Ornithorhynchus_anatinus Locus Poly:SNORA62
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus Poly:SNORA62
Ornithorhynchus_anatinus
Poly:SNORA62
Ultra117
SNORA62, SNORA62
1001..1155, 1497..1657
2657
CTGAATGCCAGTTGCGATAAGCGTCGGCCAGTCAGTGGCCAAATGCTGTTTAGAATCGA
CCCATCTAAGGGCCAAACCACACTTAGGTCCCGGGAGAGGTGCGGTCAGAAGGGTTCGTT
CCGGATTGACGGCGTATTTGAGTGCTTACTCTGTGCAGAGCGCTGCATTAAGCACTAGGG
AGAGCGCGATGCGTATTACAGCCTGGATTGATTTACTCTCTGAGGTGAATAAATGATGAT
GTCGGGATTTAAGCGCTTACTATGTGCAGAGCACTGTTCTCAGCGCCGGGGGAGATACGG
GGTCATCAGGTTGTCCCACGTGAGGCTCGCAGTGAGTCCCCATTTTATCAGATCCCAGGG
CTAGTAAGGGCTTACTTACTACTCTTCATGCCACTTGGCCAGAATCGAGTAGGGGTGGGG
TACTAAACCGATCCCGTGTTGAATCGAACGGAACCCTTTTCCAAAAATGTCGTTGAATTC
GACCCGATTTTCAAAAACCCCCGGTCGGTTTGGTATCTCCGATTATCGCTGAAGCGAAGG
TACTGGGCGGATGCTTCCGTGTGGTGAATTGAGACGTTAAGGCCCGCTTTCTATCTAGGG
GAATTTTAGTTCAGCGAGCGCTTCTCTGTACTCTGAAATTTCCTTAAGCGGATTTCTCTG
TCTATTGCAGGCGCCATATGAGATACCCGAGACCCTGGCCAACAATATATACCAGAGTAG
CAGGCAATGTGTGACATAAACCAGAAAGAAATGTAGCCTCCCAGAGCTGGGAGGGACCTG
GAACTCCCTGCCTGAAGGCAGGTGAATAACTAAACCGCCCCGGGGTGGACGGTCGGCCGT
TCTACCCTTCCAGATCGCCCGCGTAGCTCGTTTCGGCGTCCCGTCGTCCTCTCTGTCCCC
CGACCCAGCTCCCCGACGCCCGTGTTTTAACGATGGATGGGTTAGATGAGAGCGCAAGGA
GGGGCGATGGGAAGGCAGCGTCCCCTCGTCGATCGCCGCGTCCCGCACACTATTAAAGCT
CAGAGCTGAGGCCGGTTCCGGGCCTATGAACTCCTGAGTGTCGGAAGTGTGCCACAGTAA
AGCGGGCAGGATTTTCGCTAACACCAGGAGAGCTCGCCTCCGTGACTGGGGTTTGATAGT
ACTCGCTGCCACACGCTTCGGGTTTTTAGAAGGGGCCGTCGGGCCGGTGCGGGGGGGGGC
GGGTGAGGCGTCGCTGATCCTCCCGTCCCTTAGGGATCTACATCATAAATCTGAAGAGGA
CGTGGGAGAAGCTCCTCCTGGCCGCCCGGGCTATCGTCGCCATCGAAAACCCCGCCGACG
TCAGTGTCATCTCTTCTAGGAACACCGGGCAGGTACGTGCCCCGGTGGGATAAGAGCCGC
AGAGGTGCGGGGTCGGGTCGTCTCCCGCGTCGGGAGGAACCCACGCGGAGAGGTCACGGC
GGGAGACCTGCCGGTGTCGAGTTAACCGGACTAACTCCGGGGACCCGGTTGGACGGTCCC
GCACACGGTTAGAGCTTGGAGCTGAGGCCGGTCTCCGGCCGATGAACTACCGAGTGTAGG
TCGTGTGCCACAGCGAAGGACGGCGGGTTTTTTCGCTAACGCCACGAGGCCCTCGGTGGG
CCGACGAGTGGAGTTTGATAGTGACATCTGCCACAGGTTGGAAACTGGCGGGGCCTTGTG
AAAGCTGAAAACGGGGGGGGGGGGGGGAGGAAGGGAGGAGGGGTGGGGACAAGCGGCAGG
TCTCCAGAGGTCCGCGTGCGTGAGGGGCAGCGGACGTCCGGAGCCTCTCCGGACAAGAAG
CTAAGCGACTTGCCCAGGGTCACGCAGCAGACGGGGGAGCGGAGCCGGGATGGGAACCCA
AGCCTTCCTGACTCCCGGGCCCGTGCCCTCTCCGCTGGGCCGCTCCTGCACGGGGGTGTC
GTCCGCGTCGTTGGGCCCGGGGCAGTGTCAGGCGCAGACTTTTCTTCCTCCCGTCCCTTC
GACTTCTTCGTGGGTTCTTGAATTGTCTCGCCTTCGGGCCCCGTCCACTGAGAGGACGCA
CGTATGGTCTTTTCCCCTCTGCTCCGCCTCCCCCCCCCCCCCGCACCCTCGTAACCTTGT
TCGATCCCCTCCTCAGCGCGCCGTGCTGAAGTTCGCGGCGGCCACCGGGGCCACCCCCAT
CGCCGGGCGCTTCACCCCCGGCACCTTCACCAACCAGATCCAGGCGGCCTTCCGCGAGCC
GCGCCTCTTGGTGGTGACGGATCCCCGGGCCGACCACCAGCCGCTCACGGAGGCCTCCTA
CGTCAACCTCCCCACCATCGCCCTGTGCAACACGGACTCCCCCCTGCGCTACGTGGACGT
CGCCATCCCGTGCAACAACAAGGTATGTCGGCCTCCCCGCCCGCCGCCGCCCCTCCGTGA
GACTCGAACGCGTCCCGTCGGGGAGGGGGAGGGCGTTGGGGGCCAGACGACCTGGAACCG
AGTGAACGTTTAGAGCCGAGGCCGGTTTGGGGCCATCGGACGACCGCAGTTGGGGTGTGA
TAGGGCTGTGTGGGAGTCTCCTTGGCTCCTGTGAGTGAATTACAGCGGGGGTTTTGCTAC
AGAATTAAAAAAAAAAAAACCACCTCAAGGCCTAATGAAAATTGGCAATTAAGGAGCTCT
GAGGACTCCGCTGCTCGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved