Ornithorhynchus_anatinus Locus Mono:SCARNA3
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SCARNA3
Ornithorhynchus_anatinus
Mono:SCARNA3
Ultra341
SCARNA3
1001..1137
2137
CGTTGTGGGCAGATGCCTCTGCTGCAGCTTCAAGGAGTTTTGAGATGTTCATTCATTGT
CGTATTTATTGAGAGCTTACTGTTTGCAGAGCACTGTACTAAGCTCTTGGAAAGTACAAT
TCAGCAACAAAGAGATACAGTCTCTGCCCACAACGGGCTCACAGTCTAGAAGGAGGAAGA
CAGACATCAAAAGAAGTAAACAGTCATCAATAGCATCAATATAAATAGAATTAGATCTAT
ATATGCACACATCAGAACAAGTAAAACAGGCGTTAATATAAATAAATAGAATTATAGATA
TATACATATATACACAGGTGCTGTGGGGAGGCAGGGTTAGAGGAAAGGGAGCAAGTCGGG
GCGAGGTGTGAGAGGAGATGTTGCTGCAGAGCGTTTTGTTGCAGAACCGCCTTCACAAGA
GGAGAGGAAGTGAATATGCCTGGATCCGCTTCCATGCTGAAGTGAAGGGGTGACTAGAGT
TGTAAGGAGAAGGGCCTGGGAATTCTTAGCTCCACTTCCCCAAAATCGTTGCTTTCCACT
TAATAAGTTAGCCAGTCTCCAAAGCCGCATGATCTCAAATAGCAAACTATTGACCTTGCT
CCTGGTCTCTCTTATATTGCATGATTTTAAAGATTCCCTGGTCTCAGGGACACAGGCATG
TGATGGAGAGTAAATGCTGTGTGATAGAGAAGCAGTCTTACTTTAAAACGTATTTCCCAA
TTGATCTGACAAAAGAGGGAAGGAACCTTGAATTTTTTGATCATGTATGTTTCCATATTT
CTCCTCCAGAAGTATTTACAACTTTTTCTCCCCGACTTAAGATGCCTTTGACTTAAGTGC
AACTTATAAATGCCCCCTCCCATTATCCAAATATCCTTTCTTTAGTTTACGTGAATACAT
TAAGGTTTATTTACTGTAAATGGAAATTTGATGCAGTCAGGAGCCTGGAATCAGAAAGGC
TACATAACAAAAGTGTCTTTTTAATAATGAAGCTCACCAATACTGGAAGCTGCCGGAAAC
AACCATGTGGACAAATGAAATGTCTTTTGTCTGCATTCTGCAGCCTTCCTATAAAAATTG
GAGGTCTCTGTCTGGCTTAAAGCAGCTGGCTAAGCCTGATCGTTCCCCTCCATACAATAC
TTCCTAGCATCTTTCATGTTTCCTTGGCATCATCCCATCCAGTTTAAAGTATTCTCTAGC
CCACTGTTCTGAATTGTGAGGGAAAATATGCCACGAGGCAGCATTTGTAGTTATCATGAC
TGAAATTTCTGGCAGCTAACAGATATGCAGCTCTTTATTTTTCACTCAAGGCAAACCAGG
TAATGACTTTTCCATAAAGAGCAGATTCTTAGAAGTATAGGACCATGTGTACTGATAATT
GAAGGCTGGCCGTTCCACAAGTTCCTCATTTGTAACTGCCTGTTGACTCTGGTAGTTTCA
AATCAGAATCAAGCAATCAACTATTTTATGTCTGCCCCTCTGGATTGTAAATTCTTTTTT
TTTTTTAAAGTATTTGTTGGGATCTTACAATAAGTCAAAAACTCTTCTAAGCACTGAGGT
AGATAGATATAAGTGAACTAAATCCTTGTGGGCAGGGAACTTGAACATATCTACCTACTT
GGGTATATTGTCCCTCCTAAGTGCTTAGTACAGTTCTCTGTACACCATAAACACTCAGTA
AATGCAATTTATTTATTGATTGGTTGAAAATGTGGTTGTATCATGAATTGTCATCGGTTG
GGATGCATTTTCCCACAGGCTTCCATGTTCAGAATTGAAATCCCTTCCCATTCCAGAACT
GGAAAAGTAATAGGATGTTCCCTCACCTGCTGCATACTGAAATGATAAATATCACTGAAG
CATTGTTTGTCTTTATTAAACCAATTTGAAGCAAGAATTACAGTATTGAATTAACGAAGA
GCTGTAATGTGATTATAAGAGTCTTGTAGGAAGCTGCAGAGGTAGAAGCTAATTGTGAGA
CTATTAGTTTTTCAACTTTAGTAAAGAGTTCTTTTCTTAAAACACCTTGTATGAGTAGGA
TCAAGCAGTACATATTGTATTCCCGGGATGTTTGTGTCTTGGGATCATTGTAACCCCAAG
GTGGTTGGTACTGCACAGCAAATATTGGGTGTCTATTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved