Ornithorhynchus_anatinus Locus ENSOANG00000012964
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000012964
Ornithorhynchus_anatinus
ENSOANG00000012964
Ultra170
SNORD51, SNORA41
4238..4316, 4580..4714
6368
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTCCTCATCGCCATCTGCTTCGCCCACAGGTATGTGCCCTCCCAGGCGGATATCGCAGT
GTTTGAAGCCGTGTCCGGCCCGCCACCTGCCGACCTGTACCATGCCCTCCGTTGGTACAA
CCACATCAAGTCTTTTGAGAAGCAGAAGTCGAGGTGAGGTTCTTTCCCGGGCTTATTCAA
GAGGTGGAGTTAAACACGTTTCCAAGAAACTCGGTATTTTGGCCTCACGAGGGTCTTTAA
AGTGTTCAGGGTCACGGAAATCGGAGGGAGAGAGAGGATAGTCCTCCCCATTTTTTCTCA
GAACGAGTGAGGAGTAAGAATAATTGTCTGTTATGGGATCGATCCGTGTGGTCATCCAAT
TGAAGGCCGGCTCTGTTCCTGCTCAAGAGAAGCAGCGAGGCCTAGTGGAAAGAACGCGGG
CCTGGGTGGGTAATCTCAGGTCCACCATGTACCTGCTGTGTGACCTTGGCAAGAAATTGT
TCTGTGCCTCAGGTCCTTCATCTGCATAACGGGCGGGTTCGTTACCAGTTCCCTCTCCTA
CTTTGACTGGGAGCCCCATGTGGGACAGGGACTGTCTCCATCCCCATTTGCTTGTATCCA
CCCGGGCGCTTAGTAGAGTGGTTGGCATGTACTAAGTGCTTCACCAATACCCCGAGTATT
ATAATAATGCGGGATCAGCTCATCTCGTTGAACCGTTTTCCTCCACACTGACCTGGGCAG
ACCACTGCAGTTGCTATGCCTCTTTGATTTATGGCCTTTCCACAGAAACTACCAGCAGGT
TGCCAGACTCGAGGACTTGGAGTGGACACCAGTCCAATATGGAGGGGTCTGAATTCATCG
CTGATAGGGATTTACTTGTAAGTTCAGAATTGAACATCCCGGCATTATAAAGTGGTTAGG
GCCTGAAAGTATTCTACAGAGAATTGCGCAGAAGAGCTATCATTTCTATTCCCACCATCC
ACATTTCCAATTTGCTGCCCCTTCCCTTATTAGATGGGGTGCAGAATTGTCAGGCCCCCA
GCATTGATAAGAAAACCAATGTCTAAATCTTGATTTTGAAGGAGGGGTTTGGATTTGGAG
AGCAGATTTTAGTCACCATAATCCTTCTGGAATTCAGCCTTTACGCTTTCCCACTTTCTG
TCCCCATTATCGCTAGCAGCATCTGTTGACACCTTCACGCAAAAGCCCTGTATTCACTCG
AATGAGTACAAGAGTAAGGAAAGATGATCCCTGCCCTCTGGCAGGGGGAGGCAGACACCT
AAATAAATTATGACTTGGGTGTGCTGCGGTGCTTTCTAAGTGCAAGCACAAAGACGCAGC
GTGGCTAAGTGGAAAGAGCCTGGGCTTGGGAGTGCTAATGTGGGTGCTAATCCTGGCTCT
GCCACTTATCAGCTTTGCGACTTTGGGCAAGTCACCTCACTTCTGCGCCTCAGTTTCCTC
ATTTGTAAAATGGGGATTAACACTGAGCCCCACGTGGGACAATTTGATAACCTCGTGTCT
ACCCCAGCATTTAGAACGGTGCTTGGCACATAGTAAGCACTTAACAAATACCATCATTAT
TATTTATGTATTTAGGTGGAGCAGAAGGGCCCAAGGTGGCGTGTTGAGTGATGAAGCACT
TGGGGATTCAAAACCCCTTGCACATGTCTCTCTACCTTTTATTTCCTTTTAGTGTCTGTC
TCCCTCACTGGGTGGCAAACTCCTTGAGGGAAGAGGTTACGTCTGCTAACAGAGTGGTGG
GGGCTAGTGGACTGAGCACAGGATGGGAGTCAGGAGACCTGGGTTCTAATCCTGGCTCTG
TTGGCTGTGTCATCTTGGACAAGTACCTTTATCGGTGATATTTCTATTATATTCTGCCCA
TGACTTCTTGGGTCCTGCATACGGTAAATAGGTAGTAGAAGGGTAGACATACAGATTGGA
CCCGTTCCCATCCCTCACTAAGGCAAACAGTCCATGGACCCAAGTGGACACTCAATAGCC
CTGCTCCCTGAAATGTCGGGAGAGCCAACGTGCGATATCCGATACTAGATTTGTGGACTA
GCTGATTCCGTAGGGACACGTGTAGATGGCCGTTGGGATGAAAACCCACGTGGTTTTCAA
AATAACCAGCTTTTTAATCCAACCCTAATTGTAAATCTGGTAAAAAAAAAACAAAACATA
CAACCTGCAAAGCCAAGCCTTAATATTTGTGTAACTGGATTTATGATACCAAGTGCTTGC
TCTGTGCCAGGCACTGTAGGAGGTTCAAAATATTGGACCCAATCTAGCGCTTAGAACACT
GTTGGGCTCATAGTAAGCGCTTAACAAATACCGTCATTATCTAAGGAAGGAATGGGATTT
AATCCCCAATTAAAATAACTTGCTGCAGGTCTCACAACGGACAAGTGGTGGAGCTGGGGT
CAGAGCCCACGTCCTCTGACTTTAGGTCTGTGCTCTTTCCACCATGCCACACTGCTTCCC
TGACTGCGCTGTGTATTTTAATTAATGGGGAAACGATGTGGGAAGAACAAGGAGTCGGGG
GAATCTGGGTTCTAATCCTGACTCTGCCACTTGCTTGTCAAATGGGCCTGTTCTCCCTCC
TACTTAAGACTGAACCTCACGTGGGTGATGATCTTGTATCTCCCCCAGGGCTCAGTACAG
TGCCGGGCACATAGTAAGCACTTAGCAAATGCCAAGGTGTTTAATACGATTAGTAATTGG
CTTTAAAAGTGTCTTCCTCCCCCTTTCCCACCCCCTCCAGCCTGCCAGGAGTGAAGAAGG
CTTTGGGCAAGTACGGTCCCGCCGATGTGGAAGACAGCACGGGAAGTGGTGCCGCTGACA
GCAAAGATGACGATGACATTGACCTTTTTGGCTCTGATGATGAGGAGGTGAGTCTCAGCC
CAGGACCGCTCAGGGTGTTGGTTGAGCCACCTGGCCCGCAGAGCTTTCCTTTAACCTCAT
TAGAATTCTACCCATTAGGTTCAGTGCATCTAGTGCTTAGTACAGTGCTCTGCACACAGT
ACGTGCCCAGTAAATCGATCGCATCGCTCAACTCGAGAACCAAATCGTTCCTTGAAAGGG
AATTTTTTCGACAGGAAGCAAAACGCATAAGAATTTCATCGTGCTGACCTGCAGGTGCTG
GGCATGGGGTTACTCTTGCTGCACCGGTGACACGGGGGTGTTCGGTTTAAACCAATAGGA
ATAAAATTAGGCCTAGCAGCACTGATGCTAAAACACGGCTGGCTACATGATGAATCAAAT
CAAATCACCATCTTTCGGCTGAGATCGTGATGGATCTGCTTTATTCTGACCAAGCTGGCT
TATTTGCACACACCATCTAGGACTGCTCTCTAAGATTTGAGTAGTAAACTGTTTTTCTTT
GACAGGAAAGCGAAGAAGCCAAGAGACTAAGGGAAGAGCGCCTTGCTCAGTACGAATCCA
AGAAGTCTAAAAGTATGTAGTTAATTTTGAAAGTCGCGTTTTTATGACTACTCGTACACT
TGTTCCCAGTCAGATAGGTAGCTAACCTAACCCGGAGGGCTAGTTGTCGGTGGGGGTGGG
ATTCCGTAACCTGGAAGGCCTTCCACAGCTACTGGTCTGCAGCTGTTGTGCTCTGTAGCA
GTTGCAGTATTCCATCTGTGGGAAAGAAACTTGTTGACACTGTTCGTTACCCCTTTCTCG
GCAACAGAATGGGGTTTTCTGTGCGACAGACAAATGCAACAGAAGATTCCACGTCGTCGG
TTGGTGGTGCTTTAATTCGGATGGGCTGGTGGTCCGGAAAGTGTTTGGGGTGTGAGGAGT
GATCAAAGTGTCATCACTGGGCACGGTTAATGCTGAATCTCCTATCTTCTAGAGCCCGCA
CTCATTGCCAAGTCTTCCCTGTTGTTGGATGTGAAACCTTGGGACGACGAGACGGATATG
GCAAAATTGGAGGAATGTGTCAGGAGCATTCAGGCAGATGGCCTCGTCTGGGGGTCCTGT
AAGTTGGAAATGATTACCTTATTGTATTGGGAATTTTCGTGGTGAAAGGAATTGCTGTCT
CCTGGGGGGTGAGGTATGCATACACACCCACAGTTCTTGTTTTTTAATCAGTGCTGCAAA
TTTTGTGCTTTCCTGTCTCCTTTCAGCCAAACTGGTTCCAGTGGGATATGGTATCAAGAA
ACTCCAAATTCAGTGTGTGGTGGAGGATGATAAAGTTGGAACAGACATGTTGGAGGAGCA
GATAACAGCCTTCGAAGATTATGTGCAGTCCATGGATGTTGCCGCTTTCAATAAGATCTA
AGTCATCCTCGAAAATGGTGCATCAATAAAAGAATGTGCAAGACTGGTCTTGTTTGGTCT
TGAGTGTTTCCGTTCCAGAGGCCCATATCTGAGTGCCGAAAATTTAAAAGTATTTGCTTA
CCGTGTGCTGAGCATTGTCCTGAACACTTGGGAGATTGGTCTGCAGATTTGGTAGACATG
TTCCCTGATCAGAAGGACCTTCTAGACCAGAAAAGGAGATAAAGATTAGTACAACAGATT
TGCTGCGGGGTGCAAATTCAGCTGCAAGGGTTTGAAGCCTGAGGTGTTCTAGAGGCAGCT
TGTGGCTTTTCAGGCATGATTGCCCTAAAATGTCCAGCTCCTTCAGTCCCTCCCTCCTGC
CCCTTCAACCCCTCCCATTTTTTCCAGTAAAATGGCCAGAGACTATATCCTGCTTTCTCT
CAATCAACCCCCTGACCTCATCCCATCACTAAACGCTCAGTTCAGCGTGGCTCAGTGGAA
AGAGCTCGGGCTTGGGAGTCAGCGGTCATGGGTTCGAATCCCAGCTCTGCCACCTGTCAG
CTGTGTGACTGGGCAAATCACTTAACTTCTCTGTGCCTCAGTTACCTCATCTTGAAAATG
GGAATTAACTGAGCCTCACATGGGACAACCTGATTACCCTGTATCTAGCCCAGTGCTTAG
AACAGTGCTCTTCAAATAGTAAGCGCTTAACAAATACCAACATAAGAGTTGGTAGGCAGG
TTCCCAAGCCCCCTCATCTCCCCACCTTTTGCAGGGCCAGGATGTGTCCTGCCCTGCACC
TACCGTGGGGACTCCTGGGCCTCCACCTCGTGTGGGCAGAAAAAGACCTCACTCAGCCAC
TTACCCCTTTACTCCCTGGTGGCCCATCAACCGTGTGCTCTCCAATGGCTTCATCCCCAC
TGCTTTTAAAACATGCCCACGTCTTCCCTATCCTTAAATAACCCCTCCCTTGACCCCATG
GTTCCCTCCAGTTATTGCTTCGTGTCCTTACCATTCCTTTCTAAATTCCTTGAGCGAGTT
TCTGGCTTCTGTCCCCTTCACAGAAACCACCTGCCTTCTCACAGGTCACAAATGATTGCC
TTCTTGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1020..1172, 3760..3886, 4385..4451, 4852..4977, 5126..5368
1020..1172, 3760..3886, 4385..4451, 4852..4977, 5126..5280
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved