Ornithorhynchus_anatinus Locus ENSOANG00000022462
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000022462
Ornithorhynchus_anatinus
ENSOANG00000022462
Ultra336
SNORA31, SNORA31
2532..2661, 3427..3557
4947
CAGTCACACAGGTGAGAAGTGGCAGAGCTGGGATTCGAACCCATGACCTCCGATTCCCA
AGCCCGGGCTCTTTCTGCTGAGCCATGCTGCTTCTCATGGGGATTAAGACTCTGAATCCC
ATATGCCACACGGACTGCGTCCCGCAATTTAGTTTGTATCTACCCCAGCACTTTGTACCG
TGTCTGGCATATAGTAAAGGCTTAATATACCTTAATATAGGAAATCTAGAAACTTGGTCC
AGTTGTTGGATCTGAGTCTTTGGTTCTGAGTAAGAGTGAAGGTAACTTAGCCTTCTGAGT
AGAGCAGGGGAAATTTTCCCACCCAGGAGCTTCTCAGCTCTGAGGACCAGTCATTCAGTT
GTGTTTTTTGAGCACTCACTATGTAGGAGCTCTGTTCTAAGTGCTTGGGAGAGTACAATA
CTCCAATAAACAGACACAGTCCCTACCCCCACAATCTCCCATTCCAGAGGTGGGGAGACA
TCCCTTGTGCTTTGGAAAGAGTGGTGATGTGAGTTTTTTGGGTTGGGGTAGTTTTTTGGG
TGGGTGGAAGGGGGGTTTTGGTCATTTTTGACCAGATGACTTGCATGTTTGATGGCAATG
TCACCACCTCTGTTTTACCACCATAAAAAAAAAGTCATGCCCATTTCCCTTTTGAAAACC
AAAATCTGGAAAGGATTTTTGCTGGCAAGTTGCCTTTTCTAGAGATGCAAAGTTAGCTAT
GCTTCATGTAAATGATGGCTAGATTTCTGGTGTGACAAAATCCGTGATTGTAAGATTGTA
AGTGGGCATGGAATGTGGTGTTGTACTCTCCGAAGTCCTTTGTACAGTGCTGTGCACAAA
GAGAGCGCTCAGGTGCCAGTGACGATAAAAATGTTGTTTTCTCTGACTGAGATGAAAATA
TGGAATTTAGAGATGAGGCTTTATGTTTCTAATAAAATGTCTTTTGTTTTAGAATCAAGG
GCAGACTTGAAGAACAGAAGCCAGATAGAGTAAAACCTTTCATGACAGGAGCCGCAGAAC
AAATCAAACACATCCTTGCTAATTTCAAAAACTATCAAGTGAGTATTTTAACGTAAGCGT
TCAGTAAAAGAGTTTAGACAGGAGGGTTACTTGCTCTTCAGTTACCCAGTGTTTTATGTT
GATTGGGGTGGGGGCAAAGGGCACCTGGAATTTAAGGGCATTTAATGCTGAGGTTACAAG
TTCAAATTGCCTTTGGGTAGGCTCTCACCGTTCGGTTGTTCCCCAGACTGGTGAACTGGA
AGCCTAGGTGCAAAGTTTGGTACTTCACAGTAACACCTGTTGGGTTTCCAAGTTCTTTAT
AGGCGAGAACATGAATCCCGATGGCATGGTGGCCCTGCTGGACTTCCGTGAGGACGGCGT
GACCCCCTATATGATCTTCTTCAAAGATGGCTTAGAAATGGAGAAGTGTGTAAGTAGAGC
TAAGGAACTTTTGTCCTCCAGCTTTTGAGACCCAAAAGTGAGCAGCTTTTAGATTTGCAT
TTGCTGGGCCTGCTAGGAATGCAGTGCCTCTTCACTCTTTAATGAGGGGGTGTTTGAAGG
TGATAGCGTTCCAGGAGATGTAGAAAAGATGAAGTGTGCAGGCCGTCTCTCAAACCCAGC
CCTGCCCTCAGTGCCCCCTGGTTGAAAGGAGAAAAGGGATCAGATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTTCTGCTTGTAGAGACTCCTCCAGGAGCCGGAGAATGGGCC
GTATTCGGGGATGTGGTGTCTTAGGGTGGCAGGATGAAGTGGGGCGTGCCCCTGGGGCAT
TTGAAGTGGTGGCACTCCTGACCATCCTTGGGAGGGGGCGGAGATCATACTCAGGTGCAA
ATCTTTCAGGCAGCCTGGTGACTGAGGCCCCGAGCCCCCACCATCCTGCCTCCCTGATCT
CAGTGCTTGCTCTGTTCCTCGTCTGGTGGCATATCAGAGTGGCAGCCATGGCGGGAGGGG
GCAGGTCACTTGGGACTACTTATTTCAGTGCCATCAGCAGGCACAAAAACCCAGGGAAGT
TGACGAATGGTTAAAACTTCTGCTTCCTACTGGACTGACCACTCACCTTCTCACTAGATT
GTCATCTTAGTGAGAGAACAGCACCACTGCTCTCTGTTTTGGAGGGCCCGGTTATATAAC
ACTGACATTGTACTACAAGAACCTGTTTAATTGATCTCCTTAGCTTCATACATCCCAAAT
CCTACTCTGTGGCTTATGACATTGTTCGGATGTGCCCAGGGAAATCCCGGTGTCAAGAAG
GAAAAGGTCTGTGGGTACTCAAATGGCATTACCCCTATGCCAACTACTGTCTGAATATGT
AGCTAGGGTTGCCCGCATCTACTGATAGACCGTGAACAGTTCTCCGTTGTTCTTCTGGTT
TGCACAATGATGCGAAAGAACACTTCCTCGCACTTTCTGCCTGCCTTGCGTGGCCGCCCA
GATTGAATCGGGGAGTACAGCTGCCATTCGGAACTCTGAGACTCTGTCCGGTTTACTTGC
CCGATGTTTAAGAGCCTCCCTTTCCTTTCAGTAACCAATCTGGCGGATTACCCTCGGTCA
CCTGTCATCCACTGGCTGCTGCTTTTCTTCATCCACACAAAACCAGGACTTGGACAAAAC
CGGACTGATGTCATCTTGAGCTTTATTCATTTATTTTGACCTTGATTTATTTGGAGTGGA
GGCATTGTTTTAAAAAAAGAAAAAACCATGTCATGTAGGTTGTCTAAAATAAAAATGCAT
TTAAACCCATTGGAGAGAATGCCTCTTGATCTAGTGTACCTAGGCCACCAGATTCCGGTA
CCAGTGTGCCCTGAGGCTGACCCGGGGCCTAGCTGGCTTTTTGGTGCTTGATTCACCTGC
AGTCTACAGTTGTTCCCTGGCAGCCTGCCAAGGCAGGAAGCTTTGGGAGCACCTTTCCTG
CTGCTTGGCCACCTCACTGGGACAAGAGGAGGCCCGGGCACCAAAGCTGACAGATGGAGC
ATCTCTTCCATCAGCGCCTACAACTAGCTGCCCTGGGAACTCTGCCTGAGGTCACCAAAA
AGAAGTACGATGGAAAAAGGTAAGATGGCAAGTATCCCGGCACCGGTTATTTATTAGGGT
GGCCAAGGGTAGTGAGCAGGCAGACACCCTTACCGTCCCCCGAACCTGCCGTCTGGGGCT
GGCGACCCACTGACCAAAAAAAGTGGGTTGACCAACTAACACCTTCTGAGCCTCCCAACC
CCTCTAACTGCATCTCTTTGACAGGCCTGGGGCAGTTCCATCTGCTTTCGTGGCTCCCAC
TAAGATGCAAGAAAAAATTCCTCGCGCTTTCTGCCTGCTTGATCTGTGGCAGTCCAGATT
GAATAGAGGAAGACAAGTCCTTAGAGGAAAGGTGGATTCAAGACGGGTCTTCTGTCTTGA
AACTCTCAGGATTGGAGTCAGGGGAATGGGTTGAAGAGTTCATTGGACTCCAGCCAATGG
TTTAGCCCATTCATAAAACAGTCCCTTTCCAAAGCATTTTGCACTGTTTTCTATTGTAGG
TCATGAAGTTTTGTGATTTGAAGGTGAGAGGTAATCTTTTAAAGCTCCTGTTTGGATAGC
CAGGGTTGGGTATGGCTTTGAAACGAAAGATTTATTCCTGGTTTGCAAGACTTGGACACT
TCCATAATGGCAGCAGGGCCAAGAATGCCTGCAAGTCTTCTTTTAGTGATAGTCTTTTTG
ATTGCTTCAGTAGCCTAAGCACAAATGAAACTGCAATAAAAGTCTGTGTCTAAAATGAAC
CTTAGTTTGTCTTCATTTGACAGAACTGACTTCCCCACGGGGGTAAGGAGTGACAAAGAG
GAGCCAACGGGCCCTGTCCGCATTCTGCTTCCTCCCTCCACCTCTCTCCATTCTAGTGGT
TGGTGTGGCACGTTTATTGAGCTCTTACTTGGGGTGGTGCACTGTACTAGGTGTTAGGGA
AGTACAGAATAAAATACACTGTGGGAGACAAATATGGATATTGTAACTTGAGTGGCATTG
AGCAGTGTTAAATATACACACGCCTCCTACTGAGAGTCCCATCTGGGCCAAGGGACTCAT
TACCCTAGTGCTTAGAAAAGGGCTTGGTTTAGAGTAGCCAATTGATAGTATATATACACA
TGCTCTGGACAGTGAAAATAAGTTCATAGGTGAAGGGGTGATACCCCCCCCCCCAATATG
TATATATATGGCTTTGGGTGCTATTACCTGTTTGTTCATGTGCTTTCTTGCCAGTTGATG
CTCTTGCAGTTTGGAGTTCTTTGAACTAAAGATAACAATTCTTTAGTTTTGCTTAGAAGT
GCACATCTTTGTTACTTGCAATTACTGGCTGTCTCGTTCACCCTGTGGGGTGTTGGGTCG
CCAGGCACGAGAAGGGCACCCAAGACAAGCTAAAAACTCTTCCTGTGAGCAGTCCTCAAG
ACAAACTGTGGAGAGTTTTTTGATCTTGTACCTTCCCCAGTGCTTAATGTAGTGCCTGGC
ACATGGCACACAGTAAATTCTTGTTAATAATAGTAGAGTTCAAGTAAGTGGCAAGTGCCG
GGGTAGATTCAATATGATCAGCTTGGGCACAATCCCTGTCCCGCTTGAAGCTCACAGTTT
AAGGGAGAGGGACAGCAGGTGTTCGGTTCCCATTTCACAAATAAGGAAATAGGCCCAACA
GAATTAAGTGACTTACCCAAGGTCATTGTGAGCAGGGAACTTATCTTCCAACTCTTATAT
TGTATTCTCCCAAGTACTTAATACAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1057, 1312..1428, 2731..2947
1001..1057, 1312..1428, 2731..2733
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved