Ornithorhynchus_anatinus Locus TIPIN
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus TIPIN
Ornithorhynchus_anatinus
TIPIN
Ultra259
SCARNA14
6428..6564
12904
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCACACAGCATCTCCCCATCTGAAAATGGGGCAAACCACACGAATC
CTTACTTGCCGTATAGACCGCTCAGGAGTTCTGGAAGGGTAAAGTGGGTCAGTATATTTA
AAGCAGGAATAAAAGTTCTGTAGAATGCTGGGAATGGTAGTGTTATTTTTAGGGTTTCTG
AACAAACCCTGTTAAATTATCCTGTAATTTTGTTGTGGGCAGAGAACATGTCTGTCAACT
CTGTTGTATTCTCTTCCAAGCACTTAGCAGAGTGCTATGCACATAGTGCTCAGTAAATAC
CACTGATTATCTACTAGCCCAAGTTGTGATGCATTCATTAAGCGCTGTTATTTTTTGGCT
TTCTACATTTTAAAAAAAGACTTTTATTTTTAGGGGGAAAGATGCAGGAATCAACAGAGA
ACAATTTGTTTGACCTTCCTGATTATGAGCATGAGGAAGACGAACAGTTTCCACCTTTTC
CACCTCCATCCTCTCCTGGGAGAAGTGATAATGAAGGAGCTGAGTCCAGCCAAGGTAGGA
GATGAGGCACTTACCTGTTACTCTAGCACTTGGCTTTGATCGAATATCTTCATACAATTA
CCAGTAACTTGGAAGTGCCCTTCCATGCTGTCTGTTTATTGTTCTGTGTACTTCCTCAAG
TGCTTAGTACAGTGTTCTGCACCCAGAAAACCCTCAAAAAAATGAATGATTATTATGTGA
GAGAATTAACTTACTACCAAATCAGGGTTTTCTCCCAGTATGTAAACTAGGCAGCAAAAA
AAACCTAATCCCCAACAAAGCTTGGGGAAGAAAGGGGCATTTTGGTGAAATTAGAACACT
GCATTTTTAATGTGTTTGCTTAAGGGCACCACTTATGTATAAGGTTACGTTCAGGCTTGG
TGGTGCCTTTTTAGGCACAGGCTATATTATTGTTATTATTATTAATAATAACGGTACTTG
TTAAGTGCATACTGTTTGCTAAACACTGGGGTAGATACATGTTAATCAGGTTGGCATCAA
GTCCTGTCCCACATGAGGCTTACACTCGTCCCCATTTTGCAGATGAGGTAACGGAGGCAC
AGAGCAGTTAAGTGATTTACCCAAGATCAACCAGCAGACTTACAGCAGAGCCGGGATTAG
AACCCAGGTCCTCCTGACTCCCAGGCCCGGGCTCTATCCACTAAGCCATGCTGCTTCATT
TACTTCCTTTTCATACAAGGATCTTTTCTAGCCAGTCCCTGCTGCCTTCCCACTGTTCAC
CCCGGGGGACCTTATTCCTAATATTCCCCAGGTATGCGGGGCCCCCGAGGGAGTTCAGCA
GCGGCAGTGTCTGGCCTCTACAAATTGTAGAACTTGGGGAAGCTTCGGATGTGACTGGAC
TCTCAGTGACCTGAGTGGTGGCACGTTTAGGCCCCTTCACGTCCCTCTCACCACCCACCT
TGGTGGACTGTGCACTTGGGCTTATTATGTTGTTTCGTGTTTTTCTTATTTCGTGCTTCG
TGTCTCATCTCTGTCACCTAACTCTCCCCCATCTTATTTTCAGATCGTGAGTTCCCGAAG
TCAGTCAGTCCATCGTATTTATTGAGCACTTACTGTGTGCAGAGCACTGTATTAAGTGCT
TGGGAGAGTACAATATAACAGTAAACATTCCCTCTCACAGTGAGCTCATGGTCTAGAGAG
GGAGATAGACATTCATATAAATTCATTCATTCACGCCAAGCACTGTACTAAGCGCTTGGG
GGAGTACAGTACAACAAACAGACACTATCCTTGCCCACAACGAGCTCACAGTCTAGAATG
GATAGGTAAATAAGTAAATTATGGATATGGACATAAATGGTGTGGGGCTGGGAGGGGGAA
TGAATAAAGGGAGCAAGTCAGGGTGACGCAGAAGGGAGCGGGAGAAGAGGAAAGGAGGGC
TTAGTCAGGGAAGGCCTCTTGGAGGAGATGAGCTTTCAATAAGACTTTGAAGTGAGGGAG
AGTCATTGTCAGCTATGAGGAGGGAGGGCGTTCCGGGCCAGAGGCAGGATGTGGGCGAGA
GGTTGGGGGCGATGGGCCAACTCCCCTTTCTCTCTCTCTCTAGCCCAGTACATAGGAGGC
GGAGAGTGTCTGCTTGTGGCGACACTGGCAAAATTGGCTCCCTTACTGGGAGCTGGGGAG
ATACGGGCAAGGTGACCGCGGTGACACGTGCACGCACCTGTCCATATGCAACACCTCCTC
CTGCACATCTTGTCCAACAGGAGGCTACAGCATTCTGTTGTTTTCAAGTCACGTGCCTCT
GTGTGTGTCTGTCCTTTCAGGAAGGAAGAAAGAGAAATCGTCTCCGACGGACGATCCTCC
CGTGAACATAAGGAAAACAGTAAAAAGAAATTTACCTAAGCTAGATGCTCATCGGTATGT
CTTTTTAAGAAAGAAATTATTTTTCCCCATTATGGTTTGTTAGCCTTATTTCAGGTGTTT
TGGAGAGATTCCAAAATCTCTAGTTCCATCTTATCAGATGAAAACATTTTAACATGAAAG
TTCATTTTTAGTTCATCGAAACAGTCTTTTGTGTCAACCCCTAATATTCTTATTCTGAAC
TTGAAAGCGTGAGAACATTTAATTTTCAGCACATATTTCTAATTTGCAGGTTAGTTTCAG
AGAGAGGGCTTCCAGCATTACGACATATGTTTGATAATGTAAAATTCAAAGGCAGAGGCC
ACGAGGTAAGAAATATCCCAATTTGATGGTCCTTCGTTTTAATATGAGAGTCAGAAGATT
CTGAATTCACCCTGAATTCACGGTACCTTTCTCCTCGGCAATTCAAAGCGTTTCGTTCTC
ACATCCCCGTGCGAAAAGTAGAAAGGCAGGCCGGATGATGACAGTGCCTTGTGCCCATTT
TACAGATGGAGAAACGGAAACAGAATGGTTAAGTGGTAGATTCGAGGCCATACAGGCAGG
CACGGTGGTGGAACTGGGAGTTTGCCCTGGATGCCGACTTCATGATAAAATGTCATTAAG
TAGACAAGACGTGCGCTCTGAAGGCAGGGCATTTTGGGTCAAGAGATAATGAATAGAAGA
CAGGAACCTAGTTGAAATGCCAAGCTGTTCAATGCTCATACAGAAGGGGAGATTAAAATA
GGAAGAGAACGGTGGAGGAGAGGATTTCGTGAAAATACTCATGATCTAGGTGGGTTTTAA
AGAAGGAAGAAAATATGGGGTCAGGTCCAGAGAGGGGCGAATGGGAGCATCAGTGGTTCC
AGCGAGTGAATGTTTTTGCTGCTGTTACTTCCCCCTGGATGATTTGATTTTCTTCATGAA
GAAAATGCTGACTCAAGGGTGGTTTCCTCCTCGCACACGTCTTTAGGATCGTCTTTTTGT
CTTAATTTTCTCACGCCTCGTATTTTAGAATCATTATCATGACCTAGGAGGTGGATGTCC
TTACTCTCCATCTGTTCATTCGCCCCCTTGATGATCTGGATCTGCCAACTCTGTTGCATT
GTACTCTCCCAAGCGCTTAGGACAGTGCTGTGCACACAGTAAGCGCTCAGTAAATGCCAT
CGATTGTTCGATCTTTAAAGACCTATTTCAGAGTCTCTGGTAATTTGGCTAGCTTTTCAG
AAAGGTATTTACAACGTATGAAGATGCAGTATGTTCAGTAGTCAAGACTGACCCTTTATT
TTGGAAAAGAACCATTTTGGATGAAGAAATGTAGCCACTGCTTGCTGATGTATCCTGGCA
AAGATGTCTCCCACCTGTAAATACAAAATGCCATCAGCAGCGTGGGCAGTGTTACCCCCC
CGAAAACCCACTGATAGATTTGGATGTTGGAGTGAAACTTCCTAATTTTGCATTTTTCCT
TCCGCCTCCTCAGGCCGAAGACTTGAAGACACTGATCAGGCACATGGAACACTGGGCCCA
CCGGCTCTTCCCCAAACTGCGGTTTGAAGATTTTATCGACAGGATAGAGCATTTGGGAAA
TAAAAAGGAAGTTCAGGTGAATATTAAGCACGTCGGGGTCTTCAGAAAACATGGAGCACA
GGCAGTGCGTACCCCAGTTTATGAGTCCTTAAAGCCCAGGATTATATCCTGAAGGCATTG
CTTGTTTACCCTGCCTTCCAGAAACAAGGAACCGGGAAGGACAGGTGGCAGAGGGGTGGG
AGGATTCAAAGTGCAGAGGTGTTTGGAAGAAGTGTGCCTGCTGCAGGGTTCTCCGTGAAG
GAATGAAGGCAGCTCTGTAACCCAAATTGGCCAAATTCTTCACGATTTTTCCCAAATTTT
CAATTGTTTCCATAGAACAAGTTGCCTTCTGTAGCTGAGAAGACTCAGTCGTATTAAAGC
TCCTTATTTACCGTTGTGGTGTTAAGCTGTGAGTTCCCTCCACAAGGATTAAACGATAGT
TCAGTGATGTTTAATGTTAGAGTCTCTAGCACCTAAAGGAATTTAATGTGCTCTAGAGGT
TTTGGAATGGATTCTAATTTGTAATTTGTTAGGCATGGGAAAAAAACCTGATTAGTCGAG
AGAAGCAGCGTGATCTAGTGGTTAGACCATGGGCCTGGGAGCTGGGTTCTAATCTCAGCT
CTGCCAACCTGTCTGCCATGTGACTTTGGTCAAGTCACTTAGCTTGTCGGTGCCTCCATT
CCTTCTCCTGTAAAATGGAGATTAAGACTGTGAGCCCCATGAGGGACCGGAACTATGTCC
AACCCACGAAATAGCCACTTAATAGTAGCCACTTAAATACTATTATTGCTTATAATAATA
ACAATAAAACATACTCCATGATAAGCACATTTTCAGGGAATGTAACCTTGCCATATCATG
GGTTTGTTGATGGAAATAATGGCATCATAAGTACTTTTAATTTATAACATAAGTTCTTTA
AAACATCATGAGTGGTTTAAGAGAGTTACTTTAGTAGATTGTTTTCCTTTGGAGGAACTA
ATTAACTAAGGGGTTCCTCAAGTCAGTGAAGTGTGATGGAGGAAAAAATCATTAGTTAAT
ATTCCATGAAAGACTAATCACTGTCTTTAAAAACAAGATACACTCCCAGCTTTATATAAA
CTCATTTAGTGGTGAATTAATTTTTTTATTTTCAGACTTGTTTAAAACGAATTCGACTCG
ATTTGCCCATTGTACATGAAGACTTCATCAGTAAAGAAGGTAAGTTAAGTGAAATTAAAG
TCCAAGGTTAGAGTGGGATTTCTAGGAAGTGATATGCTTTTGAGGGAGAAATACTGTTGT
ATTAGGTGCTTTTTTCTAAAAGGACTAAAGTGCACCAGCTCTAAGACTTAGTTAAAATGT
TTCTCGTTCTCTGGAATTGAAATGGGTAGAAATTTGGGGACCAGTGAGAATAGTGAAATG
GTCAAAGGGGAACATATCTGCTAATTCTAGTCTATTGTACTCTTTTCCGACGCTTAGTAC
AGTGCTCTGCACGTAGCCTTCAATGATAGCGGTAATTTTATTTGTATTCATGTCTGTCTC
CCCCTCCTCTAGACTGTAAGCTCGTCATGGGCAGGGAATGTGTGTTTTTTGCTGCATCGT
CCTTTCCCAAGCGCTTAGTGCAGTGCTCTGCACACAGTAGGCACTCAATAAATATGATTG
AATGAATGAATATCGAATGATAACGAAACAACTTGTCACAAAATACATAAAGGATTTAGA
GAGCTGAGTTGTTAATGCAAAGTTTGTATTGTCTGTAACTTTTCATTCTTCAGCCGAGAA
CCCGGTGGATAAAAGGATAAGGTGTGAAGCTCGTGGGCTAGTGACTTTCTGCAAATCGCT
GTCACTAGGGAGGCGTGGGTGGAAAAGCCAGAGGGGTGGAGGGAGAGCTGTCTCAGGAGG
GAAGAAATGTGACTGTACTTGGTACAGGTTGCATTTGTGAGTAGTCTGATGCAACCACGG
CCAGTCACGTACATAAAAATCCAGTGGTTCCTGCCGACAGGGTCTGTCTAGTGATCAGAT
TTCCTGTGCGATGGCTCCGTACAAGGTGGATTTTTCTCCCTAGAGATAGAGCGTGGTGCC
AAACCGAGGCCTTTAATGTAGAAATATTAAGAGCGGTTGAAAAGATGAGAGTAACCTCTG
AGTTGCTTGTACGTAGTAAGACGGAGTTTAAACGTCCCAAGAAACGTCTCCACACTGGGC
AGGGAACGTGACTACTGACTGTGCTGTATTGTAAACACCCAAGCTCTTAATACAGTGCTC
TGCACATAGTGAACGCTCAGTGAATATGATTGAAGACAAACTTTTCTGATTATTCTTTAG
AAGATAAATTAATCTAGGGATTGTTGCATATCCTTCAGCCCTAATCTCATCCCATTTTAA
CCGGTATTGGGTGGCCACCTGACATGAGGCTTCCCTTTGACTATTTACGTGTGTGTTCCT
GTGTGAATTAGTTTCTTGAGGCCTGCAGCTACTGGAGCTCATTGAGTTCTAATCCCAGCT
CTGCCCTGTCTGCTGTGTGTCACTTCACTTCTCTAGGCCTCAGTGATCTCATCTGTAAAT
GGGGTTTAAGACTGTGAACCCCATGGTGGGCATGGACTGTGTCTAATCTGATCGGTTTGT
ATCAATACAGTGCCTGGCACTAAGCGCTTAACACTATAGAAAAAAACCAGACAGACATCT
GTCATGTGATGGAAGGAATCCCTCCTCCCATCTCGAACTAGCTAAACACGTGGTCTGAGA
CATCGTCAGCCTGGAGGAATTAGTTCTCCAGGCCCTGACACACTGCTTTTCTCAGAACCA
TCGAACTAAACGTGTGGGTCTTCTCAACTTTTCCCCCAAACGAAGAGTTTGAAGCCTTTG
GCTTAGCTATTAACCCACCTGGTGTCAATTCCGTACAGGTGACGACGAAGGGGAAAGTCG
CGAGAGAGATGGGAGCGCCGCTGACGTAGACCCCTTTTTCACAAACCCAGCTGAGAATAC
GGAGTTTGCCTCCCCGTCCAGTACAGACTTAACAGAGGAGCAACAGCAGAGAATCGAGAG
GAACAGACGCCTGGCCTTGGAAAGGAGGCAGGCAAAGCTCGTGATCGACAGTCAGCCCCG
AGAAAATGGTAAGTCTCGGCGTGGTTTTGGGTAACCTTCAAGTTGGGGACACTCTTGTTC
TGCTTTTACTCTTCTGTCTTTGCAGCGTGGGTCGGTGGAAAGAGCACGGGCTTGCGAGTC
TGAGATGGTGGGTTCAGATCCTTCCAAGCGCTTAGTACAGTGCTCTACACATAAGCGCTC
TGTAAATACAGTCGAAGGAATCGTCCATATTATCCTCGAGATCCTTGTACCGTACAGGAG
GTTAGTCTAGCCGGAGAGATTTTGGGATATATTTATGTATATTTAAATACAACTCAAATT
GTACATTCCAAGCGCTTAGTACAGTGCTCTACACATAGTAAGCACTCAATAAATACTATT
GAATGAATGACTTTACTGATGAACTCCAGACTGTAAGTTCATGGGCAGGGAACTCTTAAA
TTGTACTCTCCCGAGCACTCAGTTCAATGTTCTGCACATAGTAAGCGCTCAAAAAATATG
ACTGGTTGAACATCCCGTTCCAAGTTCCTCTCTCCTTTGGGTATTATCTAATGAAACAGC
TTAAGCGGAGCAATGTAATTTAGGAGTGTGATTCTCTCTTTTTGGCAGATATGTCAATCT
CCGGGCCCACGACCGCGGTAGCCGAAGCAGCCGATGGTGATGATGAAGACGAAGGCGTTC
CGAGCGAGATAAGGGAAGGAGTTTTAGACACCCAATATAATACTGCTGCTGATTTGGAAA
ATATAGAGGATGGTGAACAATTAGGAAGTCCGGGCCTGTGAATCCTCTTTGAAGTTTGTT
AATAACTTCAAGATGATATTCTTCAGTTACCTAGGGATCTGCCAGCTCGATCAGCGGTAT
TCATCGAACGCTTACTGGATGCGGAGCACCGTATTGAGCACGCGGAAAAGTACGATAAAG
GGAGTCGATGTGACTTTTGCTCTCAAGCTCCCAACAACTGTTCTGTATAAGACCATCCAC
CTCCCCAGTCTTGTTTCCTTCGGCTAAGCCAGGTGGAGCTATCGATTGTGTTTTCAGTTG
AATATCACACCCTTATTTATACGTAAAAAGAGGCTTTGTCTGGCTTTTAATGATTACTGA
GATAGGGGGTTGAGTTTTATAAGTTTATGTAAGAAGGTGCTGCCGTGGCTTTTCTGTATT
GTATTTTGACATATTCAAAATACAATATATTTTGATATAGCCAGCGTGCGATTTCTTCAG
TTAACTTGATGGCTAAAAGCAAAAATAAAGTGTTTTCAGGTATTTAAATCACTGAACGTT
CATGTTGCGGAATGCGGAACAATAAAAGCTACTGTTTTACAAAAGAGACTGTGGAGTTGT
CAGTATATCTGCTGTCATCATAAAGTTGTTCTACTGGAAGTGGCTCTCAAGCCGTAAGCT
CTAATAATAATTAGTAACTGTGGAATTTAAGCAACTACTGTAGGCCAAGCACTTGGACTA
AGCGCTGGGGTGAGCTCGTCGTGGGGAGGGACCGCGTCTTGTTTTATTGTATTCTCCCAA
GGGCTTAGTTGAGTGCTTTGCACACGGGAAAGCTCAGAAAATTGAATGAATGAATAGCAG
AAAATCATGGTTCCTCGATTTCGTCTATCTCGCCGCCAACCTCTCACCCCCTTCCTGTCT
CTGGCCTGCAACGCCCTCCCTCATGTCCAACGGAGGACAGTGACCCTTCCCCGCTTCAAA
GCCTTATCGAAGGCCCAGCTCCTCCAAGAGGCCTTCCTCGACTAAGCCCCCCCCTTTCCT
CTCTTCCCACTCCCTTCTGCATCACCCTGAGGTGCTCCTTTTATTCGCCGCTCCCTCAGC
CGCCCAGTACATAGCTGTAATTAAATTAATGTCGGTCTCCCCCTCTAGATTGAGCTCGTT
CATTCGTTCAGTTGTATTTACTGAACACTTACTGTGTGAAAAGCACTATTCTAAGCCTTG
GGAGAGTAAGGGCTCAATACAGTACGCACAGGAAGCGCTCAATAAATATGACCGTGTGAC
TGAGAGTACAGTATAACAACAGGCACGTTCCTGCCCACAGTGAGCTCGGTCTAGAGGAGG
AGACGGACGTTAATATAAATAAATTCGGGTCGATATAGATGTATACACACATGCTGTGAG
GCGGGGAGGATGGATGAATGGTCAAGCTGGTGGGGAAACAAGCTCGTTGTAGGCAGGGAA
CGTGTCTATCGACTGTTAGACTGTGCTCTGCACCCAGTAAGCACTCAGATACGATCGACT
GAATACATTATACTGGTACTCTCAACACACTCTGACATGAGTGGCACTTAATAATAATCG
TGATATCAGGTGCTTATTATGTGCCACTCACCGTACTAAACGCTGGAATGGATACCAACG
AATCGGGCTGGACACAGTCCCCGTCCCTCGCGGGGCTCGACGCCTCCCCGTTTTACAGAT
GAGGGAACCGAGGCCCAGAGAGGCGAAGCGACTTGCCCACGGTCACACGGCGCACAAGTG
GCAGAGGCTGAATTAGAACCCAGGTCCCCCTGACGCCCGGGCCCGTGCTGCTTCTCTTTA
GAAACTTGGGTTTCTAAATTCACATCCTGCTCCATCCAGTTTTACACCTCTGGCTTCTGG
CGCTACCCTGGGGAGTGGAGGTATGGGGGGGCGGGGGGAGCACAGGAGAGCCTTGAGGAA
TCGGGGGGAGCTCAGAAGGCCACGGAAGGCAAGGTTACCTCATCCTCAGGCGCAGGTCCC
ATGGGGAACGTTCTGACAACACTGAGGCCTCAATGCGTTTATGTTGACATCGTCCCGGCT
CGTTTTGGGAAAGGAAAAGGGAGGCGGGGGTGGGGAGGGGGTGGTCCATACATCTCCGTC
CCCTTCTTTCTCAGCAAACAACCCCCCGTTACAGCGCCCGTGAGAAAGTTGTTCTGCAGA
ACTTTTTGCCCTAGGATGCAAGTTTGAAGATCATCTCTATTAAAAAAAAACACCACCACG
GTCAACTCATTCCAATCATGTGAACGTTTGAAAACGTACCGTTTTCTGGAAATGTGTATT
TCTTGAGGGCAGGAACAGAGAAAGTTGTTCCGAAGAACTTTTTGCCCTAGGACCCAAGTT
TGAAGATCGCCTCTATTAAAAAACACCATCACGGTCAACTCATTCCAATCGTCTGAACGT
TTGAAAACGTACCGTTTTCTGGAAATGTGGATTTCTTGAGGGCAGGAAAAAAGGGACTTC
ATTACCTTACGCGCATCCGTTTTCTCAGTGTACGAGCTGCCGAGGAGGAGGTTAATCAAA
TAGACTGTACAGATCGTCTTTAAACGGGGCTGGCTGACACGAGGAACTGCCAGAGAATGA
CCGGCTCCCACGATAGCCCGTTTGTACCCTCTGCTCTACCCAATTTAGTTTGGTGCTTAT
AAACCCGTGTACACGATTGGAATTGTCTCTTCATCCTGTCAGTCGTATTACCGAGCGCTC
ACTGTGTGCAGAACACCGTACTCAGCGCTTGGGAGACTGTACAACAACAATGAACGGAGA
CGATTCCCGCCCACGACGAGCCGACGGTCTCGGTGATAAGACCTTACCGCTACGACGGCA
GACGATAAAACCGATCCAAAAGGAAGAAACTCGCTTTTAAGTTATAAAACGGCAGCTTCG
GAACAGCCGATAGGAAAAGAGGATTTAAAAAAACCAATATAAGGCAAAGCTCCTTCGGCG
GAGCTGAGGTAGTTTACTTCCCACAGCTCGCGGACTCGTCCGTGAGAGAGAGGTCTCGTA
TCTCTTCCAGGAGCAGGTAGAGACTGTCCCCCTTCGTCTGGCGGTATTCCCGGAGGTCTT
CCCGACCGACTTTCGTCTCCGCGGCCTCTTGGGCGAGGTGAGCGGCCGACTGGGTCACCT
CGCGGACTAAATCGCTCTTCGCCGTCCGGTGGGCACTCTGAGAAGGGAGGGCCATCTCCG
CCGCCAGGCACGGTCGGTTGCTGGCGATCTCCAGCCTGACGGTGTCCCTGTGGCAGCGAG
ACGTCTGGACCGAGATCCGGACCTTTCCGAGGCGAGAGCACCGTCGCGTCATCCTCTCGG
CCTTCGGTAGCCCCCGCCCCGCCCTTCGCGAGTCCCCGACTTACCGTGACGTGGTCGAAC
ATGTTGAAGGTGACGGAGTCGCCCCCCGTCGTGGCCAAAGTGATTCTGTTCTGGAAGCGC
TGGACGGACCCCGGCTTCCACTCACAGCTTCCGTCCGGGCGGCAAGAGACCACCAAGCCC
TCTTTGTTTCTCAGGTAGGCGGCGCCTTTGATGCCAAACCTGAATCGGGGAGGAAAGAAA
AATGCGGAGCTGTCCAATTCCCAAGGGTGCGGACCTCGGCTCGTATCGTAGCCGTTCATT
CGATCCTGTCTCCCGAGCCTGGCGCGTGGTAAGCGCTCAACGAATGCCATCATTACTATC
GAGCGCTTACTGTGTGCAAAGCGCTGCACTTAGCGATTGGGAGAGTACAACAGAACAATA
TACAGACACATTCCCGGCCCACAGTGAGCTCACAATCTAGAGGGGGAGAGAGACATTAAT
AGAAATCAATAAATGACAGATATGTATGAGTGCTGTGGGGCTGGGTCGGGGGGGGGAGAC
TGTGTGTCCAACCCGCTCTGCTGTATCCACCCCAGCGCTTAGTGCAGTGCCCGGCACATA
GTAAGTGCTTAACGGATACCAAGCCGTTCGTCCATTCCATCGTATTTATTGAGCTCTTAC
TGTAGGCAAAGCACTACTACTAAGCGCTTGGGAGAGTACAGTAAAACAAAAGACACATTC
CCTGCCTGGAACGAGCTCACAGTCTAGAGGGGGAGACTGACATTAATATAAATAGATGAG
GTCATTGAGGCACAAAGGAATTAAATGACTTGCCCAAGGTCACAGCAGATAAGTGGCAGA
GCCAGGATTAGAACCCATTTCTTCTGACTCCCCGGCCCGGGCTCTTTCCACTGAGCCACG
CTAAATTACAGATTTATGCATATGGGATGGGATGGGAGAATGAAGGAAGGAGCAAGTAAG
AGCGGCACAGAAAGGAGGGTGAGAAGAGGAGAGGAAAGCTTATTATTATTATATAGCAAG
CCAACTCACCTGGGAATAAACACGAGCACCCCGTTGGTTCGAATTGAATAAATGATGCCA
TCCGCTGTGCAGTGTTCTTCTGTGGCGGGGTCTTTGTCTTTGAAATACATACACTGGAAC
AGCTCCGTGGACTCTTTCTGGGAACGCTGGGCGGCCTGGGAGAGCAAGCGGAGATCGGGG
GGAGGCACCGTTAACCGTGTGGCTCGGTGGAAACGGCCGACGCTGAAAACCGGCCACCTC
GTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 2900..2993, 3229..3304, 4453..4575, 5675..5738, 7418..7627, 8208..11904
1001..1133, 2900..2993, 3229..3304, 4453..4575, 5675..5738, 7418..7627, 8208..8380
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved