Ornithorhynchus_anatinus Locus Poly:SNORA40
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA40
Ornithorhynchus_anatinus
Poly:SNORA40
Ultra29
SNORA40, SNORA18, SNORD5, SNORA40, SNORA8, SNORA1, snoZ40, SNORA32, SNORA25
1721..1846, 2532..2662, 2815..2884, 3461..3589, 4507..4647, 5002..5137, 5697..5769, 6052..6167, 6316..6444
7569
CAGTTCCCAAAAGGGCGGAATCCAAAATGGTGCCAAATGGAGAGGAGAGATTTGTGGGG
TTAAACCAGCAGCCTGAGGAGACCCCTCTTTTCGGAAGGAAGAAGTCCCTTTGTGAACCC
GGAGAAGTGCAGGTGAACGGAGCTGCGGAACAGAGTGGGCCAAGTGTGGAGGAAGCACCC
AGGAAGAAGAGAAAAAAGAAAAAAAATCAGGAAGTAGGAGACGTGTATACAGAACAGATG
GAAGAGGGGGAAACCCTGAGAGCTTCCCAAAAGATAGAATCCCAAATGGTGCCAAATGGA
AAGGAGAGATTTGTGTTGTTAAACCAGCAGCCTGAGGAGAGCCCTCTTTTTGGAAGGAAG
AAGTCCCTTTGTGAACCCGAAGAAGTGCAGGTGAACGGAGCTGCGGAACAGAGTGGGCCA
AGTGTGGAGGAAGCACCCAGGAAGAAGAGAAAAAAGAAAAAAAATCAGGATGTGAGAGAT
GTGTATACAGAACAGACGGAAGAGGGGGAAACCCTGAGAGCTTCCCAAAAGATAGAATCC
AAAATGGTGCCAAATGGAGACGAGAGATTGGTGGTGTTAAACCAACAGCCCGAGGAGACC
CCACTTTTTGGAAGGAAGAAGTCCCTTTGTGAACCCAGAGAAGTGCAGGAGAATGGAGCT
GCAGAACAGAGTGGGCCAAGTGAGGAGCAACCCAGGAAGAAGAGAAAGAAGAAGAATCGG
GAAGTGGGAGGTGTGTATACAGAACAGATGGGAGAGGCAGAAACCCCCATAGTTCCCAAG
AGGAGGAAATCCAAGACTGTGCCAACTGAAGAGGAGGGATCACTGTTCATAGACCAACAG
TCTGAAGAGGCCCATCTCTTACCTGGGGAACTCATGCAGAATAAAGCACTGACCGAGGCG
AATGGAGCTGTAGAACAGCGTGTGCCGAGACAGCAGGAAGCAGTAGCCAAGAAGAAGAAA
AAGAGGCGGAAAACACAGGTAGACCAACCTGCAAATTGCTGAGGGAAAGTTTGATTACTC
TCCAGGGACCTAAATCCAAGAACACATATGGCTAGAACAGCATGGGCAAACTGAGGAGGA
AGGGGAATCAAAAGCATGTTGGAAGGCCACTGATGCAGAGCAGTTTCCACAGATTGAAGA
AGCTGAACCTTACCAAGAGAGGGCCAGACTTAGAGATGAGATGTGACTAAAAATGGAGAG
CCCTCCAGAAGGGCACGTGCAAAGAGAAGAGACAGGTCTAAAGAAATTGTAAATTCATAA
GAAAGCATGCAGAAAACACAAGGGCGGAGAATCAGAAATTTAAAATCTGACAACCGAAAG
GAAGAAACCCTCTAGAGAAAGGAAGCAGCAACATCTAGAAAAGCCAAAAGTACAGGAAAC
AACCTCTTCAAAGAAATGAAGACGAAGAAAATGCATTAATTCAGTAAGCACTCTAAGTAT
GATAACTTGAGGATGACAGGTTGATTTGTTCCTTAAAGTGAATGAACGTCTGTCTATCAA
AGGCCCTGATGTGATGAAAGGGACAAATTGGTCCTGCACATGGTTGCATATGAGTTGATT
ATTCCTCCCACATCCCCTTGCTAAACTCCACACCCGGCCGCATTTTCGTAACCCCCAAAT
CCTATTCTCTAGCTGCCCAAGTGATATGGAGATACTCTTTATCTTTAATGCCATCCTTAC
GTAGCGTAGACAGGGAACAAGTCACATCTGCCTGAATGACTAGCACTTCTCTTGTTCTTG
TTCAATCTGGGGACGAGGACTTAGAAAAAGTGCTCAGAACAAACCCTCTTTTGCAACCCA
CAGTTCATGGCACAGTATGAGCTGTGGTACATATAAGGAGGGACACCTTTAGCAGAGCTT
ATGACAGTGACATGAACTAAAAGGCTAAAAATGGAAAGCCTTGTTGGGGCGGGGAATGGG
GTCTCACTATAAGGGATTCTGCTTAGGGTAGGCCATTAGATTTTCTTGCCGATTTCCTCA
GTGTTATTTGAAATATTTGGGCTCTATTGTGAGCAGCGTACTAAACGCCTGAGAGACTAC
ATTGGCATCTTTATCCGGACAGGCTAGCCTAATAAAAGGCAGGAGTAATAGTGGGATCCC
ATTGTATATCTAATTATGATAGCATGTCATGTTACAAATGCTATAAACTTAATAGTCAAG
GCTCAGTGCTATAAAACTGTTAACCTGGGTTTTTCTTTCCCCGTAACAGGTATTTGCCTG
TTAAGGAATCAGAAACCGGATGATGTGAGAACCGAGGTTTGCTAAGGTAAGAAGTTCTGT
ATTGTACTCAAGCGCTTAGAACAGTGCTTTGCACATAGTAAGCACTCCATTGATAGCCGT
TCCCCTACCTTTGTGGGATGCAACTAGCATTTGATCACATTTAAAACTCGAACAAAGAAA
CTTGACCTCCGTATTGTAGAAGTTTGTTCTTGCCTAACTTACCTGCACGATGACAATGCA
TTGGATTTTGGTTTCTGCGTCTCAGCTCCGAATCACTTGTTTTCAGCATCTGAAATGGTT
CTCGAAAAGGCTTTTGAGGTCTATCCCGATGGGACCTCTCATAGGTCCACGTCGTTGGAA
ACGCCTCAGAGAAAAAAGTTGTGGTCTCGCTTTACCTACCGAACTGTGTGTTGGATCGGT
GGGGGAAAAGCCACAAGACAGTTCTGTAAGTGTAGGATGACCACCGTGGTAACGGATTCA
GCGTTAACCGTAGACGAATGATTCTGTTGACAGAACTGCCGGCCGTTGAAGCTTGAAAGA
CCAGCACTGCAGGTAAGAGCGAGCGGTGGACTTTGGCTAGCTTGGCCGCATTGCCATTCA
AGTGATGACATTATTGTTCAACTGCTAAGTGATGTAGATATGAACAAAAAGGAATTCTGA
GGGGTTATGGGAATGCAGCCCATCACTTGGGGACATTCAGCGGTGTCATCCGGGGCTGAT
AAATGACCTAACAGTTTAATCTCCTTTTTTTGGTTTTAGCTGGCTTTAGATGGATTGAAT
GAGATTTGAGTTCATTGCTAGTCGCAGAGGGTAAGTTGCCAGTTTGGGAATCTACCGGAG
GACTTTTGGAAAATAGGAATTGATTAGATTGCTGGGGGGGGGGGGGGAGGACTCTGCACT
GTTCATTACCAAACTTGCTTGTCTTGCCTATTATATTTGATTTTATTGCTCACACTGTGT
ATGAGGTGCCTTTAATCTAAATGAAATTTTTAAGCGCTTACTATATTGCCGGGCATTATT
CTAAGCACGGGGATAGACGCATAGTCAGTGTCCTACACGGGGCTGACAGATAAGGTTGGA
CATAGTCTGTGACCCACATGAGGCTCAGTCTTAATTGGCTGTATCCATCCCAATGCTTAG
AACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAACATTATTATTATTATGAGGG
CCCCTTGCTTCTGAATTAAGATGTTAATTAAGGTGTTTCTAAGCACATCTCGTTGAATTT
TGTTAGTTGCTCTTTAACAAAATTTGTAGATGAGTGCTAAAAGTAAGCCCTCTCTTGCAA
CCCACAGCTGATTCATTACATAAGTTGTGTTACTAACTAAGAGGGACAACTAAGGAATAT
ATCCGTAGCCATATTTACATAAGTAAAATACATGTGATTTGTGTGTGCATGTCTGATGTA
AATGACCACATAAAGAGGATCAATAAGTCTGTCATTCTTGTGTTCTGAATGATGCCTCTA
CTGTGAAGGAATACACTTAAAACTAAAGGAGATAAAAACTCCAGATAAATTTGTCAGCTG
GCTAGTCTGAAGGCTTCAAGGGTGCCAGGTATGGACATTTCGAACAAAGGCCTCCTGAGG
TTGTGGAGAGAAGCAAGGTGGGTTCTCCCCACTAGGTAATGGGGCTTTACCCCCTCACTC
AAGGGCCTCCCTCCTAACTGTCCTTAGTATCTACATCCTTGATGGACTGTTTACAAGTTA
GATTGTAATTTGCAGGTGATAGTCACTGTAGAAATTCTTTTGAAAAGTGCTAACTAATCC
ACCTTTCCTCCACCTTCAGGTCATTTGATTCTAATCAAGCTCAAGTTTGAAGACCAAAAC
AATCTGTTACGTGGGACAGGTAAGCTGTCCCCACAAAACCTGTTCTATAATAACCTAGGT
TTTGTTGGTTGCATCTAGTGGAGATCTATGACTGGAGAGAGTGATTTAATAGACTTTAGT
AACGGCAAGGTTGACTCCCAGCTTTTGAGAGTCCTGCTGTTTCAGCTGGAGGAATGGAGG
AATATCGTTGTCAAGGCAAGTAAGAATTTAAGACACTAGATAATTGCTTTTTGAAAGAGT
CCAAGTCCAGTAACTTCTGGACTGTGTGAAGAAACAGTCTTCTTCCTTCTGTTTACTTGG
GAAGAATAGATTGAAATTCCTGCCCATAAGGAACTTAGCATAAAAATACTTGCAATTACA
GCCAGGGAAATTGAACAGGGGTCGTCTTGAAGGTTCCCAATTCTCAAGTGGCCACACTCC
AATTAGCTGCACTGTATGGTATCTACACCCAGCAGTCTTTTTCCTGGTGGGGTGTTCAAA
AGCCAGTGCTAAAGGAATGCAATATCTGGCATCGTTGGTTTCCTTGCCGTTCGTGCTTGT
TAAACCTGGTATTTGTATTGCTACAGGCCCATTTAAATGCCTAAAACGTGATGAGTTATA
CTATGATCTGGAGAGCTGACGTTCCCTCTTTTTTTAACTAGGTATTTCAGTTCAGTGTTC
GAGTCCACCGGTAATCTACTACTTGTAAGTATATTCGAGTTTATAAAGGTTGCTAAGCTT
TTCATCTGAAACTTTATCAGTTGGATGGTCTGAAGTGCCACCTTCAAGCAACTTGCTTAA
GGGAAAACAAGCTATTGCCATATAATTAAGTGGTTACTGTGAGCACTCCACTAAGGGGGT
ACTGTAGTTTACTTGTCCAACGTGAGCCCATTTGTGGGTTTTACATAGCCACTGTAGAGC
TCAGTGAACAGATGGCTCTGCCTGCCCCATTCCAAATATTCATGGACACAGTTCATGTTT
GTGTCACATGGAACAATGTGGCTACAGTGAAAGCACAGGTTTTGCTTCCATCACAGTAAA
AATAAGTTACTCTGGTGACAATGAGACCTGTAACAGGAATATTTGCCCAGTTATTTAGAT
TGGCAGTGTCAGAAACAGGGGTGACTTCTAACTTTGCTTGTAGGGTTATATACTGGAATC
CCTTGGAGATGGCAGAGAGATCGGAAGAAAGTAAACAATGGTAAGGAACCTCAGTAGCTC
ATTTGGGGGGCGGGAGGGGGAAATTACTGCCTAAGCGGGAATTTAACCATCTGGCGTCAG
TTCGGGGGTTACTTACATGGCATTTTGAAGTGATCCGGACAGCCGGATCCTGAAACTCCC
CTTGCTCAACCTGGGACCGAGTGGCGAGTTCAAAGCCTAAAGTACAGGGAGGGTTGGCTG
GGCTGTTGTAGCTGGCCATTAATGACATGGCGTGCTGTGGAATGAAGCTTAAAGTGGCAG
GCGGTATGGCGGTCTGTACCCGCTCCAGTAATAAAGCTGCCTGAGGTTTGGGGCGTACCC
CTAAGCTACTTGAAAAGTAGCCATAAGCTAAGTCTCCATAGTCTCTCCTCTCAGACTGGA
GCTGTTCCACTGTTGCCAAGAAACATTAAGCCTTCGGGCTTATAGGGAAACATAAGGAAA
TGTTATGATGATTGGCCAAATGTTCAACTGCTCTGAAGAGAGTGAATGAAAACAGCCTTT
CTGAACATCCAAGCTTGTGGAGAACCTAGGCCAAAGCAGAACTCTGCCAAGTTGCCCATT
CACAATTCACCAAATGTTACTTGCAAATGTAAGAGCTTAGCGGTGGGAGAGGCAGGAGAC
CTGGGGCAAGTCACTTGATTAGTAGCTCTCAGTTGCCTCATCTCAAATCTTTTTTCCTTC
ACAGATATTTACATCAGCTCAAAGCATCTGAACCTGGCTGGAAATGGAGTACTGTGGCAG
GTAAAACCCTTGAAAGTTTCTTATGCAACTGGGCTTGTGTCCAGTATTTGTCTGGTCATT
ACCAAGGCTATTAGAAGCACAGTTTCTGATTTGCTGTGGACATGACCGTAGAATAACTCT
CTCGGTTTTAAATGGCTATATTATTAGCACAAACCTGGAGAGACATGCACCTTTTAAGCT
TTCCTTTTGGAACTTCGGGCAAGCTTTCACTCATTAATTGAATCTATTCTGATTTAGGCT
TGTGGACAAGTCATGCTCCCCTGTGTGACGAACATGGTGCTAGAGTTTCAAGGTTAGTTA
AAATTCACTTAGGAAGAGGTCATTTCAAAGAGGGTTCGTATGGCTGTAAAACCAGCAGCC
CTTAACGCGATGACCTAATAGGAACTCTCTACAGGTTACCACTCTCACTAAGTAGTGCAC
TGTGGTTTCCTCCTGAGACACAGTGTCCTGTCCCATGCTGCAGTTACTAATTTCTTTGTT
CTTTTTCAGGTCACCAGGGCTGGTGCGTTTGTAGAGAGCATCCCAAACTCTTCGATTAAT
TAATAAAATTTATTGTGTTGGTTAAAATTTTAGTATGAGTTTTTGGCGCGTAGTTTCTCG
AGAGTTCTCTGTAAACAGAAAGACAATCAGTCAGCATAGAAGATTCTCCCCTTGCCTTTC
TCCTCCAAAGCTAAATGCTGCCCATTCTCATTCCTTACCCTGTGAAATTCTTTGGCTCGG
TCCCTGGTTTTAGAAGTCACTTCCTTTCTTGCCTTCTCATCCCTCTGGTGCCTGTAAAAG
GATGATTACAAACGCTACTGTAATCAAGACAGGCCGGGTCCTTCCTCCTTCCTCCTTCGG
TCACCCAACCTACCTTAGAGGATGGTGGTGTAGGAGTGCTTCGGGGGCCGTCTTCTCTGG
GGAACATACTTTAACTTCACTCACTTTCTGTAATGCTGGACCTGGAGGTAAAACGTCAAA
ATGGAAAATTATTTTGGTGGTGGGGTGAATGGCAAGTGGTCCCGCTAACCTCATACTGGC
TTCATAAAAACACACCTGAGAGCCTCCTCTGGGAAGGAAGGGTTTCAGGTGTTCTCGCTG
GGCTTCCTGGGGTCCAAATTGAAATTCAGAGAGAATCAGAAAGTGTTTTCACTTCAAAAA
CGGAAGATCTAAGATTCTAAGAGCTGAGAATGTCCCTTTCCGCCCTCCACCCCCCAAGAA
CCCTCCCAGTCTGTCACCCCCACAATAGGGAATCATGAATTACCCGCAGGCTGGTTATAG
GCTGAGGTTCCCTCTTGAGGTGATGAGGATGAATCTACTTGTGGGTCCAGGGGTAAAAGT
TTTCTTCCCTGGGACAAGAAAGAGTGGTTAAGAAAGAGGCCTGGACAATATAACAGGAAA
ACTTGCAACTGGCTTTTACCATCCGTATTCACCTGAGAACTGGTCTCCAGTTTGTCCTCC
TGCTTTTCGGGCTCCAAGTCCACATCAGCAATACTGACATCAGTAGAGCTGATTACAGTC
AGTTCGGGTTCTTCCATAATGCCAAGCCCGGATTCCGTCTCCTGAATAATAATAGTGTTG
GTATTTGTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved