Ornithorhynchus_anatinus Locus EIF3A
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus EIF3A
Ornithorhynchus_anatinus
EIF3A
Ultra272
SNORA19, SNORA19, SNORA19
11071..11200, 11923..12054, 14011..14142
28383
AATTGCGCTTGAGTCTGGGAAGAGTTTTTTTGGAGGACTCTGGCCTCCACGGCCCTGGG
GGGAAAGAAGGGAGAAGGGGGTGATTGTGACTGAGTGCCAAACTGGCAGGGCAGCAGACA
CAGGAAGGCTCTTCCCAGAAACACACTGTACATCCTAAACCTCTCCTCTCATTATTTTTG
CTGTTTTTGCCCTTGTAAAAACATAGAAGCGTAGACTCTAGAATAGAAGTTTAATAAATT
GCAACTGAATAATAGTCTGTTTCTTATGACCTTAGTGAGCTGGAAATACGCTCCAAAATA
TGGATTTGTCTGTTTACCTATTTATCTATAGAAAGCAGACCGCTTCCCTTATGTGGCTAA
TATTCATCCGCTAAATTTCTTGGAAGTCAAATAACCCATCAGCCCATTAAAGCCTACGAT
TGGGTTGTGCATAGCGGCGCAGGGTGTAGGTAGCAGAGAAAAACATTCTATTCATCCAAA
GTTATTTTAGTACTTACTGGCTTCTACCCTGTGGTTTCTTTGGGCCCAGTTCGGTGTGAT
TGCTCTGAGTTGTAGAAATGTTGTTTTTGTTTTCCTCAAGTCAGAATGGAAGTCCGGTGG
AAGACGTGAGACTAGGAGTAGTGATAGTAGGTTCGTATTAAACTCGGAGCTGCAGTTACG
AAGGCAAGTCACGGTGCGTGAAGGGATCTGGAAACTTTTGTGGTTAAATGAACTAAGATG
AATTTAAGCGATCAGAATAATGGTTGATTTCCCTTTTTTCTGTCCCTGGGAAAAGAAAAG
ATAGGTGGGATTAACGATTACCTGCCACATGAGGCAGTCACCCCCCCCTCCAAACCCCTC
TTTTTAATTCTGTATTGAGTTTTGTGCTAGAATCATAATTTTAGCCAGTATGGAGTTAAT
TTCACTTCAGTAATTATGGATTTGCGCTGTTGGTAAATCATTCTTCAGAATAAAGGAAAT
AAAGTTCTAAGTGGGGAATGTAAAATTTAGAAATGGAAGTCGTCCCGTGGCAGTAAGCAG
TCGATTCACTCTGAATTTTGTTTACAGAGTTTCTCGAAGTTGGAAAGAAACAACCGGCCC
TTGATGTTCTTTACGATGTTATGAAAAGTAAAAAACATCGAACATGGCAAAAGATACACG
AACCTATTATGCTGAAGTACCTAGAGCTCTGTGTGGATCTTCGCAAGAGTCACCTGGCTA
AGGAAGGATTATACCAGTACAAGAATATTTGCCAGCAGGTGGGAGTTGTGGAAAATGTTG
GCTCATTTTTGACACTCACCTATTTGATAGGCCTTAAATGGTCACTCGGAGTTCCTGCCT
TACCCCGTGGTTTTAAGATGTAACGTATGGTCCATGTATCGCAGCATAAGCTTTACGCTT
CAGGACGTTTTAGGTTAATGGAATCCATCGACGGTATCGAGCGCTTACCGTATGCAGAGC
GTTGTAGTAAGCGCTTGGGAGAATACGGTACGATAGAATTGGTAGACTGAAAAGACATTT
CAGGTGATTTGGTTTTTTTTCTAGGTGAACATCAAATCCTTGGAAGATGTAGTTAGGGCC
TATCTGAAGCTCGCGGAAGAGAAAACAGAAGCTGCTAAAGAAGAATCCCAGCAGATGGTC
CTAGATATAGAAGATCTGGATAATATTCAAACTCCAGAGAGGTAAAGGGAATAAATCTAT
AATACTTTTGGGATAGCAGTCTGTTTTAGCTGGCCTTGCTAAAGTAGGCCATTATCAAGT
GTCAGGATTTTCAACAGTGGTGCCCAGAGGAAAGAGCACCGGCTCGGGAGTCAGAGGACT
TGGATTCTAATTCTGGCTCTGCCCCTTGGCTGTCGTGTGACTGGGCAGCTCTCTTAACTT
GTTTGTGCCTCAGTTACCTCATCTGTGAAATGGGGATAAAATACCTGTCCACCCCCTTAA
ACTGTGAGCCACCTATGAAACGGGGATGGAATCCGAGTCCCAGCGTTGGGCAGAGAGTAA
GCATTTCTCAGCTACCACAATCTTCCCATAGAAAAATCTTCCCAGCTTAACATACTGTGC
TGTTAACAGACACCATGGTACGGTTTAGATGCGGAAAAAGTGGAAGTTGCATAGAAATTA
ATAGTTGTGGAAGTTAGGACCTCCATTGGTGACCGGTAATTTCAGAAGGTGGCATAGCCT
GAGAAAGTGGGAAGTCATGTTTAACGAAACTTTTCCTTCTGATTCGTAGTGTGCTCTTGA
GTGCCGTAAGCGGTGAAGATACTCAGGATCGTACCGATCGACTGCTTCTGACTCCTTGGG
TTAAATTTCTGTGGGAATCCTACCGCCAGTGTTTGGACCTTCTTCGAAACAATTCTAGAG
TGGAGCGCCTCTACCATGATATTGCCCAGCAAGGTGAAACAAGAATAGGGAATTGGGAAG
CATTTGTTTCACGTTTCCAATATTAAAATATATCGGGATCCTGTTTATAACAGGGCTTGG
GGTTGTTAAAAAAATTGGCATCCATACGATCGGGGCCGTAATAGTTTGAGTTCTCTTTCT
CAAGTCCCAGAATTTGCAGAGTGGGGAAGAGGAGAGGCTTGAGGAATTAGTTTTCCCTGT
CAGTATCCTTGAGGAAAGTATTGCCTGGCCCTTAAACTGAAAACAGAGAGATGGTTATTT
TATTCGCCAAACTTTCGTGCGTAACCCAAACCCAGTACAACAAGAAAGCACTTGATAAAC
CCTAAACGTGACATCTCCATTTTGTAGGTGAGGAGCAGATGAGCTGGGGCTATAACTCAG
GACTTTTCCGCTCACATAAATGGATCGCGTTTCAAGTTGCAGGCACTTAAGGATCTATTT
AGTGAGAGAAAAATAACCCTTTACACAACCTGCACATCAGACCTCAGTGATAGTCGTTCA
GCTTGTCGTCTTTTGTGGGAAATGAGGCTAAGAGTACATTGTAGTATAATATGGTTAACT
GAATCAGATTTCTGGGCATTTTATCAAGCAATTCCCCTATTTCTGGTACCCTAGGTAATG
TCACCACTTAATGGAATTATGAGCATCTTAATGCACTTATCTTAGAGGCCCTGTCAGATG
GCAGCGGGGAGACGATCAGCAGCAATAACTGAGGGCCAGGAGACCGATCGAGGTCATGGA
AAGCTTACCCCTGCTCACCTCTTCGTGTCCCCCGACTGAGCCGGAGAAAGAACCAGTTCC
CCATTGCAGCTTCTTGCATCTGAAGCTCTTGCTTCTTGGGGAGAGCTGCAGGAATGATTT
GTTTAGTTAGACGCTCCAGTTGTACATCCAAGAGTTTTGGATCACTTTGGTTGATTTAGG
TTTCAGGCCAGTGAGTTAACCAACTTATTTAAGGCCAAATGGGACACCAGGTATTAGGGG
GAATGACACTAACTTGGAAGTGATTCTGTACCTTCATACCCTGTAGTACAGACCTGGATC
CTTTGGGGGGAAAAGAGCCCAAATACTTTTATGAGGTACCAGGGAAAATCAGCTGAAATA
CTTTAAAACAGAGTATCATTTCTTAGAATCCTTAAACTTTTGCTAAAAATTTGGAACGAA
GCCACACCCAACTGCCTTGTGATTCAGACTTAAGAATGTTTTCTCTACAGCATGTGTTCG
TTCCCTGAAAATATGAAATTTTGCCATGGGCTGCCATTTGTAAATGGACCACGTGAACCT
GGAGACCCAAATGTAGTTTAAGGAAATTGCGTAGGAATAATAGAATGTTTCCTTACAGGA
CTTTTAGGTTTTGTATTCCACTGTAAGATTGGCTTTCTGGGCGATCTGTATGCTCCTTGA
GAGTATACAGGCGACTGTTGTTTTGCTCAGAGGCGGAATATGTGAGGGTTCCCCTTCCAA
ATGAGCTCCTCTCTCTTCCTAGAAAGCTTACTGTGGTTTAACGGTGTATCGGCCTAAACG
ATGTGCCCTTCGAAATCGAAACGCCTGGCGCCGATGAAAAGAAGTTAACTCATCTTTCTA
ATCCTCCAGCTTTCAAATTTTGCTTGCAATATACCCGGAAGGCCGAATTCCGTAAATTAT
GTGACAACCTGCGGATGCATTTAACTCAGATCCAACGCCACCACAATCAGAGTACCGCAA
TCAATCTCAATAATCCCGAGAGCCAGTCGATGCATCTGGAAACGCGACTCGTGCAGTTGG
ACAGTGCCATCTGCATGGAACTCTGGCAGGTAGGTGGGGAGGGGGTTTATACGGTGTCCC
GGGGAGAACGGGGCCTGTGAAAAACTGACGCCCGTTTGGCAGCAGACTCTGAATTCCAGA
GTAGTCAGTCGGTAGATTTACTAGTGCGATGACTCATAGGTGAGGAATAAACCCCGCTCT
GACTCCAACAGTATGCGTGGCAAAAGCCACCGACGGGAGCGGCCGTGCTTCGGTCGTCAC
GTTTATTGAGTCCTCGCTGGGTGCAGAGCACTGTGCTAAACCTCTTGGGACAGTGCAGTA
GAGCACGATAGGTAGGCACGGTCCCAGCCCACGAGTTGCAGCCCAGAAGTGGGGAGTCAG
GCATTAATAGAAGGAAGTTCCCGATCTGTTCATAAGGGCTGTGGCGCCGAGGATGGGGTG
ACTATCGAGTGCCCAAAGAATACAGTCCCAAGTGGAAAGGTGCGGAAGGGAGGAGGTGTT
TAATCAGGGAAGGCCTCTTGGAGGAGATGTGTGACCCTTAGGGCTTTGAAGGTGGGGAGA
GTGGCGGTCTGGTGCATACGGATGGGGAGGGAGTGGCAGGCTGCGGGGAGGACTGGGGGA
AAGGGCAAGCCGACGAAATAGACGAGATGGAGGTACGGTGAGCAAGCCGGCACTGGAGGA
GCGAAGAGCGTGGGCTGGGTTGGGATAGATGCGAGGTAAGGTAAGAGGGGCCAAGCTGCT
TTAAAGCCAATGGTAAGGAGTTTCTCTTTGGTGTGGAGGTGGGTGGGCAACCACGGGAGG
TTCTTGAGCAGCGGGGAGATGTGGACTAAGCGTATCTCTTTAGAAAAATGGATCTGGGCG
GTGGAGTTGAAGTATGGACCGGAGTGGGGAGAGACAGGAGGCAGGGAGGTCAGCAAGGAG
GCTGATAATGGAAATCAAGTGGGACAGGATAAGTCCTTGCCTCTTGCTGATAAACTCTGG
CAAGTCAGTTCCATATCTGGCTTCTTTATTAAAAAAAAAAAAATCTACAAAGTTTCTTTC
TCTTGCACTTAGCGTGCTAACGGTTTTGTTTTTTTTCTGATTTCCTGATGAAGTGTAATT
TGGCTAAAAATCAGCTCAAGTCTATTGAGGGAAGAGAAGGGAAAACAAGATTGATCTTTC
AAGTGTCCTTTGGACTTCGTTGGTAAATATACCTCTGTTTTTCAAAAGTGAGAAGCAGCG
TGGCGTGGTGGAAAGAGCCCGGGCCTGAGAGTCAGAAGACCTGGGTTCTAATCCCAGCTT
GGCCGCCTCTCTGCCGTGTGACCATGGGCAAGTCCGTGTGCCTCAATTAACTCATCTGTA
AAATGGGATTAAGACTGCGCCCCACATGAGGCATGGAATGCATCCAACCTGATGATCTCG
TATCTACCCTAGTGCTTCCTGCAGTACCTGGCACATAGAAAGCACTTTACAGATGCCATT
AGAATAAAATTCTCCTTTCGAGTAGGGGTTCGGAAACGACTCGACGGCACTTAATAATCA
TAAAAAAAAAATCATTCAGCAGTGATCTTAAATGATTAGACTTGACGTTTTTCCAGTGGT
AGGATTGCCTGAGATAGAACACCTGAATGACCGAGTCTGCTGTCAAACAGTGGATGAGCT
CTTGTCCCGAGAGCCTATGGGGAAAAAATCGATACGGTGGTAATGGCGCGCATAGTTTTA
GTTTGCCTTTGTGTGATTCTGAGCGAATGCTGTAACCTTTTTTTAATACGTGTTTTAATT
AACGAATACTGAATTATAATTATCCTCACAAATGACAAGGCTAAAAAAAGTTGGGGGCTT
TTTTTTTTCCCTTCTAGGAAGCTTTCAAAGCAGTGGAAGATATTCACGGGTTATTTTCCC
TGTCTAAAAAACCTCCTAAACCCCAACTGATGGCTAATTACTATAACAAAGTGTCGACTG
TCTTTTGGAAATCTGGGAATGCCCTTTTCCACGCATCCACTCTCCATCGACTTTATCACC
TGTCCAGAGAAATGAGAAAGAATCTCACTCAGGAAGAGATGCAAAGGTGAGATTTTTCTG
TAGACCTTACCTTCTAATTTAATTGGTTAAAATGCTTTTAAAGCCAGTAGAACAACTTCG
TTTAAGAAGCAGTGTGGCCTAGTGTATGGGCCTGGAAGTCAGAAGGACCTGGTTTCTAAT
CCCAGCTCTGTCACTTGTCTGCTGTGAGACCTTGGGTGAGTCACTTAACTTTTGGGCCTC
AACGACCTCATCTCTGAAAGGACCAACTTCCTAAATAGCCAGTCTCAAAGATGCGGAGAA
GTATTTCTTGATAAGCGCATGCACATCCCTGCGCTTTCTTTTCTATTTCAGTTATCGACA
TCTTTTCCAGATGGAGAGCTTGTAAATTGTTAATTGAATTAGGCTCCTATGGTTTGGGGC
AGCAGGTAGTAAACACTGGGAAATACATAACGTTGACTGTAGAAAATGAGTCGAACCTCA
TAAATTTCAAGTCTTTAGAGACGTCACTGAAGTCTACATTGAGTATTGCTCCAAAATTAA
ATGTAAATCCTAGCAGCCGAGCGTAGGAGGCCGCAGAGACTAATGAAAACCGGAAGACGT
CACGGTTTTATTATACGATAAAGGTGAAAACATCTAAAGGAAAATTGGAATGGGAAAAAG
ACCAGAAGGAGTCAGGCGGTAAAACCTGTTTTTCATACAAGGGTATATGCGGTCAGTGGC
AGCCTTGCAACCTCGCTAGCGTGGTCTGTTGAGCAAAGAGCTGCACGAGGCCTGCAACGG
TTATCTGTCCGTCCCCCCCCCCATCACCGGCTCCTTCCCTTAGTTCTGCCGGGCGTCCGC
TCTCTCCGCCCACTTTTCCAAATGCTCTTTGCAAGCGCGGGCACGGGGTCGATCTCTGGT
TACCAAATGTCTTGCCTCGGTCAGTCAGTCAGTGGTATTTATTGAGACCTTCCTGTGTTC
AACGTACCATACTAAGCTCTTGGAAGAGTACGACATCACAGAGTTGGGGAGCTTGTTCCC
TGCCCACAAGGAGAATAACTTCTTCAGGGGGAATCACTCGGCAATGCAGTTTATTTGCAA
ATTAGGAAGCCCTTGAGGCCCTGTGGAGGCCCTTAGACCTGAGACTCGGGAGACCCGGGT
CCGATTCCAGCTCTCCACTTGCCTGTGGGCTGACTGGGCAAGTCGCTTAACTCGTGGGTC
TCATAATTTCCTCACCCGAAAATGGAGAGAAAATTCATTGTTCTCCTTTTTTGTCTTTAC
AGCGTGAGCCACTTGGGATAGGGACTGTATCCAACCTGATGACTTTGTACCTACTGCGAT
GCTTAGCGCAGTATTCGGCCCGTAGGAAGTGCTGAATGAAAACCATAACTGTTAACGCTC
AGCCAACTGGGCATTTTAAAGTGAACTTTTATCTGCCGGGAGGTGCCTACCCTTTCAGCA
AGTAGTTTGCTGTGATATTTCATCTGTCGCTTAACTCTGCTGAAGAAATAGTTTAGATCT
ATTCATGTTAAACTCTCAGAACTAATTCACGTGATACTTCAGAATGAAGGAAAATGAAGG
GTGACTTCTAAAGTCTTTGCTTGATCTACGAGCAGAGCCCAAGTGTTAACTATGTAGATG
GTTGCACTGAGACAGGCATTTCTCTTGGGCAAACCTTTATGTTGTATGATGTCCGTCCCC
CCCACCTTATTCTCGAAGGCAAAATTCCAAGATTTCACAGTGTAAGAGCCTAATCGAGTT
GGTTCTTGGGTAACATTTTAAATTTATTTTTGGTATTTGAGCATTTACTATGTGCCAGGC
ATTGTACTAAGCTCTGGGTAGATACAAGATAATCAGGTTGGAACTCAGTCCGTGTCCCAT
TTTACAGATGAGGTGACCGAGGCAGAGAGAAGTAAAGCGAGTTGCCCAAGGTCAGACAGC
AGACAAGTGATGGAGCCGGATTAGAACCCAGGTCCTGCTGACTCCCAGGCCCGTGCTTAT
ATTAATGTCTCCTCTAGACTGTAAGCTCATTATGGGCAGGGAACCTGTCCGCTAATTCTG
TCGTACTCCCCCAAGTGCTTAGTACAGTACTCTGCACCTAATAAATGCCATTGATGGATG
TATTTGCTAGCGTTATATGTATAGAATGTCCAGAATTGAAAAGGTTTACGGTCGCCGTAA
AATGGAATGGTTGCCCGTTTTAATGCCACCTGACTTTATTCTTAACAGAATGTCCACGAG
AGTCCTTTTGGCCACGCTGTCCATTCCTATCACTCCTGAGCGTACTGACATTGCCCGTCT
CCTGGATATGGATGGCATCATAGTAGAAAAGCAGCGACGTTTAGCGACACTTCTGGGCCT
TCAGGCCCCACCCACGCGCATTGTTCTTATCAATGATATGGTAAGCATCAGTTCGGGCCC
AGTGAATTCCAAAAAATTTCAGAGTCGGTCAGGCGCTCAAATACGAAGAAAAATACATCG
GGTTCATTTGGATCGATCGTACTAGAGAGCTTACTCTGTGCAGAGCACCGTACTAAGCGC
TTGGGAGAGGAAACTATGACGGAGTTGGTAGACACAATCCTGCCCAAGGTAATTTGGGAA
AGGAGGCGGCCTAGTGGAAAGCGCGTGGACTCGGGAGTTGGATTTCAAGCCCGGCTCCCT
CACGGTACCTGCTGTGTGACCCTGGACAAGTCACTTAAGTTGTGTGCCTCAGGTCCCTCA
TCAGCACAGTACACCCATTATGCCTCCTACTTAGTGAATCTCATGGAACCTGGGACCTGA
TTATCTTGTTTCTACCCCAGCGCTTAGTACAGTGCTTGGCACATAACAAATAACCATTAC
TACTCTGGGGAATTGGGACAACTCCCTGTTGTAAGCCAGAAGCAACGTGGCTCAGTGGAA
AGAGCCTGGGCTTCGGAGTCAGAGCCCATGGGTTCGAATCCCAGCTCTGCCACTTGTCAG
CTGTGTGACTGTGGGCAAGTCACTTCACTTTTCTGTGCCTCAGTTACCTCATCTGTAAAA
TGGGGATTAACCGTGAGCCTGACGTGGGACAACCTGATTACCCTGAATCTCCCCCAGCGC
CTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACGTTATTATTAAATTG
GTAAATACCCTAAAATTAGGAAGTGTTATCTGGAGGCGCTGCTTTACAAATAGCACATTT
GAATTGTGGAATTCCAGTTGGGCATTGCAGAGGAGGTAAGGAAGGTAGATGATTTATTGG
GAAATTGCAGGAAAACTAGTAGAGCTACGGGGATGTCTTCTACCTCCTTGGACAGGTTTT
CCCTCCAGTCCTTCCCAACCCCCTAATGCTCTTGGGTTTCGACTACTTTCTGTACTTCAG
TGGAAACAACGTTCATTTGGTTAAATAGAAATTGCAGTGATTTTTATCAATCAATGGCAT
TTATGTATGATTGCTGGTTTTCTAATTTTTTTTTAAGAGTTGTGGACATTTTCAGGACAA
GGAAATGGAATTACTTTGAGAGTAAGCGATCTGTGGATTTTGAAATGGAGCACAGCGTGG
CCTAATGGATAGAGCTCGGGCCTGGAAGGCAGGAGGACCTAGATTCTCATCCCAGCTCCG
CCACTTAGTAATGTTGGTGTGTGTTAAGCGCTTACTATGTGCCAAGCACTGTTCCAAGCG
CTGGAATAGATAGAAGGTCATCAGGTTGTCCCATGTAGGACTCACAGTCTTCACCCCCAT
TTTACAGAGGAGGTGACTGAGGNNNNNNNNNNAGGGGACCCCCCCACCAAAGAGGGCGTA
TTTCCTCTTCCCTTCCCACAAGGGAGGGAGTACCAGCCAGGATGTGGTTTGCAGCAGAAA
AGGATGAATGCTTTGGACAGAGTTTCACCAAGGCAATCAGGGGTAGGCAAGGGTGCCTCG
CGATGATCACCCCCACATTACAGAGGATGAGAGCCCGCCCAGAGAAGTTAAGGGACTTGC
CCAAGGTCACATAGCTGGCAAGTGCAGAGCCGGGATTAGAACCCATGACCTTTGACTCCC
AGGCCCGTGCTCTATCCACTACGCCAGGCTGCTTCTCACACACTTGTCTGCTGTGTGATC
TCGGGCAAATCACTTAACTTCTCTGGGCCTCAGTTACCTCTGTAAAATCTGTGCGATGTG
GACTGTGTCCAACTGGATTAGCTTGCTTCTATCTCAACTCTTAGTACAGTGTCTGGCACA
TAGTAATCGCTAAAATGCCTTTAAGAATGATCTTTTCACGAATACTACATTCCTAGTCTC
CCGGTATTTCAGATTTTTTTTTTTAAAGAATTAAGGTTAACGTGAAATGCGGGGCAGTTT
TTAACAGATTAATAACGTTTAATTGTATTTTAGGTGCGATTCAATGTACTGCAGTATGTC
GTTCCGGAAGTGAAAGACCTTTACAACTGGCTGGAAGTGGAATTCAATCCACTGAAGCTG
TGTGACCGAGTTACGAAGGTAGGCCGTGATTTTGGAAATGTGTTTTTTCTGTTAGGTAAA
ATACGAGGCTTGTTTTAACCTTATATCTTGTTAGTACTTAATAGTGGAGTAAGCCATTCC
TGGAAAGAAAAGCATTCATTCACAGTGGAAGCGGTCGTATTGTACTTTCCAAAGGGCTCA
GCACGGTGCTCTGCTCGCAGGAAGCGCTCAATAAATATGATTGAATGAATGAAGCAGCAT
AGCCTAGTGGCAAGAGGACGGGCTTAGGAGTCAGAGGTCGTGGGTTCTAATCCCAGCTTC
TCCACTTGTGTGCTGCGTGACCTTGGGCAAGCCACTTAGCTTCTCCGTGCTTCAGTTACC
TTACCTGCAAAAACGGGGACCGTGAGCCCCACGTGGGACAGGCTGATCACCTTGCACCTA
CCCCAGCAGTGCTTGGCACATAGTAAGCGCTTCACAAGGACCATAATTATTATTGTTACT
AATATACGAAAGGCACTCCTTTAGACAAGTTAAGCACATCCCACTGTCTTTTTTTCTGTT
CTGGAGAGGAAAAAAGCAGTTTCTGTTGTGCTAGATGAACTTGAAGGTAAATTAGCGGCA
TGTCTAATGTAGCCATTGGCGTCAGTCCCCTTCATACAATTTTTGGAGAGCCACAGTCCG
AAATGTTAAAGGCTTTGAATATTCTAGATAGCTTTTCAACGCTCAAAGGGAACGATGATC
CGAATAGTTTTGTTATGGTCTTTTCATGTCTAAGTAGCGTGGCACAGTGGAAAGAGCCCA
GGCTTGGGAGTCAGGGGTCATGGGTTCGAATCCTGGCTCCGCCGCTTGCCAGCTGGGTGA
CTTTGGGCTAGTCACTTAACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGATT
AAAACTGTGAGCCCCACGTGGGACAACGTGATCACCTTGTATCTCCCCCAGCGCTTAGAA
CAGTGCCTTGCACGTAGTAAGCGCTTAACAAATATCACCATTTATTTAAGTTGCCGTTTT
CACTTCAGTATGTATATAATTTGGACTTGCTTGATTCTAATTATAGGTTCTAAACTGGGT
GAGAGAACAAGCCGAAAAGGAGCCTGAATTGCAACAGTATGTTCCACAACTGCAAAACAA
CACCATTCTCAGACTTCTGCAGCAGGTTTGAATATTAAGAGATTATTCTAGTGAAATTTT
AATTGATCTAAGCGGTGCTTTTAAAGTCTTGAAGTCAACCCTGCTCTGTCTTTTAGAGAA
TTTGTATTTACAAAAATGGTCTCCTAACCCCCTCTGCTTATCGATTTTGAGATTACTTTT
GGACATTTATTTATTTTCTGTTAGAATGTTCATTGTTGAATATGTGCACATTTCATTGAC
CTGCTTTCATTGCATTGTGGAGCAGTGTTATTTCTGATGTGCTATATAAACTGTTGAAGG
TTAATTAGCAGCACAACTCTATATAGTAAATGCTGCCAGTCCCCTTCAGACAGATACAGC
ATTTAAATAGTTTTCCTACAACAATTCCCTAATCTCCTAACTGAGGATCTAGCCCAATTC
TGTAAAGAAAACATAAAGGCTAGAGCGGGTGTGAGAGTTTCGTTTTTGCCATTGATGTTT
TTCTCGGATGCAAAACGAAAACGATCTACCTTTTTTCTGCAGGTGGCACAGATTTATCAG
AGCATCGAGTTTTCTCGTTTGACTTCTCTAGTTCCTTTTGTTGATGCTTTCCAACTGGAA
CGAGCTATTGTAGATGCAGCCCGACACTGTGACTTACAGGTAAGTGGCACAGAAAGATCA
GAGTACGCAGAGAGCTGTTTCCACAAATCCTAGGAAAAAACGGGGCTCATTCTGTGCATT
TTCCGATGTAGTCTCCAACGTGTTATTCTGGTTGGGTTTTGTCAGAGTAACCTGAGGTGG
TAAACTTGTTGAGGGAAAGGATTATATCATTTACCAGTAGTTTTGCACCCAGCAAGCTCT
CAAAGCCCATGGTGATAACTGAGCTCTTGTGAGTTCACCTGAGTAAATCGTAAGGTCACT
GAACAACTTGCCCTGATGGATCTGAGTGGTAGAGACACGTGTAGCACCAAGCCAACTCTC
TTGGGCTCGATAATTGAGATTATTGAAACCGCAGCTGGGCACCGGTTCTATGCGTTCGTC
ACTGGTCCCCAAGAAGTCCACACTAAAGTGAATAAAGGCAGAGGAGAGTCCCCGGGGCTC
AGAAGAATTATGGGGGAGACTTGAGAACCACCCCAAATGCCTACCTTAAGTTGACCCGAA
ATGACTTCGGCAAATTGATGGAGTCCAGGCCCGCCGACTTGACCGGCTTTGGAGGTCTGG
AAGACTTCTCTCGCATCATTACCACTAGCTAGACTTTTACCTGGTGAACTATTTCTTCCG
CTAGCCTCTTTCACCTTGCCAAATGGCAGAGGGGAATGGAATCATACTTTAGTTTCTGTG
TTGGTGTAGTTAATTCAATTTTTATATCGGCAGGTTAAACATGAAACCGTATTATGTGAT
TCGTTCTAACAAATTCTTATATTTAACTTACGAAGGTTCGCATCGATCATACTTCTCGAA
CGTTAAGTTTTGGATCGGACTTGAATTTTTCCACTCGAGAAGATGCCCCAGTTGGTCCTC
ATTTGCAGAGCATGCCTTCCGAGCAGATCAGAAATCAGCTGACTGCTATGTCTTCAGTTC
TTGCAAAGGCCCTGGAAGTCATTAAACCCGCTCACGTACTGGTAAGAAACTGAACCTTTG
GAAGGGAAAGCTAATTTTTTGTGTTTTTTAATAGACTACAGATTCACATTTAACACTGAA
ACATTCAGAGGCTTTCCTCTTCCTAGTCATTCCCTTCTTCCTCTCCATCCTCTCTTCCTA
GTTATTCCCGTGTTCACTTCTCTTCCCCTGTTTTCCTTATGTCTTTGACTAGCCGACTCT
CCCAACTTCCTTCCTTTGCCATGTCCGTCTTTTGGGGCTTCCGTTTCTTTCTCTCTTAGC
ATCAGTCTGCTTGTGTTTGGGTCGGCGTGTATCTGTGTACCTTTGTGCCTGACTGAGCCA
GGGTGGTTGTTTTTCTGGGTATTTGTGGTTTGTGTGGGTTGGCTTCGTTTTGTGCATTTT
TGACTACAAGACAGGTTAGAAGTAAGAGAGTAGGAATAATGATGAGGATGAAGGGGGTAA
GTGCCTGTTGGGTGCCACAGTGACAGTCCTACATTCCAAGTCACTCATTGCTGGTGGTTC
TCTGGGTATGTGTCTCCCTTCAACAGCTGTGCCAGGGGCCCCCCGAGAAAAACCATCCCG
AGCACCATAGGTGAGTTTTCCGCGCCAGCTTTCTTTTCTAGGCGTATCCTTGTTGGCTCA
TTCATTTAAAGGGCTAACCCAGACACGGGGAGGCGGCACCTCTCCCGGAGGTTAACTCGA
ATGTCACGAATAAACTGCATTCTGTCTTCGAGTGCACATTTCGTTGACCTGCCTTCTCTA
TAATGGTGAGCAGTGTTATTTCTCATGTGCAAAACAAATGATTGAAGGTTAATTAGCAAC
TTGGCTTGCTTTCAGCTCTGTTGCCAGTCTCCTTCAGACATTAAGCGTTCAGGCATTTTA
ACTTATACAGCTGCCCTTAGTATTGCATCTGGGGCCGGGGCAAAATAGATACCAGCGCGT
CTTCTGATCCGCCAAGCGATTTAAGCCAGCTCAGGGTGAGGATCCGGGCCGATTGAGCCA
GCTGTGGTGCAGTTGGCGGCCGAGGGCAACTGTATCTTTGGCTCCTGGGGGGTCACTAGG
TAAAAGGGGTATGCCGTCTTAACCCTCTCCCTCCGCCCTCCAAGCCAGCCTGCGGACAGT
TACTGTTTGCCATAAGTGGCTTATAAGCTCCCTTGGTTCACTTTTTAGTAGACTTGGTTA
TTGCTGAAGCATGAAATACTCTAATTGGTATTTAGCTTCATTTTTCCTTTGGGTTTCCTT
TTTATTAACTTTGTTTTTTATGTCTCCCCCCCCCCCCCCCCCTTTGTTCCAGTTCTTCCT
AGGTTCTATTTTCTGTGAAGCTTGGAAATAACTTTAGTTGAGAAGTTAAAGTAGGGCAGT
GTTTCAGCCAGGGGCAGGTGGAATAATAAAAATAATTGGAATAGTGCAGTAATTTATGCA
TTTGGAACTGGGGATCATAGTTTTTAAGAATTGCTGAGTGGTATCTTTACTGGATCTAGA
CTAGACATAGCATGTGAAATGCATTTTTTTGTGTCTGTGCCTTCCCCCCAAAATGTTTTG
ATTTCTTTCGTCCTTCCATTTAGTTCCGTGAACTAACTTTTACTTTTCTGGAAATGAAAA
AGAGTTTCATGGGTCAACTTCTCAAGTGGCTTATTCCCTCCGATGTCTACTTGTGCAACT
TAAGGAGTGGTGTTCTTAAAATGTTTTCTAGCAAGAAAAGGAAGAACAGCACCAGCTGGC
TGTGACTGCCTATGTAAAAAATTCAAGAAAAGAGCATCAACGTATTCTGGCTCGTCGTCA
GACCATCGAGGAGAGGAAGGAACGCCTCGAGAGTCTGAACATTCAGCGTGAGAAAGAAGA
GTTGGAGCAGCGGGAAGCGGAACTTCAGAAAGTCCGCAAAGCCGAGGAAGAACGTTTGCG
CCAAGAGGCGAAGGAGAGGGAGAAAGAGCGCATCCTACAGGAGCATGAACAAATCAAAAA
GAAAACCGTGCGCGAGCGCTTGGAGCAGATTAAAAAGACAGAATTGGGGGCTAAGGCTTT
CAAAGATATCGATATTGAGGTAGGTAACTCGTTACTGCTTAGAGAGTTGACATCCAGATT
CAAGTAGGGGAAAGTGGTTGGCCGAAAATTATATTTGGGGTTAGAAGTATGGACGTTTTT
AGTGTTGAAATTGATTCTCAGTGGGATGTAAATCCAAGTGTGTGGTGACACTCATGATTT
TGATTCAGGGAAAAAAACACCCTTGGATATCTTAAAGAATGGAAAGTGGTCCTATTTATA
CAATCCTTAAGTGTTTTCAAAGAAGCAGTGTGACCTAGCGGCAAGAACGCAGGCCCAAGA
GTCAGAGCACCTGGGTCTAATCCCTGCTCTGCCACTTGTCTGCTCGGTGGCTTTGGTCAA
GTCACTTCTGTGACTCAGTTACCTCATCTATCAGTGGGGGTGAATTGCATTTACCGAGCG
CTTACTGTGTGCAGACCACTGTACTGAGCGCTTGGGAGAGTATAATAAAACAGAGTTGGT
GACATGTTCCCCGCCGACAGTGAGTTTATAGTGTAGATAGGATAGACGTTCATATAAATA
AATTATGGATATGAACCTCAGGGCTTTGAGGCTGAGGGTGGGGTGAATAAAGGCAACAAA
ACAGGATTATGCAGAAGGGAGTGGGAAAAGAGAAATGAGGGCTTAGTCAGGGAAGGCCTC
TTGGAGGAGATGGGCCTCCAGTAAGGCTTGGAAGGTGGGGAGAGTCATTGTCTCGGCAGA
TAAGCGGGAGGGCGTTCAGGCCAGAGGCAGGATCTGGGAAAGAGGTTGGTGGCGAGGTAG
GATTGAGGTACAGTGGATAGGTTGGCATTAGAGGAGCCAAGTGTGCTGGGATGTGGGATG
TATTAGGAGATTGTGCTTTAAGGCTGTGAGCCCTATGTGGGACAGGGACTGTGTCCAGTC
CGATTATCTTGTCTTCTCCCCGGCTTACGGTACCCGGCACGTAGTAGCACTTAACACGGA
ACTTTTTAAATGGTATCTGTTACATTTAAAAGTCAACTGATATCGAGCGCTTACTCTAGG
CAGAGCACTGTATTAAGCGCCTGGGAGAATACAACACTTAGATGCTATGAAAATAGCAAA
ACCCACAAGGCAACCCCTCTTAAACTAAGGCAAATACCGCCGTAGTGATTCACTACGACA
CACGTGCTCTATTGCTCTTTAGGACCTCGAGGAGTTGGATCCAGATTTCATTATGGCCAA
ACAAGTTGAACAGCTTGAGAAAGAAAAGAAGGAACTCCAGGAACGTTTGAAGAACCAAGA
AAAAAAGGTACTAGTGAAATCATTCAACTCCCCAGAGAAATGGAAAAGTTGCACCGGTTT
GGCAGAGTCCTTTACTAATGTTTTTATTTTGTTTAGATCGACTACTTTGAAAGAGCAAAA
CGTTTGGAAGAAATCCCTCTTATAAAAAGTGCCTATGAAGAACAGAGAGTGAAAGATATG
GACCTTTGGGAACAACAAGAAGAAGAAAGAGTATGTTTCTCATAAATGTGTTAGTTTTGT
ATGTTGAGTTTAGAATCTAAGTGGTACCATTTTGCTCTCACAATTTCTTAATTGTTTTGC
ACAGGGAGTAGCCCCAAGGGTAATTTTTTTATATATTTTGTAATATTTAAAGTATCAGAG
TCCATGGAGATATTAAAAAGTGCCGCAAAGACATCAAACAAAGTGACATCTCCCAGGATT
TTCCCCACCAGTTAGGGTTTGCCCACTTCTTTAATGGTCGGCCTCTTCCTCCAGACCCTT
CAGGTACACAACGCACCGAAATGTTAGAATCTTCAACTAAAAACCATCCTTCCTGCCGTG
TGGCCAGTTTACTTTTGACAGGGCAAACCCAGGAATAGTTCCTGTCTTGTCCATTAGCTT
CTCAGCTAAGAGGAGATGATTGGTTAGCAGAGATTCTTGGCTGGCAAGAATGCTTCAAAC
TCAGTGGGATGAAATGTCTTCTGTGGGCTCTTGGTCCGCTCTCTTCCCCGCCTCCAAATT
ATACTGGGATGGGGCATGATTGCCTCGTTGTACCGTTCCCCTACCGCTGAGGGATACTAT
TCAACTAAATCCAAATTCTCCTCAATGTAATCGGGAACCAGAAGTTGGAGGTGGGAAAAT
ACAGGCAGTAAAGGACTTTGCCATGTTTCCATCGTCTCAGGGGCGTGATGGCTTTAACCT
TATCCCTGTCCCTGAACTGGGCAGACTGGAGGCGGGTGAAGAGATGACTGGTTCCTCGGG
CGTAACGTCGCAGGGGCCTGCCGAGCCGGAGAGGACTTGCCGATGGCCCCGCTCTCTAGT
GGGACTTGACTGTTCCTCGATTTGCTCTGCATTACGAGTGCCCTTTGGACCACCTCTGGA
CTCTGAAGAAGCCTGGGTCTATTAGTTTCTGTTGCTTCACAGTCGATTTTTAGTTGGCAG
CAGTTTCAGGACACAAGGGCATGCGGAAGTCCCTCGTCGTCGCTTGGCTGTAACTTGGAA
AAACAGCAAAGTTTTCATACTGTGGCGCGAACTCAGAAGAGCAACGTGCTATTTTGTACA
GCTAACATAGTACCTATTTACAGATTACTACTATGCAGTTGGAACGGGAAAAGGCTCTTG
AACACAAGAATAGGATGTCCCGAATGCTGGAAGACCGAGATTTGTTTGTAGAGAGACTCA
AGGCTGCACGGCAATCTGTTTATGAGGTATGCCTTTATTTGAAAGAAAAAAATTGGACTG
TTTAATGCCGTTAACTTTTACGGGAACTATTAGAATAATCTCCTTTCTCAGAGTTATCAG
GAGGACACAGATATTCATTTTGCAGGGAATAGGCCCTTTCAGGCCTATTGTTTTCTGCTT
AGAGCACTGGCGAAAAGTTGACTGCTTTGGCGTTTTCATGTCAGTTAACCAGAACCAGTC
TTAAGTGGCAGCCGGTGACTTTTATGTAATATGAGTGAGGATCATGAGGTGAAGGGAAAA
ATGTGATTTTGCCCTAACAAAATGCTAAGTATTTCCTTGCTTCAGAGAACTCTTACGTTG
GTCTTTGCAGGAGAAACTGAAGCAGTTTGAAGAGCGGCTGGCCGAAGAAAGACGGAATCG
CTTGGAGGAACGCAAAAAACAACGCAAGGAGGAGCGTCGCATCACTTACTACAGAGAAAA
AGAGGAGGAGGAGCAGAGGCTGGCAGAGGAACAGATGATTAAGGGTACAAGATGGGAATG
AAGCGAGGGAGGGCCAATCTAAGATGAAAGGATGCTTTTTTGCTTTTTTAAATTGAAAAT
ACACAAATGTTTAGGCATCTGGGTCTAGAGGGAGTCTTGTACACGTGGCAAAGACACCTC
AACTTCTTAGGCATGAACCCTGCGGTAATAGTGTGTGCAGTAAAGCCTTTCTTAGAGGAA
GAATGCATGTGCTTTCAAGCTTTGGGATGATAGTCTTTGACTTTTTGATTCTTTTGCCTG
ATGGCCAAAGAATTCTCGTACCAATTCAGATGGGAACACCGCATTTTCAGAGCTGGCATT
CAGATGCTAAGTTAAAATAAACAGACAACAGATGGCTCCAGAGTTGGCATTCAGCATGTG
GCATACCAGATGCTAAGGTGATAGACGACTTCGTGCTGTCATCGTTTCCTTTTTCCCCTG
TGATAGTGGCAAACCTACAACCTGGAGGATTAATGTGAATGAGTACCGTAAGCATTTGCT
TGAAGAAATGCATTTCCTCTGCCTGATTCCAAATCATCATTATCAGTACATTAAACCATT
CTCCGTTATGATTTTCTAGAGGGCCAGTCCTCTAATTGAAGGATCAAAATACATTTTTAT
GTGACCTGCACACGATCTGCATATGCCCGCGTGTGAACGGCAGCGTGGTTCTATAGGGAT
TTCGTTACCGCAGCACCGATTATCATCCTTCCTGATTTCCCCTCCACTCTCCCCCCACCG
CAGTTACACGCGCATTTATTCGCACTTACCTGCTGGTGCTTGACTCAGCTTCCCTTTCAC
CTAAGACTGTAGAGAGGAGATGGGAGAGCCACGTTGAGTCACGGGAGAGGGGTCGGTGGT
GGCCAGTCTGAGGAGCATGTAAAACGATATGCGGTACACATTGTTGCAGAGCGTGAAGAG
AGAGAACGTGCCGAACGTGAAAAACGTGAAGAAGAACAACGAGAGTATCAGGAGCGGGTC
AAAAAACTAGAAGAGGTGGAGAGGAAAAAACGTCAGAGAGAGTTGGAAATTGAAGAGAGA
GAACGTCGTCGAGAAGAGGAGCGGCGGATTTCTGATGACCCGCTTTCTAGAAAGGTAAAG
GTAACCCGCTAAACGCTCTCCCACCCCGTTTTCTCTAGGTATAATTTATTAGAAGATGAA
ACTTTTCAATGGCGATGACCCTGACCTAGTAACTTTAAAAAAGTTGTGTACCTGAGCATA
GGAGATCGAAAGTTGAGCGTCTTTAACCAGTTTTCAAGCAGCAAATCCCCCAGAATTCTA
GGGGAGGAAAGGGACATTTATATTTCCGTAGAGTGTGCAAAAGTTAGACGTTCCTCCTGC
CAGTTGGGTTTAATTACAAGAATAGGTAAGAAGGATCTGGTCATTTTTGGACTGTTTCTG
CCCAGAGGTTGCATTGGCACAGGCCAATTCCCCCTAGATGGAAAGTCTCGCTCAGTCTCG
TCAAAAGAACGCGTAACCGTGACCACCATCCCACGCTCTGCCGGTCCGTTGCTTTGTGTG
TGTGAGTTTACCGAGGTGGAGGATGGCCAGACTTCAGGTGGTGATGGGCTAGGAGGGCAG
GTTTGTCCCCACCCACTACAAGATGCTCCTCTCTTCCTGCCTACCGTGACTTTGTTCTCT
CACCCTCCTTGTCAAAGCCTAGCTCTGGGGTGCGTAGGGGAGGAGGGGGTCAAGTTGGGT
ATCTGTGGAGGAGGAAGAGGAGCGTCTTCGCATGCATCTGTGTTTAGATGGATGAAAATG
TCCCTGGTTGGGTACTTGTTAGTGGCCTAATCCCGGGCCAGCATAGACGGTTCTGTTGAT
TCATTCATTCAATAGTATTTATTGAGCGCTTACTTTGCGCTGAGCACTGTACTAAGCGCT
TGGAATGTACAATTCGGCAACAGATAGAGACCGTCCCTGCCCATTGACGGGCTCACGGTC
TAAAGTTAGCCTGGAAAGTTTCATTTTTAAGCCACTAGTTTGAAACCCCCCTATTTCCAG
ATTTTTGAAGGTTTTAACCCCAGTGTATCCATCCTCATGGATGTTTTACCAGTTTGATGT
TTCAGTTGGTTATTTGGATATGCTGACAGAGCCTCCAATGAAGTCCCCAAACATTTTGTC
CTCTTCAAAGTTACTATGGTAATAATAGTTCTGGGGCGTTTTTTAAGTGGTCTGTTTGAA
CTGAACCCGTAAATACAATGTTAAACTCGAGCTTCGTTCCCTGTAGGATTCTCGTTGGGG
TGATAGAGACTCTGAAGGCACGTGGCGGAAAAGCGCCGAACCCGAAGCCGAATGGAGACG
AGGGCCACCGGAAAAGTAAGAATATTTTCGGGCCGTGACCGTCGATGACCTTTCAGATAT
CCCTCCCGAACAGTCTGAAGTGTAACACGTACCGCAGACGCGTCGGCTCTAAAGTTGGAA
GTTTTTCCTCTTCCTTGAGCTTGCGCTATTGGGAGCTCATGGGATTTGGCGGCGCCTCTG
ACATTTGCCATAATTACTAAAAGCCTGCGTTCTCCTACACCTTCAGGAGAGGCTCTGTCG
GAAGAGTTCAGGACTGGTCTCTCTGACAGTTTGCACACCTATATCGGGGTAGATGCCTTC
GGGGGTGTGCACGTTTACCACGTGGCTCAAAGCATAAAGAGCGTAACGGGAATTTCCCTT
CACGTGTGGTTCTTCAGGAATACAATCCCACTCGTTACGGGAGAAGCGCCTGTAGAATTT
GAGGCTCAGAGCAGCGCGGCTCAGTGGATAGAGCCCGGGCCTGGGAGTCGGAAGGACCTG
GGTTCTAATCCCGGCTCTTCCACATGTCTTCTGTGTGACCTTGGCCAAGTCGCTTAACTT
CTGGGCCTCGTCACCTCATCGGTAAAATGGGAAGAGACCATGTCCAACCCGATTAACTTG
TATCTACCCTAGCGCTTAGAACAGGGCTTGTCACCTAGCAAGCGCTTAATAAGTACCATC
GTCATCATCGCCTGTCCAAAAGAGAACAGTTGCAGAGAATCCGTGAGCCGAGCTGGAAAG
ACACACTCAGTTCTGCCGTAACCCATGTTTTCTCAGTTCTTAGTGGGGTTAGAATTGAGT
GAGGGAGTATTCTGGCGATAGCCTCTCTGGGCTCAGCAGGCTGTATCACTGCAGAAACCC
GCGTGTGTGCATTAGTGCGTGTAGCGCAGCTTCGTTACTGGAGTGCAGGTTTCTTTTCAT
GTGAGGTTTTGCAAAAACACTCCTTTCTTTGCACAACTGGGTGTGGCTGCACTTTAAGCG
GTGCTTTACTTTTAACTTCCATCTTTTCTCCGTGAAACCGTTCGCCTGTGGGCTGATTTA
GCAGGGAAAGGACGTGCTACATTATGGATGAGGTTCAAACCGTGAGTCAAAGTATTCACA
GCTACAGAATCGCCAGAGTTTTCTTAGTGACCGCAAAGCCCGTTTATAGGGATCTATCCG
TTAATCAACTAACGTAGTCAGCGTACCGATCCGTTTCGTCACTCCTATTGGCGGTTGGAT
TTCAAATGGGGAACCATCAGGACTGTGTGCATTTATGGGCGGGAGGTTAATATGCAAAAT
GAAAGTCTTCAGGAAGTCTAGCACTCGGGTGAGCTTGTACACTGGGTGTGATTTAACTTG
GTGTAATCTAATAGAGAATGGCGGCGTGGAGAAGGGCGTGATGAAGAGAGACCTCTTCGA
AGAGATGAGGACCGACCGAGGCGGGCAGGAGACGACGAAGAGAAAGAGCCGCCCGCCAGA
GCGGATGAAGACCGGGTTCCCCGCCGTGGGCTGGACGAGGATCGGGGCCCCCGGCGCGGT
GTCGACGAGGACCGGTTCCCCCGGCGGAGCGCGGACGAGGACCGGGGCTCTTGGCGGAAC
GCGGACGACGACCGGCCCCCGAGGCGCGCCGTCGACGAGGACCGGGGGCCCTGGCGCCCC
GCCGAGGACGACAGGCCCCCCAGGCGCGGGCCGGACGAGGAGAGGAGCAGCTGGCGCAAC
ACGGACGAGGACCGGGGGCCCCGGCGTGGAGTTGACGAGGATCGAGGGCCGAGGCGCGGG
ATGGAGGAGGAGAGGTCGTCCTGGCGCAACACCGAGGAGGATCGCGGGCCGAGGCGCGGC
CTGGATGAAGACAGGGGTCCGCGACGTGGTCTGGATGACGACAGAGGTCCCTGGAGGAAC
ATGGACGACGATCGAGGCCCCAGACGCGGGGCTGAGGAGGAAAGGGGTCCGTGGCGAAAC
ATGGATGACGACAGACCTAGGCGTGGCGACGATGACAGGATTCCCAGACGCGGGGACGAT
TCTAGACCCGGTCCTTGGAGACCGTTTGGTAAACCAGGTAAGAAACACCCACCCCCGCAG
CTTTGAAATCGAAAACCTTTTCGAGGTACCTCAAAAGCTGAAATTGTGCCTACTTACTTG
CATACTCGGTTTCCCACTCCTGTCTCCTTTTCATCCAGCTACTGGAGTTTGCCTCTAAAA
AAAAAAAGTTGCTGTTATGTGGCTCTGATGTAAAGCTTAGGGGATGAAGAGATAGTCGAA
ACAGCTAAAGTTGGGCTTGAGAATTATTACCAGCGAATTTCATTTGCACAGCTTACACTC
ATCCTTATCTCACGCTCCGTTTGTAATCAGGGCACCTCCTAGCTTTAAATGAAAACTTCT
CAGTAGTTACATAACCGTGTGTATTCGGTTTTATGTGAAATTCCTTGAGGGGCCAAAGTC
TACTCTAGAATATCAGTCCAGTCCAGCAAAAACATTTGATAAGGCAGTTTTCGCCAAGAC
CTCGGTTACAGAAGCGCAGAGTTGCACACTTTTAGTGCTTGAAGGGTTTGGTAAAAAGTC
AAATTACTCCTGACGAGGAAAATCCCAGGTGAGGCGGATTCTACGAAGTGAAGTCCTTAA
CGGTCTCCATGTCCTTTTTGTCACCTTGAGAGTTCGGTACCATTCGGATGCAGTGCATCG
GGTACGTACGGCAGCGTCCCCACACTTGACGGAGGCCGGCCTCATCTGGCCCTCTGATCG
TGTGAGGCGAAGTTGTGAGAACGGTTAGCGAAGCCCAGGGAGAAATGTGTTTCTGACCTG
AGAGGTGTATTAATAAACTCTATTGCCTTAAAAACAGGCGGATGGCGGGAGAGAGAGAAG
GCCAGAGAAGACAGCTGGGGTCCCCCCAGGGAATCCAGACCTTCCGAAGACCGTGACTGG
GATAGGGAGAAAGAGAAGGATCGAGATCAAGATCGGGACGAGAATGACAAAGATCATGAA
AGAGACCGCGATGTCGATCGTGAGGATCGCTTCAGGCGCCCCAGGTTTGGCATCATGCTT
ATCACCTCCGGGTCGGGGGGTGGTGGATTAGAACGTTTAGTCAATCGAGTATATTCAGGC
AGTGCTTACTCTGCGCGGAGCCCCGTTATCTGACGGCGGAGAGAACGGTCGGTCTGCGAG
ACCTTAGTAGTAGGAATGGCGCTTGGACGGAAAACATTGTACAATACAGCCTTGGTTATC
TGGCCTCTTTAACCGGACGTGGGTGTTCTTTGTTTACTGAAGATTCCCTCTTGTTGGAAA
TGAGCCACTCAGCCTGTTTGTCGCTTGGCACGCTAGCCTACCTCCCTACATTAGGACTGG
CTTAGGCCGATCTCCCCGGACCGTCCGGAATTTTGGTCGACCAGGTGGTGCTTGGGCCCT
TCTTTAAGAAGCTTCGTTTTCCCCCTGCAGTAAGTGTGCCTGCGGGGTGAGGAAACTGAC
GCGGGCTTAGCGTCAGCTGTGGCTAACTTTGGTTCCTTTTTCGCGCAAAAAGGGATGAGG
CTGGTTGGAGAAGAGGACCAGCCGAGGAAGCTTCTAGCTGGAGGGATTCGAATCGACGGG
ATGAATGGGATCGAGATGACCGTCGTGGTCGTGACCGAGACGATCGAGGAGGCCGGGACC
TGAGAGATCGGCGTGGTGATGACAGAGACAGGAGAGGACCTCCTCTCCGATCGGAACGTG
AAGAAAGTATGTTCATTTCCCCACTTGGGTTAGGACCCTTTAGAGATCGATAGATCTGTA
AATAAAAGAATTGCGCGTGTCCGGTAAAGGTGAATTTAAAGAAGTTGGTGGATTTAAACA
TAGGTAGCACACCTGTAAAAGGAAGTGCGTTCCACTGCCAAAAATCGGATCATGCATTCG
ATTTCCCTGTAACTCTCGAACTCGGCTGCGGATTGAAGACCTTAGTAAAATAAGCCACAG
CGAGGACCGCGTGTACATTTACCTCGTTTGTAACCGTTGGTTGGTTTGACTGGCCCGAAA
AATTTGAAGCAAAAAGTATTGTATTCAGGACTTGCTGCTTGACGGTTTCTAGTCATCCGC
GTCTTCCAAAATTTAGTTAATGGCAGCCTTCAAGAAAACCAGTGCTTTCCACAGTTGAAG
CTTAGTGACCAGCTTATAGAGAACATGCTCTTTTTAAAGCCTGTAGGCTCCTATTTAAAT
TTCCATTTTCCGAAGGAGCGGGTCCTAAAAGTTCTCACGGTCTCAAGCGCCGGTGATTCT
GTGAAGATGATACACCTTTCTGGCTCTTGTTTTTCGAAGCCGGTTTCAGGGAGTGTGGCC
GATTCAGAAGTGCTGACGATTTCACTTTGACTTACTTTCGCTTAGTCCACAGAAGAGTCC
GGAAGCTGGGTTTTTGATAGAAATGTGTTATTTTTCCCCCCTCGGGAGCAGGCGAAAGCA
GTCCATTTCGATCTGGTACCGGATCGTCTTCGGTGTAAAGTAGAATGACAGACGAGGCAT
TGAAAAGAGCTTCTCTTGTTTTGTACCTCCAGCAAGTTCGTGGCGACGCACCGACGAGCG
GAAAGACGAACGGGGAGAGGAGCGTGACGCTCCGCGCCGTATCCCTCCTCCCGCTCTTTC
ACGAGATCGGGAGAGAGACGGTGAGAAGGAGAGAGGGTCCTGGCGGTCGGAAAAGGAACG
AGAGACCCTTCGTCGTACTAAAAATGAGACTGACGAAGACGGGTGGACCACCGTGCGACG
TTAAGCCACAAGATCCACACGGTCTAAACTGGTGTTTTATCCTAGATTTGATCATTATTC
AAAAATTATATTTGTGCTTAAAACCATTCTGAATCGAGGTTCTTTAAATGTTTCGCTGTA
ATATGAAAAGCATGAACTTGTGTTTAATCCTATATAGATCGATCAAGCCACTGTATCCAC
AGCAGAAGATGGGGAAATCGAATGCTGTTTTCTGAAATATGAAGTGTTTCATTAATTCAC
AGATCATTTGTGTGTTTTTTTAAAATCCAACCCCAAAACACAACAAAAATAAACGGAAAC
TGTGAACCCTGCAGGTATCGAGTAGCACACGTGTTTCAGGATAAAGCTGAACTTTTTTTT
TTTTAAAGTCAAAAGAGCTGATTGAAATTTGGAGCGAAGTAAAAACGAAATCTGTCCTTA
GGCCAAGATTGGAAAATCTTTCCGTAAAAGAGTCAAGAGATTTTTGAGGGTGCTTAGCCT
TATCTGAATCTAGAAAGCTCGTACGTCCACGTCGTGTGCCGTATGCATTCTAAACCTTAG
ATACAGTGGGGGTTCGGTAGATTTTTACATGACTGCAGGTGCGTCTTTATGGAGCAGTCT
GCTCGTCGTGCTGACGACGCGAACACAGTTATAGAGCGAAGCAAGGAACAACCTTTTAAA
TTGGAAGCCTCGGGTAAGCCTGCTGCTAAGAATGTTTTCTGTTGCCAATAGCGTAACCGC
TTTTCCACTCACCAAGAACTCATGCCTTTTAAGCATTTTAAACCTGATAATATTTATAAC
TGTGTGGGGCTTTCTCTTGAGATTTTTTTCTTTAATTTTCTTTGTCTTCAGTATAGTTTT
TTTCTCCCTCCCTTTCAACAAGTACTTTGTAGTAATGACTGTGTTGACTTCAATCTTGGT
ACAGTAGCACCGTCAATCGTTAACCATTTGGTCTTAATTGAAGCCAACACAGAACTTGCT
GCTGTATTTTTTTTCCTTCAGTGAAAAAAATAAACTACTTATAGAATTAGTTATAGTCTT
GATTTTTAATTAGCATCACTTGAGTATTTTGTCCAAAAATAGGTCTCGTCAATCATTTAG
TCTTTCCCATCCCACCCGAATAGCGAAGTAGATTTATAGATGTTCTTGATTCAAGTAAAA
GGTATGTGGTCTCTGCCAACTGAAATCTGACTCTGAACGTGTTAATATTTTGCCGCCCCC
CCCCCCCCCCAAAACCCCCACCGCGGAAAATGAAATTTCCCTTTAAAATGTGTGTTTTCC
CTCTGGAACTCACCCAAGTTAACAGGTTGAAATTATCATTCCATATCTTTCTATGAAAGT
TTGGATTACTTTGGCACGCTTGTTCGCCCCAACTAAATTTTTTCCAAAATGCTCGCACTC
GCCACGTTCTGTCTTAATAATATGGAAAGCCTGTCTCTTTGGGGTCGACCGCTCAGTTAC
TACAGATCATCATGTTGACCGAGAGCCACCGGGGTGACCTTCATCCAGAAGAGGGAGCAT
TTACAATGAAATCGTGAACGAAGCAGAATGAACGCATTGCCCGGATAGATGGCTTTTCAT
TGTAATTGATGATAGTTTAGCCACTTTAATCGAATCACCCGTTTTCACAGTTAATTGTAT
TGAATCTCAGAAATCCTCATCAAAAATCTTGAAGAGGTTCTACTCGTAGTTACGTGACAC
ACTTTCCTCTGACCTGTCAGATTTTTGACATTTTCTGTCACCGTGCTGCTGGGGCCCCTC
CACGTTTCACCTGTGTTCTGGTGGTTCTATGTGCTTGAAATGGAAGATTTCCACACTTCG
TCTGCATTTAGTAAAGGGCATTTGGATTGTCCAGATATCTTGATTTCAGAAATAAACTTT
CCACTATGAAAAGGTTTTGGGTTTGCATGCTGACTGATAGCTACGCCGACATCAGCGAGA
TTAGGGAAGATTTGATTTTAAAACTACAGTCGCTCTTGCGGGCCCTTTTCCCCAGCGCGT
TTTCCCGAGCTCTCAAGAAGACACCCCCCCCCCCCCGGATTCAAGTGACATTTGCTCTCT
TTAAATCTGTTCTCCATTTCTAGGGGTGCATTCCCTTTGGTTATAAATTTGAAGGAATGC
AGAATATTTGCCTGAAAAGCTGGACCCTAAAACTGGCCTGAATTATGGATAAGATGAACA
CTGATTATTCATGAACCTCTGAATGCTCTTTGAGAAAACTCTCACGGCACACAACCAGTC
GCAAGAGGAGGGAAATATTTTTGAAGAGGGGACACCGACAACCTCACAGGCCACCTATTC
ATTCAATAGTATTTATTGAGTGCTTACTATGTGCAGAGCACTGTCCTAAGCGCTTGGACT
GTACAAATCGGTAACAGAAAGAGACAGTCCCGCCCTTTGACGGGCTTACAGTCTAATCGG
GACATCTAGTCATATTGACGTGCCCACTCTGCTGGGATCTGTTCTAAAACTGAATTGGTT
TATAAAGGCTCAACGCAGATTTTATCCAGGTACTTCAGAACAGCAATTGGGCTCTTCAAC
GAAGGAATTAGCAAAAAAAAAACCTTGTCGGCCAAGGGTGAGGGAAGTTAAGAACCCGTT
CTACATCATTAAATCTGATGTCGTGTGTTCTAGCTTGAATGTAGTTGCAGTTGAGGTTTC
TGAGTGGGATTGCAAGGTTTCTTTAAGGTGAGGCTCTTGAAGAAAGCACACACTCCCTGC
CCCCCGAACACCACTCAATTAGAGCATTACAATTTCCCCTTGATGGCCTCCAAAGGGAAC
AGACCAAGGAAATCTTTCCACTAATCTTTTAAAACTCCATGAGCAACCTATTTTAGTTCA
CTAAATTCTTGTCAAGAATCCTTTTGTGCTCTGGAGTTCAGTTCAAGATAGCTTCCATAG
ACGTCTCGCCGCTGTTCATTAATGGTTAAGCACCTCCAAAGATGCTTCACAAGTACTCGG
TTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1237, 1524..1660, 2209..2372, 3969..4168, 5957..6165, 8328..8499, 10473..10577, 11626..11724, 12222..12338, 13115..13300, 14971..15318, 16462..16566, 16656..16769, 17843..17965, 18310..18463, 19369..19553, 20686..20774, 22094..22776, 23557..23743, 24223..24425, 25232..25257, 25325..27383
1046..1237, 1524..1660, 2209..2372, 3969..4168, 5957..6165, 8328..8499, 10473..10577, 11626..11724, 12222..12338, 13115..13300, 14971..15318, 16462..16566, 16656..16769, 17843..17965, 18310..18463, 19369..19553, 20686..20774, 22094..22776, 23557..23743, 24223..24425, 25232..25254
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved