Ornithorhynchus_anatinus Locus ENSOANG00000013360
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000013360
Ornithorhynchus_anatinus
ENSOANG00000013360
Ultra122
SNORA71
5450..5579
8593
TTGAGAAGCAGCATGGCTCAGTGGAAAGAGCCCGGGCTTGGGAGTCAGAGGTCATGGGT
TCTAATCCCGGCTCTGCCACTGATCAGCTGTGTGACTTTGGGCCAGTCACTTCACTTCTC
TGTGCCTCAGTGACCTCACCTGGAAAATGGGGATTAAAACTGTGAGCCCCAGGTGGGACA
ACCTCATCACTTTGTATCCTCCTCCCCCCAGCGCTCCTTGATTCTAACATCCCCTTGATT
CTATTTGCTCTGCCACTTGTCAGCTGTGTGACTGTGGGCAAGTCACTTAACTTCTCCGTG
CCTCAGTTACCTCATCTGTAAAATGGGGATTAAAAAACTGTGAGCCCCACGTGGGACAAC
CTGATCACCCTGTATCTACCCCAGCGCTTAGAACAGTGCTCTGCACATAGTAAACGCTTA
ACAAATACCAACTTTATTATTATTGTTATTTATTGCTATTTTTTGTCTGTCTCCCCCAAT
TAGACTGTAAGCCCGTCAATGGGCAGGGACTGTCTCTGTTGCCGATTTGTACATTCCAAG
CGCTTAGTACAGTGCTTTGCACATAGTAAGCACTCAATAAATACTATTGAATGAATGAAC
AGTGCTTTGCACATAGTAAGCGCTGAACAAATGCCATCATTATCAGCGTGGCTCAGTGGA
AAGAGCACGGGCTTTGGAGTCAGGAGTCAGGAGTTCGAATCCCAGCTCTGCCACTTGTCA
GCTGGGTGACTGTGGGCAAGTCACTTCACCTCTCTGGGCCTCGGTGACCTCATCTGTAAA
ATGGGGATGAAGACTGTGAGCCCCACGTGGGACAACCTGATTCCCCTGTGTCTACCCCAG
CGCATAGAACAGTGCTCTGCACATAATAAGCGCTTAGCAAATACCAACATTATTATTGTT
ATTATTATTATCATCACCATGACTGATTGAAGGGGGCCGCCCCTGGCCTTCACGACGACG
GCCGCTGCGCTTCCCCTCCTGTCCGCCGAGGGCCGCTGTGGTGCCGCTGCCCTAACTAGG
CGCCTCCGGGCCGGGCGGAAGCGGCGCTCTTGCCCCCGCTTTATAGCTCTTTTCCCGGCA
TCCTTTGCTCTCTTCTGCCCGCCGCCGCCGACAACATGGTGAGTCTTCCCCCCCTCGGCC
CGTCTCCTCTGCCATCCGCCTCCATCCGCTCTTCTCCGCGGCCGGGCCGGGCCGCAGATG
GCCTCGGGGTCCACAGCCACCTCCGTTCTCCCTGTTTCCGCCCCGGATGGCGCGGCGGGG
TCCCTCGGCCCGGGGAGAGGGTCCTGCGGGACCGAGAGGAGATCCCGATCCAAAACGGGA
TGGGGATGGAAGGGGCCGGGAATACCGGGATGACCCGAAACCCGGTCCGATTCGATCGGG
AGCGAGGCCGGTGTTGGTCGCCTTCCTGGAGGGGATGGCGGAGGAGCCCCCCCGGGCTGG
GGGAGGGGACAGGACCGGTCGCTAACCCCTCCCCGTCCCCAGGGTCGTGTCCGGACCAAA
ACGGTGAAGAAGGCCGCGCGGGTCATCATCGAAAAGTACTACACTCGCCTGGGCAACGAC
TTCCACACCAACAAGCGCGTGTGTGAGGAAATCGCCATCATCCCCAGCAAAAAACTACGC
AACAAGATCGCGGGGTGAGCCCGGGGGGAGCCGGGGAGGGTGGGGGACCCCCCCAAAGCT
AAGCAGGTGTGTTGGGGGGAGAGGGTTTATGAAGAATAATAATAACGTTGGTATTTGTTA
AGCGCTTACTCTGTGCAGAGCACTGTTCTACAGGGTCATCAGGTTGTCCCACGTAAGGCT
CCCAGTCTTCATCCCCATTTTAATAGCATTGGTATTTAAGTGCTGACTATGTGCAGAGCA
CTGTTCTAAGCTACGGGGTCATCAGGTTGTCCCACGTGATGCTCACAGTCGTCTTCCCCA
TTTTAGTAACATTGGTATATGTTAAGCGCTTACTATGTGCAGAGCACTGTTCTAAACTAC
AGGGTCATCAGGTTGTCCCACGTGAGGCTCCCAGTCTTCATCCCCATTTTAATAACATTG
GTATTTGTTAAGCGCTTACTATGTGCAGAGCACTGTCCCAAGCCCTGGGGTAGCTACAGG
GTCATCAGGTTGTCCCACGTGAGGCTCCCAGTCTTCATCCCCATTTTATTAGCATTGGTA
TTTGTTAAGCACTTACTATGTGCAGAGCTCTGTTCTAAACTACAGGGTCATCAGGTTGTC
CCACGAGAGGCTCCCAGTCTTCATCCCCATTTTAATACCATTGGATTTAAGTGCTTACTA
TGTGCAGAGCACTGTTCTAAGCTGCGGGGTCATCAGGTTGTACCACGTGACGCTCACAGT
CTTCATCCCCATTTTAGTAACATTGGTATATGTTAAGTGCTTACTATGTGCAGAACACTG
TTCTAAACTACAGGGTCATCAGGTTGTCCCACGAGAGGCTCCCAGTCTTCATCCCCATTT
TAATAACATTGGTATTTGTTAAGCGCTGACTATGTGCAGAGCACTGCTCTAAGAGCTGGG
GGAGATACAGGGTCATCAGGTTGTCCCACGTGAGGCTCACAGTCTTCATCCCCATTTTAG
TAACATTGGTATTTGTTAAGCGCTTATTATGTGCAGAGCACTGTTCTAAGCTACCGGGTC
ATCAGGTTGTCCCACGTGAGGCTCACAGTCTTCATCCCCATTTTAATAACATTGGTATTT
GTTAAGCGCTGACTCTGTGCAGAGCACTGTTCTAAGCTACAGGGTCGTCAGGTTGTCCCA
CGTGGGGCTCCCAGTCTTCATTCCCATTTTAGTAACATTGGTATTTGTTAAGCGCTTACT
ATGTGCAGAGCACTGTCCCAAGAGCTGGGGTAGCTACAGGGTCATCAGGTTGTCCCACAT
GAGGCTCACAGTCTTCATCCCCATTTTCAAGATGAGGTCACTGAGGCCCAGAGAAGTGAC
TGGCCTACTGTCACACAGCTGACAAGTGGCAGGGCCGGGTTGTGAACCCATGACCTCTGA
CTCCCCAGTCCAGGCTCTCTCCACCAAGCCACGGTTTAGCAGAGGGAGATTACGACCGCT
GACCCTGAGAAGCGATGTGGCCTAATGGAGAGTGCTCTGCACATAGTATTAATTGGTATT
TGTTTGTTATGCGCTTACTATGTGCCGAGCACTGTTCTAAGCGCTGGGGTAGACATAGGG
GAATCAGGTTGTCCCACGTGGGGCTCACAGTCTTAATCCCCATTTTACAGATGAGGTAAC
TGATGCACCGAGAAGTGAAGTGACTTGCCCATAGTCACACAGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAAAGAGCTCGGGCTT
GGGAGTCAGCAGTCATGGGTTCGAGTCCTGACTCCGCCACTTGTCAGCTGTGTGATTAAG
AGCAAGTCGCTTCACGTCTCTGGGCCTCAGTTACCTCATTTGTAAAATAGGGATTAACCG
TGAGCCTCACCTGGGTCAACCTGCTTACCCTGTATCTACCCCAGCACTTAGAACAGTGCT
CTGCACATAGTAAGTGCTGAACAAATACCAACATTATTATTCATCCCCATTTTACAGATG
AGGTCACTGAGGCCCACAGAAGTCAAGTGACTTGCCCATAGTCACACAGCTGACAAGTGG
CAGAGCCGGAATTCGAACCCATGACCTCTGACTCCCAAGCCTGGGCTCTTTCCACTGAGC
CACAGTTTAGCAGAGGGAGATTACGACTGCTGACCCTGAGAAGCGATGTGGCCTAATGGA
GAGTGCTCTGTACATAGTAAGTGCTCAGTAAATCCTATTGAATGGTCTAGAAGTCAGAAG
ACCTGGGTTCTAATGCCGGCCCCACCTCTTCCATGCTGTGAGTCTTTGCGGTGCCTCCGT
TTTCCCCGTCTGTAAAATGGGGATCGACTCTCTCTGCCCTCCCATAGACTGAGCTCTGTG
TAGGTCAGCTCTTGTCCTGATTGTGGTGGATCGAGGGCTTAGAGAAGCAGCGTGGCTCAG
TGGAAAGAGCCTGGGCTTGAGAGTCAGGGGTCATGGGTTCTAATCCCGGCTCTGCCGTTT
GTCAGCTCTATTGTCTGTGTATTGTACTCTCCCAAGCGCTCAGTTCTGTGCACACAGCAA
GCGCTCAGGTAGTGGGTTCTAATGCGGCTTTGCCCCCTGTCAGCCATGTGACCTTGGACA
AGTCACTTTACGTCCTCTGTGCCTCAGTTATCTCATCTGTAAAATGGGGGTGAAGACTGT
GAGACGTGGGGCAGCCTGATTACCATGTATCTACCCAGCGCCTAGAACAGTGTAAGCGCT
TAACAAATACCAACATTATTATTATTAATATGGTGTTTGGCATATAGTAGGCACCCAAGT
GCCCCTAGTATTATTAATGTGTATCATCCCAGCACTTACTGAGCACTTAAATACCATTCC
CATTCGGTCATATTTGTTGAGTGCTTACTGTGTACGGAGGACTGTACTAAGCGCTTGGGA
GAACAGACCCATTCCTGCCCACAACGAGCTCATAGTCTGTTGTCGTTATTTTGGCCGTCG
GGGGTGGACAGGACCAGTCGTAGGCCATGTGGTATAGTGGAAAGAGTCTTGGACCAATAG
TCAGGAGATACCGACCTTGCCGGTTTGACCTTGGGCATGTCACTTAGCTTCTGGGCTTTT
TTTTCCCTCCTGCAAAATAGGGGTGTGATGCTTAATCTTATCTCCCAGATTACAGGAAGG
GCAGGGACTTAGAGTGATGGAAAGAGGCTCATAAATGAAGGCACATTGAGTCTCCTCTTT
TCTAATTCTGATCCTTTGCATTTGGTGAGATTTAAGTCCCATCTCTGGGCCCCAAAATGG
GTATAAGGTGTGTGAACAGACCTGTACCCTTGTGCTGAAATTGATTGTCTTTGGGTTGGG
CCCCAGGGAAAACTATATGGCATCTCAAAAGTTGGTTCCAATACCCCAGCTCTTGTTCTG
CACATAATAATTGCATTTGTTAAGCATTTACTATGTGCCAGGCATTGTACTAAGCATTGG
GTAGCAAAACGGGTTGTTTGGGCTCACATCCGTTTTACAGATGGGGAACTGAGGCCCAGA
AAAGTTAAGTGACTGGCTGTGGGTCACACTGCGGCCAAGTAGCGGGCCTGGGTTTAGAAC
ACAGGTCCTTCAGATTTCCAGGCCCTTGCTCATCCATTCCATCACAGTCTCTGCCCTATC
GACTTTTTAGTCAGAAGTTGGAGTGGCAGACCTAATGGGGAAGGAGCACAGGCCTGGGAG
TCAGGATCTGGGTTCTAATCGTCCGACCTCCATTAAACTGCCTGGCATAAGTAAACACTT
TACAGATGTATTGTTATTATTGTCGGTCTTGTTATTTAACTGGGCTTTCTGGTAGCGTGG
ATTTATTCCCTGCTTCCTTTAAGAAATTCCACCCTCAACTCCCTTTCCACACCTGCATTC
GAAAGTGATTATGGTATTCTGTGACCTGGTCATTGATAGTGCAGGGAGAGAAACTTAAGA
AAGTTTTTCCCGTGTTTGGAGGGTCCACCTGTCCCATCCAAACCCTGTAACTTTCTAACA
TTTGCCGGCTTCTCCCTCCAAAGCCTGTTTCCCGTCGGGTGGGGACGGCACTTCCTGTGG
GATCCAAAGTCCCGCGACTGATGAGATGGGTGATTTTTGTGGAACGGCGCTTGGGTTTTG
ACTGGATAACTGACCGGGTGAGCTGGTCTCTGATGCTCGAGCTCTGGTCCCCTGCAGGTA
TGTCACCCATCTAATGAAGCGTATTCAGAGAGGTCCCGTGCGAGGCATCTCCATCAAACT
GCAGGAGGAGGAGAGAGAGCGGAGGGATAACTACGTCCCGGAGGTGAGCTCCCTGGTCCC
ACCTTTTCTCCTTTGGGTGGGCTGGCTTGACGATTCACACAAGCTGAGTTGAGGAGCCTT
GTCGATTGGCACCTTGAAAACCTTTGGTGTTCGGTGACTGGCGCCCGTGAGGTGGGAAAC
CACAGAACCGAGATGGGCGTTGGGAGCAGTTGGAACCGCCGGTGGCCAGCGTTGATCAGA
GCTACCCATTGATTTGCCACACCAGCCAAGGCACCTCTGTTGAGTTTATTTTTGTTACCC
CATTGGGTGAATCTGAGGGGATCAATAATTAAAGTTGAGGCAGAGAGCCTGCTTGCTGGG
CCTCCTCTAGAGTGCAGACCTGAGTTATAATCCTGGCTCTGCCACTTGTCTTCTGGGAGT
CTTTGGGCAAGTCACTTGGACTCCTATGCCTCAGTTCCCTCATCTGTAAAATGGGGCAAA
CCTGAGAGCGAGGAGCAGAATCAAAAGGCTACAGTTAGCGGTTTGGACTAAGTGTGACGG
AGAGCCCGTTTTCATCTGATAACACGGGATCAGTCAGGCTTGTGGGAACTGAAACTCTTT
TCAGTGGGCAAGGAGAGTTTTTGCAGGCTCCTCCCTTACCCTGTTTGCTCCCTCTAGGTC
TCTGCCCTGGACCAGGAGATTATTGAAGTAGATCCTGATACCAAGGAGATGCTGAAGCTG
CTGGTAAGTGTGGGCTGGATTTCTCCGTCTCCTGGGAGCTGGGTGGGTTTGATGCCCTAG
TTTGGGAATTCATAGCCAGAGCTGGGCCTGACCCCGTGCTGCCACTCAAAGGGACTTGTC
TGTTGCAGACAGAAGGAGGTCACACAACTTTGTAGTTGTGTTTGTGAGGGAGCCAAGTAA
CGTGTTCGGGTTTAGATGTCGACAGCCTAGTTGCAGGGGAGCCCCGGGGTCCTTACCGTT
GGTGACGACTGGCAAGTGGGCTGTGGACTGTCGGGGTGGAGGAGGTCCTTAGCTGATTCT
GCTTGTAGCCGAGGCCTGTGTGATGCTGTGTGTCTCACCCAAAAAATTCCCTTGTTCCAG
GACTTCGGCAGTCTGTCCAACCTGCAGGTCACCCAGCCCACAGTGGGGATGAACTTCAAA
ACACCAAGAGGAGCCGTCTAAGTCTATCTGTGCTGTATTCTTTTCCAATAAACCTGGAAA
ACCCAAATTGCTGTCTTCAGGGAGTCGCCTTTGGCTTGCTACCATGTGGGCGAGTGTGGG
GGCACTAAAATACAAAACTCTGCCCTTCTGGAATTGCCATTCCAGGCGCTTTGCTATGAG
TGGGCAGGGCAGCTGAGCATCCAACAGCAGAAACCTTGGGTTGGCACTTCCTAAGAGCCC
GTTACCGTGTGCCAGTTGAACGCTGGGTGGCCTTGCTTCCCGGCCATCTATCCTGACTCT
GCCAGGATCGAGTTTGCTCTGGGGAGGGCCTCGGGGGTGCTCCCTGTGCCTGGCCAGAAG
GCATACACGGGCCTGATGTGAGATGGTAGAACAAGGCCTAAAATTGTACTCTCAAGGGCT
TAGTACAGTTCTCTGCTGACGGGGAAGCGCTCAGTGAACCCCACTGCTCCATTCTTGGGC
TGCAAAGTCCTGGTCTCATGGCAGTTTTGAGTACTGCAGGTGCACCTCGGAGCCGTATTC
CCAAATTTAGGTAGGCAAGACAGTTAAAGATTGTGAAGAGGTTCCTTGGCTTTTTTTTTT
TTATGGTATCTGTCAAGCCCTTACTACACACCAGTCATTATTCTAAGTGATTTAGATACA
AAATAATAAGGTTGGGTGCAGTCTGTGTCCCACATTGAACTCACAATCCTAATCCTCAAT
TTACAGATGAGGCACTGAGGCACAGGAGTGAAGTGACTTACCTATGGCCACAGAGCAAAT
AAATGTTGGAGCCAGCTTTAAAACCCAGATCCTTCTGACTCTCGGGCCCATGCTCTATCC
ACCGACCTGGACTGCTTTTCCATTCTGCAGTATTGAGTGCTTACTATGCAGAGCACTGTA
CTAAGTGCTTAGAGTTCCCTGCCTACAACCCTTGAGCATGCTGTTGCATTTTCTTGACTT
TGGGCGTGTAACTCTGTGCCGCCTGTTAAAGCGTCATCCAAGTCAAGCTGGTGGAAAGAT
CCCCCTCTACCTCCCTTGGTGACCTTTCAGCTCCTGACAACCATTCATTCATTCAATCGT
ATTTATTGAGCACTTAGTGTTTGCCAAGCACTGTACTAAGGTGAAGGTGGGGAGAGTAAA
TCATCTGTCAGATCTGAAGGTGAAGGGAGTTTCAGAAGCAGGATGTGGGTGAGGAGTAAG
CGGTGAGATAAGTTCAAGATAGAGTGAGATGGCATTAGAGAAACTTGAGGTACAGAATGA
CAGAAGGGACGGTTCTGAACCTTATGAGGTTCTGGGGGGTGGAGAGGATGTGACAAGTCA
AAGTGAGGGCCAAGTAGCCCTCTAAGCAGTCTGCGGGGAGCATGAGAAGGTGGGCAACAT
TCATTCAATCGTATTGAGCACCTCCTGTGTGCAGAGCACTCTATTAAGCACTTCGGAAAG
TATGTTATAACATTACACAGTGACATCTGCCCACAACAAGCTAACAGTCATGCCCCCAGG
CCTGGAGCATCCTGAATCCTGCCCTTGAAATCTCTCATCTCCCTGTTAGCGTGTAAGCCC
CTCATGGACCGAGAATGTGCCCTTTAGTTGGACTGCACTTCGCAAGACCCTAATAAAGTG
CATAGCACCCAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 1482..1633, 5757..5862, 6477..6542, 6900..7593
1115..1117, 1482..1633, 5757..5862, 6477..6542, 6900..6980
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved