCTCTTCGGGAAATGGGAGGGGAGAGG
TGGATGGAAGTGGCGGGGCGGGGGCGGGGAGGTATCTGTGGAGGGGAGTGAGAAAAGGTG
AGTCCCCTCAGGAGAGAGCAGCAGGGGAGACCGTATCTCCTCTGGAGAGCGAGTTACCTG
CCGTTGCCTTGTGTGACTCTGCCGGAGGGGGTGTGGACCGGAGGCCCTTTTTCCTCGCTG
AGTTCAAGACAGGTATTGCCATCCCAGCGTGTCGGGTGCGTCATCTGCAGCCTCGGAGGT
GCTCTGGGTTGTTAGTACCCTGGGCGGATGGGGCTCGCAGAGAGAACATAGCCCAGAGGA
AGCTGAGGCATGACTGTTAAAGGGGCAGCAGCGCCATGTGCAATATTCCTCTGACACCAA
ACCAGATACTGTTGTCACGGCGATGATGACCTCTCTCGTGTCATCTGTCTATCTATCAAC
AGTTAGAGCAGCGTCGCAGTCAAGATATGGTTCGGCAAAGGGAGTGGTTTCTGCCGAACA
CTGAGAACTGCTATAAGCCTGGTGTCCGTGGCTTCAAGTGACTTCCCTTTCAAAGCCGGC
GTTTTGATCGATTTGATGGAAGGAATCGATTTTGGATGCCTAGGGGCGGTTGGCTTTTCG
ATCTCCGGCCGTAGGCTGGAAGCATAAAACAGAGTTTGATAGCATCCCTTCTCTCTTTCT
CGCTCATTTGAAAGTTTAGCGACCCCCCGGGAAGAAAAAAAAAAAAGAAACGTCCAATCG
GATATACTTATTATTTGAAACTTGATTTTGAAAGAAGTTCACTGCTTGCCTGCACCGACA
GTGCAATAGCTGTGGTGTCTGAAATCGTTCCAAGAACGTTTTCCAGGGTTGCAAGAATAC
GTATCTGTGTCTTGTGCTGGACTGGGATTTTGGTCGTCTTTAGGGACTTGTTAGAATTAT
TGTCTTAAAGTTTTGTATATGCTTTTTTTTCAGGTTCAAGAGATCCTGGGTCAAACTGAA
GAACGTTGGGAACAGCTAGGTATATGCAGATGCTTGACCTGTTAGGTTAAGCATTGTTTT
GTGCCGTTTATGGTTTCGGAAGTTCTGCGTCCTGTTTGACAGTAGAGTGGCGTATATTTT
TTGGATTTCTTTCTATCTAGTGCTACTGTTTTTTTGCCACTGGAACAATTTTAAGAGGTG
TGTGTGTGTGTGGTGCACACCTACGCTTCTAAGAGAACTATGAATTTGATTCGTCATTAT
CCCAGAACCCTATAAACCTGCTAAATTCCACTTTAGTGAGGGGAAAAAAATTGCAGACTT
CCACCTGGAAGGGCGGGAGCATCATTCATTAGGGAATGTCCACTCTCTCGACATCGTGGT
TGAAGGAGTCTCCTCAACCGTGAGCCGAACGCCGTAGAATGGGATTCCGAAGCCAGATAC
GCGCATTCGGTTGCCAGGTTTTTATCCTTTTGAAGTCCATAATTTTCAAGCCCGCTTAGT
TGGAGAATCTTTGTAGAAAAGAAATAATGCCACCCCTGTGGTTTTCAAAGCTATTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved