Ornithorhynchus_anatinus Locus Poly:SNORND104
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORND104
Ornithorhynchus_anatinus
Poly:SNORND104
Ultra288
SNORND104, SNORA76
1001..1066, 1293..1426
2426
GCTTTCCCTTGCATCACCCAATCACACGACGGTAAAACTGCTGCTACTCCTGAAAACTT
TTTCCACCCCTACAACCAACAGAAATAATAAAAATTTGCCCCTAATCGGGCCTACAGGGA
CTATCTCCAGCCGCCCCTCTCTCCCTGGCTCCCCGCTCTCTATGATCAGCATAGAGAGCC
GCTCTATCCGCCGGAGGACTGAAGCCTCTATGACCAGGCGCACCTCACGTGGACTCCGAT
CTGCCTTTCTATTGGTTGGTTCCGGGCGCAGGGGGCGGGGCGTCAGGCCCCCCCTATAAA
TATCGCTTAGGGGGCCGCTTTTCGGTCTTTTTGGGAAGGGAGGGCGGGTGGGGGCAACCG
GTCCTTTCTCTGGCCTTAGTAATAATAATTATTATGCTGTTTCTTAAGCGCTTATTATGT
GCCGAGCACTGTTCTAAGCGCTGGGGCTGATACCAGGTCATTAGGCTGTCCCACGTGGGG
CTCAGTCCTGATCCCCATTTGACAGAGGAGGGAACTGAGGCCCAGAGAAGTGACTTGCCC
AAGGTCACCCAGCTGACACGTGGCGGAGCCGGGATTAGAACCCATGACCCCTGACTCCCA
AACCCGGGCTCTTTCCACTCAGCCACGCTGCTTAGGCCTCAGGTGGGTGGTCTCCCCCTC
CCATTCATTCGTTCAATTGGATTTATTGAGCGCTTACGAGGTGCAGAGCACTGTACTAAG
CGCTTGGGAGGTACAGTTGCCCCCGGGGGGGGGTGGTCCCAGAGGGGCTCGGCCCGCCTT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACTCAGA
CCACGCTGGCTTAGGCGCCTCAGGTGGGTGGTCTCCCCCTCCCATTCATTCGTTCAATTG
GATTTATTGAGCGCTTACGAGGTGCAGAGCACTGTACTAAGCGCTTGGGAGGTACAGTTG
CCCCCGGGGGGGGGTGGTCCCAGAGGGGCTCGGCCCGCCTTGCTGTGATGACTTCCCTTG
AAACGTGTTAGACTGCTGATGCGAATGATGCCACTTCCAATCTGAGCCCAGGGCGGGCCG
GGGGCGAGGGAGCAGGGCGGCCCGGTCACCCAAATCCACCTGGGGACTCGCTTCTCACCT
CTCTCCTTTTTTTTTTGCAGCTCCTCGTCCACCGGACCGGTCTCCCTCTGCCTCGTTCCG
CCCACCTGGGGAGCAGGGAGATCCGCTTTGGAGCAACTGTTAATAAAAGTGATTTAAAGA
AAAATGGTCTGTCGCCTTTTGCTTTATTCGGGTGCACTGTCTTTGAACCCATGAAACGCC
TCGTCCGTGGCTTGATGGGCTACGCAGCGGTGCAAAATTATGAGCTTGTTTATAACTGGG
GCTGCTTGGTCAAACCCAAGTGGCTCTTTTAAGAACAAGTGACATTTTTAGCAGACAAAA
CCTTGGCTGTAGCGCGAGGGGTGCTGAACCTTAAGTATAGTTGGGTTTGTTCGGGGGCAT
GATAGCACAACGTTTGGGCAAGCAATTACTTCTAACCCCCATCCAATAGCAATTTCCAAC
TAGGCAGCATGGGGAGAAGGCTGCAGCAGAAATAAAAACAAATCTACATCTCCAGCCCTC
ATTGCTGACCTCCCTGCTAACTCCTTTCTCCCTATTCCAGTCCATGCTCCACTCTGCTTC
CCGGATCGCCGTTCTACAAAAACGTTCAGGCCACATTTCCCCACTTCACGACCTCCATTC
ATTGCCCACCCACCTCCACATCAAACTCCTTACCATCGGTTTTAAAGCACTCAATTTACC
TTGTCCCCCACCTTTCATTCAATCAAATCGTATTTACTGAGTGCTTACTGTCTGTAGATC
ACTGTAACAAGTGCGTGGGAAGCAGCATGGCTTGGCCCTCAGAAGGTCATGGGTTCTAAT
TCCAGCTCCGCCCGTTGTCTGCTGTGACTTGAGCCAAGTCACTTCACTTCTCTGTGCCTC
AGTTACTTCATCTGTAAAATGGGGATCAAGACAGCCCCAATGGGGCAGGGACTGTATCCA
GTCTGATTAGTTGTGTCCACCTGGGTGCTTAGTACAGTACCTGGCACACAGTGAGCACTT
AAATACTGTAATAATTGTTGGGAGTGCAGTTGTCCTTTCTGTCTCCTCCAACTCAACCTG
CACACTTCACTCCTCTAATGTCAACCTACGCACTGAACCTCCATCTGCATTACTGTCCAA
CCCCATGAGCCCTTATCCACCCCAATGCTTAGTACAGTGCCTGATACACAGTAAGCCCTT
AACAAATACAACAATTATTACAATCGCTGCAGATCTATCTATCCCACAACCCACCTCTAG
GTTGAAACATCCTCCCTCTTCATATCCGGCTATTAATCTCCCCGCCTTCAGAGTAGGTAC
ATCCCCAAGAGGCCTTCCCTCTTCCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved