Ornithorhynchus_anatinus Locus RPS13
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus RPS13
Ornithorhynchus_anatinus
RPS13
Ultra270
SNORD14, SNORD14
6225..6316, 7082..7174
9240
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GATTTAGAACTGTGAGCCCATCAAAGAGGCAGGGGACGGTCTCCATCCGTTACCGATTTG
TCCATTCCCAAGCGCTTAGCGCAGTGTTGTAAGCGCTCAATTAAATACTCTTTGAACGAA
CGAGTTGAGGCCCGTAGAGGGGAAGGGGCCCGCGGGGAGGGGTCTCCCCTCGTCGGGGCG
GGGCGCTGCGTGATGAGGTCACTTCCGGCGGCAGTGACTTCTTTGGCTCTTCCTCGCCTT
CGGCCTCTTTGGCTGCCGGGCCGTCGCCATCATGGGTCGCATGCACGCTCCGGGGTGAGG
CCCGGGGCCGCGCCGGGGTCGGTGGGGAGGGCCGGGCTCGGGGCGGCTGTGGCGGCCGCT
TCCTCCTCTTCCTCCTCTTCCTCCTCTTCCTCCTTTTTCCTCCTTCCCCTCCTCACCGGC
CTCTTTTCTCTCCTCAGGAAGGGCCTGTCCCAGTCGGCGCTGCCCTACCGCCGCAGCGTC
CCCACGGTGAGCCCCGCGCGCGGAGCATCATGGGGGGAGGCAAGGGTGGGGGGGAGGCAT
TCATTCATTCATTCAGTAGTATTGATTAAGCGCTTACTATGAGCAGAGCACTGGACTAAG
CGCTTGGAATGTGCAAATCGGTAACAGAGACAGTCCCTGCCCTTTGACGGGCTCACAGTC
TAATCGGGAGAGACGGACAGACGAGAACAATGGCAATTCATCCATCCAGTCGTCCTGAGC
GCTTACTGTGCGAAGCACTGTACCAAACGCTTGGAATGTACAAATCGGTAACAGACAATC
CCTGCCCTTTGACGGGCTCACAGTCTGATCGGGGGAGACGGACAGACGAGAATAATAGCA
ATTCATCCATCCAGTCGTCCTGAGCGCTTACTGTGTGCGAAGCACTGGACTAAGCGCTTG
GAATGTGCAAATCGGTATCAGATAGAGACAGTCCCTGCCCTTTGACGGGCTCACAGTCTA
ATCGGGAGAGACGGACAGACGAGAACAATAGCAATTCATCCATCCAGTCGTCCTGAACGC
TTACGTGTGCGGAGCACTGTACTAAACGCTTGGAATGTACAAATCGGTAACAGAGACAAT
CCCTGCCCTTTGACGGGCTCACAGTCTAATCGGGTGAGACAGACAGACAAGAACAATAGC
AATTCATCCATCCAGTCGTCCTGAGCGCTTACTGTGTGCAGAGCACTGGACTAAGCGCTC
CGAAGGGACAGTTGGACACCTGACCATCCGTACCCAATGACCCTCACCGTCCCAACGGAT
CCCCGGCTGACCCGCAGCTCCCCTCTCTTTCCTAGTGGCTGAAGCTGACCTCCGACGATG
TCAAGGAGCAGATCTACAAGCTGGCCAAGAAGGGCCTGACTCCTTCCCAGATCGGTGAGT
GGCTCCTCCCCGCGGGGACGTCGTCCTCCTGGCTCGGGGGAGGCGGCCACGGCACGCTTG
TGGTACCATCAATCGGTGGTATAATAATAATCATGGCATAATAATGATGCCATTTATTAA
GCGCTTACTATGTGCAGAGCACCTAACACATAAGGAGCAGCGTGGCTCAGTGGAAAGAGC
CCGGGCTTGGGCATCACAGGTCACGGGTTCAAATCCCGGCTCAGCCACTTGTCAGCTTTG
GGCAAGTCACTTGATTCTCTGGGTCTCAGTTACCCCGTCTGTAAAATGGGGATGAAGATG
GTGAGGTCCACGTGGGACAACCTGATCACCTTCTATCCTCCCCAGNNNNNNNNNNCTCGT
CAGCTGGGTGACCGTGGGCAAGTCACTTCACTTCTCTGTGCCTCAGTTACCTCATCTGTA
AAATGGGGATTGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTCTACCCCAG
CGCTTAGAACAGTGCTCTGCACATAGTAAGCGCTTAACAAATACCAACATTATTCTCTGG
GCCTCAAGTGACCTCATCTGTAAAATGGGGATTAACTGGGAGCCTCACGTGGAGACAACC
TGATGACCCTGTATCTCCCCCGGCGCTCAGAACAGTACTGTGCACATAGTAAGCGCTTAA
CACATACCAACATTCTTATTATTAATCCTTGCCCACAACGGGTTTCTATTTATTCTATTT
ATTTCCTTGATTCTATTTATTGCTATTGTTCTTGTTTGTCCGTCTCCCCCGATTAGACTG
TGAGCCCATCAAAGGGCAGGGACGGTCTCCATCCGTTACCGATTTGTCCATTCCAAGCGC
TTAGCGCAGTGTTGTAAGCCCTAAATAAATACTCTTGAACGAACGAGTTGAGGCCCGTAT
AGGGGAAGGGGCCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGGGGAGAACCTGAAAACGACGTTTTTACGC
CAGTCCAGCCTCGTTTCAGCCATACAAATCATTTTCCGGCAAAATTACGTACATTCGGCA
TTTTTCAAGGAAATTGTTATACAAGAGCAATATCCTGATTCAAGCAAAGAGGTTCAAAAT
CTTCGCGTGGGTTTTCATTGTCTGAGCTTCAGGAGCACAGTCAAAAACACATAGGAGGTG
TGTATGACAACCCTGTGGGATGCAATTGGTGGGGGGAGCTACAAGGTGATCAGGTTGTCC
CACGTGGGGCTCACAGTCTTAATCCCCGTTTGACCGTAGAGGGAACTGAGGCCCAGTGAA
CTGACTTGCCCAAAGTAACTCAGCTGACAAGCGGGATTAGAACCCATGAGCTCTGACTCC
AAAGCCCGGGCTCTTTCCATTGAGCCACGCTGCTTCCCACTAATAATGATGATGGCATAA
TAGTGATGGTGTTCATTCAGTTGTATTTATTGAGCGCTTACTGTGTGCAAGGTAATCCGG
TTGTCCCACATGGGCTCACAGTCATCATCCCCATGGTACAGATGAGGGAACCGAGGCCCA
GAGAAGTTAAATGGCTTGCCCAAGGTCACACAGTAGACAAGTGGTGGAGGCGGGATTAGA
AACCACATCCCAAACCCATGCTCTTTCCACTAAGCCACGCTGCTTCTATTTATTGACTGC
TTATGGTGTAGCAGATAGAACGTGGGCCCAGGAGTCAGAAGGTGATGGGTTCTAATTCTG
ATTCCTCCATTTGTCTGCTCTGTGGCCTTAGGTAAGTCATTTTGCTTTTCTTTGCTTTAA
TGATGGTATTTGTTAGTGCTTGTTAAGTGTGAAGCATTGCCTCATCTGAAAAATTGAGAC
TGACCCCCACATGGGACCGGGACTGTGTCCAACCCTTTTGTTTGTATTCGCCCCAATATT
CAAGTGCTGGGCACATAGTAAACACTTAACAAACACCACCGTCTACTGTTACACTTAAGA
CTTAACAAACACGTACAGACTACTGTTCTAAGCATTTGGAGAGCACAGCATAAAAGAACT
AGCAGTAACATACCCTGCCCCTAAAGACTTCACAGTCGAGTAAGGGAGGTGGACATCAAT
ATTCATTTATATGAATGAATAATGATAAATTTAAAGCTATGTACATGAGTCCTGGGGGGT
TGGGGCAAATATGGAATGTCCACAGGTAACATATTAAGCATTGCAGTAGATACAAGACAA
TCAGGTATGTTTTGGTTCCTGTCCTTTGTGCGGCTCAGGTCAGGAAGAAGAGAGAACAGG
TATTGAACCCCCATTTTACAGTTGAGGAGAGCAAGACCCATAGAAAGTCACTCAGGTAAA
TGGCACATCTGGGAATAGAACCCAGGTCCCCTAATTCGCGGGTCCAGGTTCTTTTCATTA
AGCCACACTGTTCAGCATCCAGGGCTGGGGGTATGGCCCTAAATAGCATTAAATGATGTA
GCCTCAGTGGGTTGGCCAAATCTCTCATTAGCGGTTAAATCAAGGGAGTTAAATAGTGCC
ACCTCTACCTTGTTTAAAGTGCCTAATGTGCTGTGGCTCACTGGTGACTACCTCCAAACC
ATCCCGTTTCCACCAGAGAAGTTTTCCCTGCTGTTGACTTAAACCTTCCTTGGATCCCGG
ATTGAATTTTGGTACAAAGCGCTTTTAAGGAGCTTTATATGGTGGGAGGATTTTTTTAAA
CTTAACTTGTCTCCACAGGTGTGATCCTGAGGGATTCTCACGGTGTCGCTCAAGTTCGTT
TTGTTACTGGTAACAAAATTCTGAGGATTCTGAAGTCTAAGGGGCTTGCTCCTGACCTGC
CCGAGGATCTGTACCACTTGATCAAGAAGGCTGTTGCTGTTCGCAAGCATCTTGAGAGGA
ACAGAAAGGTAAAAAGGGATTCACGCAGAGCCTGTTCTGAGGCTTGGAGGTGTAAGGCTC
ATGACGTAAGGATTTCTCAAAAACACCACAAACTTTGGTTTGAGGCAACCAGGGCATGCC
TTATTCCGGTGAATTCATCCACGTTTGTCGTCACAAGAGCTTGTGCCATGCAGTTTGTAG
CAGTCGGAAAAGTTAAATTTAGGCATTCAGTTGTAGTAGCCCCGCTCACTGTGATGATTG
CTTCCATACCATTCGCAGTTTCCACCAGAAAGGTTTTATCTTTGTGTTGGCTAAACCTTC
CTTGGATGTCTGAGTGAGTGTCCCCAGTGGGTCAGAAGCCCAGTCCGTAGTTCCAAGATT
CGTTCATTCATTCATTCAGTGGTATTTATTGAGTGCTTACTATGTGCAGATCACTGTACT
AAGCGCTTGGAATATGCAGTTCGGCAACAGAGACAGTCCCTGCCCAATGACGGGCTAATA
GTCTAATCGGGGGAGACAGACGGACAAAAACAAGACAACATAATCACGATAAATAGAATC
AAGGGTATGTACACCTCATTAACAAAATAGGGTAATAAAAATATATACAAATGAGCACGG
TGCTGAGGGGAGGGGAAGGGAGATGGCGAGGAGCAGAGGTATATCCTGCTCTGGTTTTAA
GTGGGCAGTCTGTAAAAGAGCTTCATGAGGCTGGGCTCTCTTTGGTCTTCAAAGCCTCCT
GAGAGGCCACCGCTCCCTCATGACTCCTTAGTCTATAGGCCCGTATCTCGTTTGAATCGA
ATGTCTGCCGTGAGCACCGCCAGCTCCCTCAAGAAAGGGAATTCTGGCCCTTCAAGTAAC
TTCTCCTCACTGGTCTCATTTTTAGGACAAGGATGCCAAGTTCCGGCTGATCCTGAATGA
GAGCCGAATTCACAGGCTGGCTCGCTATTACAAGACCAAGAGAGTGCTCCCACCCAACTG
GAAGTAGTGAGTATTAATACTATTTTTTTTGTATATATATGTACACGTTCCTCTTTGTAG
CTGGAATGTAGTGCCACATAACCATACCCCAGAAGTGTGTTGCTCGTGGTATGTGGAGAC
ACTCACCGTGATGATGGTTCCAAACCATTCGCAGTTTCCACCAGAAAAGTCTTTTTCCTT
AATGTTGGCTAAACCTTCCTTGGATGTCTGAGTGAGCGTATCCATGTCTTCGTGGACATT
ATGGGCCAGCCTGGTGGCCGGGGAAGGCAACTCTTAGCTGTGGGTGGCCACTAATTGCTA
TATTTTCTTCTCTTGCAGCGAATCGTCCACAGCGTCTGCCCTTGTCGCATAAGTTCTTGT
GTACTAAAGAATAAAATGAAGTGATTCTGAAAATGGTTTCTTCTTCTGTGTTTCTATTTG
TCTAAAATGTAGGTGTCCCTTTTTTAATGAAAGAGTAAACTGTGCTTGGAGAAAAGTGGT
GTTACCTGGTTGATAGCATTTTCTTCCCTCCTCTGGAGTATGGTGCCATCTCTTTCTATA
GGCTGTGTGACTTTGTCCTCCCACATACATATTGGAGAAAGGAAAATGGTCAACCACAGA
TGTGTGTTTGGCGGGGCAGGACTCTCCCATCAGTCAGCAGTAGTTATTGAGTGCTTAATG
TGTGCAGTACTACGTGCTGGTGAGAATGCAACAGAATTATAGCGCTGCTCCCAGCCCATA
ATGACCCAGAGTCTGGCCAGCCCTGCCAAGTGTGTGCCACCCCCCCTTTACCTCTCCGCA
GCTAAACCCCCTTTTTCCCCTTTTCCCTCTGCTCCTCCACCTCTCCCTTCCCATCCCCAC
AGCACTGTACTCACCCGCTCAACTGTATATATTTTCATTACCCTATTTATTTTGTTAATG
AATTGTACATCGCCTCGATTCTATTTAGTTGCCATTGTTTTTACGAGATGTTCTTCCCCT
CGACTCTTTATTGCCATTGTTCTTGTCTGTCCATCTCCCCCGATTAGACTGTAAGCCCGT
CAAACGGCAGGGACCGTCTCTATCTGTTGCCGACTTGTTCATCCCAAGCGCTTAGTACAG
TGCTCTGCACATAGTAAGCACTCAATAAATACTATTGAATGAATGAGAGTGACTTATGGG
GTTAGGCCATTTGAGAAGCGGCATAGCTCAGTGGAAAGAGCACAGGCTTGGGAGTCAGAG
GTCATGGGTTCGAATCCTGGCTCTACCACTTGGCAGCTGTGTGACTGGGCAAGTCACTTC
ACTTCTCTGTGCCTCAGTTACCTCATCTGTAAAATGGGGTTAAGACTGTGAGCCTCACGT
GGGACAATCTGATTACCCTGTATCTACCCCAGTGCTTAGAACAGTGCTCTGCACGTAGTA
AGCGCTTAACAAATATCAACATTATTATTATTGTGCTGAAAGGTTTCTGATTTAAAGAAC
CCCCTAGGTGAACTGGCTCAACTGGAAACCCAAAAAACACCTAACCTGGGTAGCAGACTG
TGATGGCTACTCTGCCTGCTGCCTTCGGCCACTACAGCATAACATCAAGGTGATGCTGTC
GCCCCTTTAGCTAGATCCATACATGGGTTTTGTTTGTGAGATTCCCACAGGCATTTTGAT
TCCAAGCTCCAGGAGGATTCAAGGACATGGTGCTGTCCAAAACAGTGTCAATCAATCATT
GGTGTTTATTGGACGGTACTGTACAGAACATTTGTACATTCCAAGCGCTTAGTGCTGTGC
ACATAGCGCATATCTGGAATTCATTTACATTGTCTCCCCACTCTAGACTCTAATCGTCGT
GTGGATAGGGAACGTTTACCAACCCTGTAGTGTATGCTCCTGAGTACCTAGTACAGTGAT
CTGCACACAGTAAGCACTCAAAATACCATTGATTGAAAATACAGTGTAAGAGAATTGTTA
GTGGTGAGTCTTGATTCCAAGGAACTTACAATCTTCAGAGGAAGAAAGAACAAAATTGAA
CCATCCATCCAGTTCTTAGTGAAAGAGTTACAATATAATTTTAATTGTCAGTGTCTCTTA
TCCCCAGGTAGGAATTGAGGAGAAAGTCGCTACTATTTTAAAGTTGACTAATTTTTTCAG
TTCAAAAATGGTTAATGATTCCTATCAGTGGTATTTATTGAAAAGTTTGCATAGAGCAGT
GTATGTCCTAAGCACGTGGGTGAGTACAATACAACAGAATTTAACAGGCATGTTCTCTGC
CCCTAATGAGTTTACAGTTTGGAGAGGGGCCCCTTCAATCGTATTTACTGAGCACCTACT
G
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1277..1325, 2135..2213, 5838..6007, 6865..6965, 7278..8240
1111..1133, 1277..1325, 2135..2213, 5838..6007, 6865..6965, 7278..7311
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved