Ornithorhynchus_anatinus Locus Mono:SNORA56
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Mono:SNORA56
Ornithorhynchus_anatinus
Mono:SNORA56
Ultra181
SNORA56
1001..1124
2124
GTGCTTAACCAATACCATTTTTTTAAAAAGCCGGGATTAGAAGCCAGGCCTCCTGCCTG
GGCTCTGGGCTCTTTCCCCTGAATCAAGCTGCCTCCCAACATCATGCAGCACATGATGGG
CTATGGAAGAGCTGCAGTATTTAAATGCTTCTCTAGGGCAAGCTGCGACATCAGCAAGGG
ATTGTCAACCATAAAATCCCAGCTGAAAGAGCTCCGGGAAGCACTTGGGAAGCGCCCTGA
TCCTGGTCAGCCACTCCTAAAGCCCTCCATTTCTCCCAATTCTTCTAACACAGGTTTGGT
GACAATAATAATAATAATAATAGTGGTATTTGTTAAGCGCTTACTTTGCGCCAGACGCTG
TACTAAGTGCTGGGGGTGGACGCAAACAAATTCATTCATTCATTCATTCAATAGTATTTA
TTGAGTGCTTACTATGTGCAGAGCACTGTACTAGCGCTTGGAATGGACAGATCGGTCACA
GATAGAGACAGTCCCTGCCCTTCGACGGGCTTACGGTCTAATCGGGGGAGGCGGACAGAC
AAGAACGATAGCAATAAATAGAATCAAGGGGATGGTCGGACACAGTCCCTGTCCCACATG
GGATTCACAGTCTTAATCCTCATTTTACAGATGAGGTAACTGAGGCCCAGAGAAGTGAAG
TGACTTGCTCAAGGCCACACAGCAGACAAGCGATGGAGCCAGGAGTAGAACCCATGACCT
TCTGACACCCAGGTCCACGCTCTACCCACTACACCATGCTCCTTCCCAAGTCCCTTCCCG
GCTACTCCCGCCATCTTGGAGAAAGTATCTCTAGCCCTTCTGGAGACAGATCTCAAGTTC
TGAGATGGCAATAACATGAAATGGTTTCTTCGATCAGTAACAGTGAAAACAAATCCAGTT
CAAACCGCCTTTCCCTACATCTCATACTTTGCCCCTGGGAGTCACAGCCCTCGGGTCGAG
CACCCTTCTCTCGGGACTTGCCAGGTTCCAGGCTCTCCCTCTCTCAGTTACCTCTCTCTG
GTCTGATCCGGTGACTCTAGAGGAAGTCGGCCTGCAAAATCAAATGCAAGGCCCCGTTTC
TGACCACCATCACAGTGGCGGTGGTTCCAGATTTGCCACACGCCATCAAGCACCACAGAG
AAATCCTGTAAATTTTAGCAACTCCAAGTCATAATAATTTGCATTTAAACCCTTAGAGCC
CTGAGGAAGATACGATATAATCAGGTCAGACACGGGGCTCGTTATCTTAAGTAGGAGGGA
GAACGAGTTTTGAATCTGGCATTTTACAGACGAGGGAGTCATCCACAAATGAATCTCTCC
CAGCCCCACAGCACTTAGATACGTATCTCTAATTTACCTAACGTCTGCTTCTCCCTCTAG
ACTGGAAGCTTGTTGTGGGCAGGGAATGGGTCTGTTATACTGTGTTCTCCCAAGTGCTTA
GTACAGTGCTCTGCACAAAGTAAGTGCTCAGTAAATACAATTGAATGAATCCATCCTTCA
GGAGCAGCGTCTCTAATCCCCCTTCCCAGGGCAGGAGTCCTAATTTGGGACCCCAAATCT
CCAAGGTATCCTAACCCTCACTTGTGTCCAGTAAGGGGTCACGGCATGATCTTTCCCTGT
GTTCTGCTCTTCCAGGCTCAGCTCACTTCCTCCCTTGGTGTGGTGGATAGACCGTGGGCC
TGGGAGTCAGAGGGTCGTGGGTTCTAAACCCAGCTCCGCCTCACGACTGCGGTGTCACCT
TCGGCAAGCCGCTTCACTTCTCTGGGCCTCAGTCCCCTCCTCGGTAAAATAGGGATTGAG
ACCGTGAGCCCCACGTGGGACAGGGGTTGTGTGTAACCAGATTGGCTTCTATCACCCCAG
AGCTTAGTTCAGTGCTTGGCACATAGTAAGTACTTAACAAATATCATTATTATTATTATT
ATTCTCCAACTACTGGCCTCTGCTACTTCCTTCCCCATTCTCTCTGATTTTCTTGTCTAA
GTTGTTACTCTTCCCTCAGGGAGAGGCACCACAGAGTGACTCTCTTGGCTTCCTCCCCTT
TCTCCCCTCCACCTTCATAAGTGTGGGGGCCATTCATTCATTCATTCAATCAAACACTGG
ACGCTTACTGTGTGCAGAGCACTGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved