Ornithorhynchus_anatinus Locus ENSOANG00000020299
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000020299
Ornithorhynchus_anatinus
ENSOANG00000020299
Ultra157
SNORA17, SNORA17, SNORA43
312..445, 753..885, 1075..1207
5367
TAAGACTGAGCCCCATGGGGATAGGGACTGTCCAACCTAATTGACTTGTATAAACCCCA
GTTCTTAGTAGTTCCTGGTATGTAGTAAGCTCTTAATACCATTAAAAAAGTGACTTACCT
GTGGCCTTATGACAGGTAAGTGGCAGGTGGGATTGGCACCCAGGTCACTGGGCCATGATG
CTTCCCTTCCCCGTTTTACCCGTGAGGGAACAGAGGCCCAGAGAGATGGAAAAGGTGCTG
ACTGGGTGAGAATAAGTTCAAGGACTCCCAAAACTTTCCAGAGAACATAGGAGCAAATCC
ACAAGTGGTCATGGTGCCCCTCGAGGCGTTGCAGATGTGGCTGCGGTGCCCCATTTGTGT
CATGAGGTGGCAGAGAGGATAAGGCTATGTCTACGCTCCGTGTTCAAAAATTTGTGAGCA
CGCAGAATGATTAATAGCCTGACAGTTTCCCAGGGAACATCCGAGTGGATATTGCATAGT
GCTTTTGACACCTGGAATCATCTGAGCTGTGCTTCAGCGCTGCCTAATTGTTCTTCGGTT
TATATTTTTCTCTCTAGGCTTTGGCCAGAGGCTGAAATGAGATGACTAGAAATGGTGAGT
GAGCTTTTTTTTGAGGATCGATGGATTCTCTGATTATTTTTCTAGGAATCTGAATGTCCC
TGGGCTTAGATCTGAGCTTGTCTGGTGATGGGTGCAACCTGAAGGCCCCCTCTCCCCCCC
CCAAAAAGCCTTCCAGGTTCCAATTTGTTGAATGCTACCTTACAGGTGTCACAGGTGTGG
CTACTTTACTATGTCTGTGTCATTGGGTGGCAGAAAGAAAGTGGCTTTGTCTACGCTCAG
TGTTCAAAACCCCGTGAGCACTCAGAATGGTTAATGGCCCGACACATTTAGTACAATGTG
GCTATGGTATCTTGGGATGGAACTGTAGGAGGTGGATTATTGGGGGCTTTGTCCTGACCT
AGAACATGTGGAGATACGTATTATATGTCTTCTATCCTCTAGAGTAGCAGGACCCGTGAT
CCTGCAGCCCCAGAAGAACTTTGTGGAATGAGGTGAGACGGGGCAGTTGGTGGTATATGC
CCCTAGAGGCGTACAGATGGGGCTGCTGTGCCTCATTTGTGTCATATGGTGGCATAGAGC
AAAAGGCTATGTCTACGCTCGGTGTTCTCAGTCCATGAACACTCAGAATGATTAGTAGCC
TGACAATGTCTAGTTTTGTTTGATGAGAATCAAAAAAAAAATCCAGGAGGCTACTGGATG
TCCTTTGTCAGCCTTGGTTCTTCATTGCCCATGAAGAAAGACATTCCATCCCATTCTCTG
CTGCCCAGATCACTCTTCTAAAGTCTAGTTCTGCATACATCTCCCCATTCAGAGAAACAC
CATCATCACAGACCTTAAATCCCTTGTAGCTTTCCCTCCTGCCTTCTGCCATGACTCTCT
TTCTCATACCCTCCCCCTTTTCTTTCATCCATCTCATATTCAAATCCCTTCTGAAATCAT
CCAGGCTGACTGTTTTATTCCCCCAACTTCCTATTCGCGTAAGTGATGAACACATATCCC
TGTACCTACTTCACTTGCCCTATTCCTAATAACTGTATGTGTTAAAAGATACAAGATCAT
CGGGAAGGTTACCATCCCTGACCCACGTGGAAGGAGAACAGGTGTTTCAACACATGAAGA
AACTGAGACACAGGAATCTGCCTGAGGTCACACAGAAGCCAAGAGACAAAGCCAGGATTA
GTTGATAGGCCTGTGTTCTTTTCCACTACGGCATGTTGCTTCAACAGCCTTATCTAGATG
TATGTAATTGATTACGCACCATGTCCGTCACCTGTCCAAAAGCATGAAAAGTCACCGTAG
TCATGTCTTGTAAGTGACAGCCACTTCAAATCGACTCTCGGGGGAATTGGAACCAAATCG
GAAAAGTATCCGTTGAAGTGGTTGTGAACAGGGTGATTTTGACAGAATTGGAGTAAAGAA
CCAATAGTTGAAGTGAGGATAGATGCCTATCAGTGGCAATCATGTCCCACGTATAAGGCT
GTAGGATTGAAAGGAGACAACAGCTTGTCTCTGGAAGGGCAACGTGCATAGCAGTCATTT
CTGGCTGCTGCAGCCCAGAAGTAGTCTCTTGCCTACTTTCTCAGAACCCTGGGTAATTAC
CAAGTCAGGTAGAAGCAAGTATGACTAATTTCTTGGCATCCAGAGTGGTGCATTGTGCCA
CTCGTGCCAGTTTCTACAGTCAGTGTGCCATTGAATCATAACGGCTTGGCCGTTTTGCAC
TTAGGCTCGCTCTTACTGTGGAAAAACCAGAGGCTGTTTTCACGTAGGCCTTTGCTTTGC
TCTCCAGGTGGAGAGGACAGTATGCAATTACTGGGAGAACTGCTGTGGTGACAAGTTTAG
TTTTCGATACAAACCTTCCCTGTGGCTTGGATTGGAGGTTCTAAGAAGTGACTGCAATGG
CCTGTGGCGATGCTCCCCATGATAAAGATCTTTATTGCTTTTCATGTCCACAGTTCTATG
CCTACAGAAGACACTGGCTGACTAGATGCATTTGGCATTCGGCATTCTGCACATGGCTGA
CAGCATAAGCACCGGCTGGATTAGAAGGTATGATAGCAATGATTGTTCTTGAGCGCTGGG
GGAAAAAATCAGAAGAGAGTGGGCACTGCGGGGGCTTACGGTCTAAAAATGAGGTGGAAA
AGAGTTTGGTAACAAGCCCAGTGGGGAAGGTGAAAGAATGTAGCTACAAAACAATATAAA
ATGGAATTCAGAGTCCAAGTCCAGTGGTGGTAAGGGAAACACGTAGGGGCCTGTGGGGCC
AGCCTGCCACTCAGATCGAGTCCATTCATCTCCAAAGTCCTGGACTTGACTGGAGTAGCT
GCTGCTTAAATCCTCAGTGGCCCTGCCTACACCAGGCTGTGTTGGGATTGGCCCTGACTT
GATGGAGGACGTTGAGGGTGGTGAGTGGTTTATGTAATCCCGGCTAAATAGTTATGGATC
CTGCTGAAAGGCATTCCAAAGCTCAGGTCCCTGCCTGTGTGTTTTCTCTGGGCTACCTTG
GAAAAATCAGTAATCAGGTGGGGCCTGTCTGCGCCAATAATGTGCCTGGTTTGAGCTTAA
CTTACCCACGCTGACCAGGAGGGACAGCGGTGTCTGGACTTAGCTCTCTGAACCCCCTGA
AGGCTCACGATGACTAATAGCTTGCAAAATCTGGCAGGGCTAAATGCTGGAGAATTTCCT
CATTAAATGGGCATTATTGGGGCCAAAGGTGTCATTAGCCAAGCGGGTGACTGCTGGCTG
GAAAATGAGCCATTTAATTGGGAAAAGGGTATTGCCTAATAGCAGCTTCCTAAAAGAATG
CTAATTAGGTTGAGCTGGCTCAAGATGCGAACAGTCTGCAAGAATTTGAGGTATTCGTTT
GGTTTCAAAATCCAGAATAGGTTTTATCCACTGGAAGCTAGCACCTTCAGCCCAGATTTG
AAGCTATAGCTTTCTGCTCGTTATAGGGCAGGGGCTGCTACTCTGTGCTTGTAATTTCTC
CAGTACACTTAGAAGGCTTTGCAAAAACTAGATTTGTAATAACAACTGGTGACTTCACTC
TTTTCATTTGCCCTTATTAAGTGATACCTTAGAGGTGCTTCTTTGATGGGGAGAGAACTT
TGGTAGGCTTGTTTGCCAAACATGATAAGGAAACTATAGCTGTTGAGGTGTCTGAACACT
AGGTAGATGTTTGGTTTTTCTAGTCTGATATTGTGTGTCAGGACAAGGAGTTATTCTGCT
GACTCTTGTCAAATCAAGGAAAACTGTAAAGATCATTGTTAGGTGCCATCTTGGCGTCAC
TAAGATTAATCGTTGATAGGCAAGTGTCTCTCTGCCTTTGAGTCTTGGTCTTTGTCTTGC
CAATCTCCGCATCACACATTCTGAAGATGTTTATCATTTAAGGTGCAGTGAGCATTGGAT
TTGGTTCCTTGCTTAGTGGAACTGTGTCCACTGGGTAGGTTTTCAGCTCTGTGGATTTTT
TTAGTAAGTGGTTATGTCGTAACGTTCTCTTTGGTATTTGCAGGGGCAGCTGCTGGTTCT
CTGGCAACTTCACGCCAAGGCCACCCCTGGAGTTGTGTCTACGCTACGTGGAGAAAAATG
ATACATTTTGAAACATTTTGGGCTTGGTGTGGTGACTTTTCAAGAGACTTTCAAAGCTCA
TCAATGAAAGTTGAATTTAAAAATCTGTGACACTTGAACCCAGTTTCTTGTAAATGACTG
TCACTGTGGTAAACTTTCTTGTGTTCCAGCCTCTCAAGCAGAACGTGACAAATTAATGCC
TTTTTCTCAAGAATAAGAGCATACTTTGAAACTTTGCAATGAGTTGGTCTTCACATCTTT
AATTAAGTTTGAGCATTCTGATCAGCTGAGTTGCAGTACAGCGTGCTTTGTTAGTATTTT
CACGCCTCTTCCCAATTCTGTCTCCGTGTTCCCCTGCGGCGGAAGAGTGGCCTTATTTTT
TAAGATCGGCAGCCGGTTGTGAAAAAACTTAGGAAATGAAGCATGCGTGTCTTCTCCCTG
TTCTTCCCCATATAGAAGTCTTTGAAGAGTTCATTATCTCCAATTAGAGTTAATGGAGTT
TAGGCCGAAAACTGTTTTGTTCCTAGACGTGAAAAACATTTGAATAGAAATTGCAACTTT
ATGCTTACTAAGGAAATTGGTTAGGGAATAGGAATTTAGTCTCTTAGCAGTCTTAAATTG
CTAAAATTTTCCTTTGAATAGGACTTTCAGCTGACTCTAGAGGTTAAAACTCAAGACTGG
GCTTCACAATAACTTCAGTCGGTCCTGCTGATTATAGGAAGTAAGAAATGGAGGTTTGGA
CAAGAGCAAAGGGATTTTAAAACGCTCAGAGGTTAAATCCCTGACAGTAGAACACAGAAT
CACGGTGGTCTGATGAAAAGAGCTTCAACTTGGGCACCAGGGGACCTGGGTTCTAATCCC
AGCTCCACCACTTGTCCCTTATGTGACCTTGGGATTTCGGGAAAATCATTTCCCTTCCTG
CTGAAGTTACTTCATCTGTAAAATGGGGATCATGACCGAGTCCTATGTGGGATACTGTAA
CAGTATTTGATGAGCGCTTACAGTGTGCCAAGCACTGTTCTAAATGTTGGGGAAGATATA
AATTAATGAGATTGGACATAGCCCCTGTCCCACCACAGGACCTGCAGTCTTGATATCCAT
TTTACAGATGAGTCCCAGAGAAGCCAAGTGACTTGCCGAAGTTCACACAGCAGATGTGGC
GGAGCAGGGATTAGAACCAAGGTCCTCCCAACTCCCAGACCCATGCTGTCCACTAAACCA
TGCTGCTTTAGCTTGACTCTACTCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 2513..2606, 4063..4367
2545..2606, 4063..4150
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved