Ornithorhynchus_anatinus Locus ENSOANG00000014795
snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus ENSOANG00000014795
Ornithorhynchus_anatinus
ENSOANG00000014795
Contig9797
SNORA74
6758..6963
14281
GACATGGAGAAGTTGGCTTTCAGATTGTGTTCCTAGAAGAGTAGAGAAGGGGTTGAAAT
AATAATAATAATGTTGGTATTTGTTAAGTGCTTACTATGTGCAGAGCACTGTTCTAAGCG
CCGGGGGTAATCAGGTTGTCCCACGTGAGGCTCACAGTTAATCCCCATTTTACAGATGAG
GGAACTGAGGCCCAGAGAAGTGAAGTGACTTGCCCACGGTCACACAGCTGACAAGTGGTG
GAGCCGGGATTTGAACCCCTGACCTCTGACGCCCCAGCCCGGGCTCTTTCCACTGAGCCA
CACTGCTTCTCTGTTTCTTCACTTATCTCAAAATAGTACAGAACTGGAGCAAGGAAGAAA
GGGGCAAAATTCAATCGGCCTTGTGTACCTTGCCTTGATTCTGGGCAGCTTTTGGCTGAA
GTGGAAAAGGTGGGGTCCAGATTGAGTTTAGGGATATTTACATAAGTATCGTGGGGCTGG
GGTGAGTGTCAAAGTGTTTAGCACCATAATTATTATTAAGGGGTACCCAACCAAATTCAC
GGTCAGCGCGGAGGGGTGGGGAGATAGGGCTGAGTCTGGCATGGCTCCTTGGAGATGTGA
TTTTTAGGGGGGTTTTGAAGGTGGGGAGACTGGCAGACTGTTGGATATGAAGAGTGGGGA
ATTCCGAACCCAGGGGAGAACGCAGGCAAGACGGTGGTGGTGGTGGGATAGATAAAACCC
CGGCCAGAGTGGAGAAGCTGGACTTCAAGTTCGTGTTGGGGTGGGATGGCGTTTACTTCC
CTGCAGTGATTGAACATAACGTCCAAAGATGCAGGGGAGATTTGGGATCCTGGGTCACGT
ATCTCTGGACTTTTCGTCTCGTCGTCTTTTGGGAACTGGGGGATTGCCTGTCCTCGTCTT
CCAAGAAGAACCTCTAGTTCCCACCTCTCCCTCTTCTGGATCTCCTTTCTGCCACCCACC
ATGTTGGGGTCCTGGGAACTCTTTTACTGAAAACCTTCTAGGCCACGGTAGCTTTCTCTC
CTGCTAAGCCTTATCGAGTGGCTTCTTCGAGGAAGGAAAAAGAACAATTTGGAAATTATG
CCAGTCACTGTTGTCTCACGTCATAAGTGAAATGAACATTTCCAGCAGCGGAAATGGTAG
CATCAATTTGATGGGCTGCTAGTCGATCAAGGAAGAAAAGAGTGTGGCCAACAGTCTTTT
TCCTCTCTAGTTACAGGTATGAGCCCTCTTTCTCCGTATTTAAATGTGGACCCCAGGTAT
CTTGTACAGGTAAGATTTTTGCAGAATAATTTCGTAGTTTTCTTAGACCCAGACCTTTTA
AAATAAAACCTTCCAGCCCCTAAACAGTCTAGCAATCACAAGTGCTTTAATGTCACTATT
CTTAATGCAAAGCCATGAGGTGCCTTGCTGCTTTCAAACATCATCTGAAAGATTTAAATG
TGTTTATATTTTAAGCAAGACCATTTTGGTAAACAAAGCTTGGAACAGCACGTTGGTAGT
CTTTATGGTATGGTACCATGAAAATATGGTCACTCCCATATTTTCGGGAGCTAGTTTGTA
TTTTACTCTCCCAAGTGCTTAGTAGAGTACTCTGCACATCGTTCAATAGTACATTCAATA
GTACATTCAGTAGAACTTATGGTATACTAAATATTATAATATATTATAACACAGATATGT
TATAACATATTATAACTTCTCCCAACACGGAGAAGCAGCGTGGCTCAGTGGAAAGAGCAT
GGGCTTTGGAGTCAGGGCTCATGAGTTTGAATCCCAGCTCTGCCACTTGTCGGCTGTGTG
ACTGTGGGCAAGTCACTTAACTTCTCTGTGCCTCAGTTCCCTCATCTGTAAAATGGGGAC
TAAGACTGTGAGCCCCACATGGGACAACCTGATTCCCCTGTGTCTACCCCAGCGCTTAGA
ACAGTGCTCGGCACATAGTAAGCGCTTAACAAATACCAACATCATTATTATTATATTATA
TTATTATGCATAATAATATATATTAGTTTATATAATATATTCTAGATATAGTAGTATAAT
ATACTTTATAGTATACTAATGCAGTATTGAGCACTTACTAGGTGCAGAGCACTGTACTAA
GCGCTTGGAACATACAATTTGGCAACAGAATTGTTAGTAAGCACCAAATAAATACCATTG
ATATGTAGTTTCCACTTCTGTCTTAGTATGCAATCTTAAAAATGTTACCGAGTATCCACC
CCTGAGCCTTGTTGATTAATTTGCTTATGTTCTCTGTCCTTTTGAAATATCCTTCTAGGC
AGTGTATGGAGGTCAGCTATGGCTAATGAGCTGTCCCAAGGGTTCTGTGCTCTGAAAATA
ATTAGAGACATTCACTCATTCCTTAAAACCTCTATCAGTGCAGGGCAGTTGAGCTAAAAG
AGGTCTGTTAAGTAGAAATAAAAGAACCTAGTAATCTTATTCTAGTAATAAGAATTGTGG
TATGTAAGTGCTTACTGTGTGCCAAGCACTGAGCTAAACGCTGGGGTAGATATAGGGTGA
TGAAGTTGGACGCAGTTCCTGTCCCACATGGGGCTCGCAAGTAGGAGAGAGCACGTATTT
CAGGCCCATTTTACAGATTAGGAAAGTGAGGCATAGAGAAATGCCTCAAATGCAGAGCTC
TTTCACATTATATGTATGTCACCCTAGGAGCGAATATAATACTCCTCACAAATTAGGCAC
TCAATTATCAATCAGTTGTTTTTATTGAGCGCTTTCTGTGTGCAGAGCACTACCGAGCAC
TTGGGAGAATTCAGTATAACAGAGTTGGCAGACGTGTTTCCTGCCCACAACGAGTTTACG
GTCTAGCGGGGGAGACAGGCATTAATATAAATGAATAAAGTACATATATGTACATAAGTG
CTGCGGGACTGAGGGAGGGTGAATAAAGAGCGCAAATCCAAGTGCAATAAATACTGTTAC
TGATACTAATTATAATTAGGAATGTATAAGCTTCAATGTAGAGAATTCAGAGGAGCTTCT
CAAATGGTGTGTTCTGTTGGAACTAAATTTGTATGCTTGCACTTGCACTATTTTAGGACA
CAGATGAGTTTATTTTACCCACTGGCGCTAACAAAACTCGGGGGAGATTCGAATTAGCCT
TCTTTACCATCGGAGGATGCTGCATGACAGGTGAGTGAGAATAACTGAGTTTAATTATCA
GGATTGTTTCTCAGGTATGTGTTGGTTCCAGTATTTTATTGATTATCTGGCCAAAGCTCC
AGCTCAGGAGAACTGGAGAATCAAAAGCCTACAGAGACAGACTCTCTGAATTCAAATACC
TCNNNNNNNNNNCTGTACCTGTTACCTCATCCTTAAAGGAGTAAGACTCTGAGCTCCATG
TGGGACAGGGACTCTGTCCAACCTGAGGAACTCGTATCTACTCCAGTGCTTAGTACAAGG
CCTGCCACATATAAGCACTTAAGAAATACCATTTTAAAAACAAGAATGAAATGCAGCTCA
TCAATCAAGGTTATGCTGTATGTACAAAGGAAATTTTGTACAGAGGAAGAGAAGGGAGTG
GAGGGTATGGTTCAGAGGTTGTGCCCTCATGGTGAGGCTAGATTTTGGAGAGTCTGTCTC
TTGCAGACTTTTAAAGGCCGTTTTTCTGACTTCCTTCCTGCCACTGGGGTGAACATTTCT
CTGACGCTCCTGGTAAAGAGATAAGTGGTAGGGCTTACCACTAGCTGGACGTACCCTTGG
GTTATATTTGCAGTGGTGTTCATGGTTTGCCCTGAGCCATTCACATTCTCATGCTGGTGC
CCCATGTGCCCAGTGGCACGTGTTGTGAGATGGCTGGCAGGGGGAACAGGCGCAATATCT
CTGATACCTCAACGGGAGCAGGCACCTCTGGATTCTCAGCTACTTGGCTTAGTAATGGAG
GAGGGTCTAGAAAATGGTATAACTATGAAATAATCTTGGATTTTCGACTCTGAGGCGTCT
ATAATCAACCACTGGATTATAAAATGTACTTTTTCCGAAGAAGATGTCCCTCCCCGCCCC
CAGAATCTGGGTCCTGCGGTACCAATCAACTCTCTCACTGCCTGGGAGAGCATGAAGAGG
AATTAGAAAAAAGAGGAAAGAGCATTAACGGGGCAGGAGGTGGAACATGGAAACAGGCAG
GCAAAATTATCTCTGGGTGTTCAGACTGCAAAATAAAGGATGCACCAAGACACTCCCCAG
CCCCGAAAGGAAAATTTAGAGAAGCATATTTTTCTGACATTTGCCCTTTCAGAACATGGA
CAGAATTTTCAGTCCATGTTTCTACAAATTAGAATAGGGAAATAAGTGGATTCTTAGCAA
TGACTCTTAAATTTAGTAGGGCTCAGGTTTTCATCTTTGTTTCCCCCTGGGTATAGAATC
AGGAAAGAGAATATTGGAAGTGTAGAGACCGGCATTACAGTGAAAGTCTGGGTTCTTTGT
TCAGTAAAGATGGGAATTCTGGTTTTCCAGGGGCTGGATTTGGGGCAGTGAACGGCCTAC
GGTTGGGATTGAAGGAGACGCAGAGCATGACCTGGTCCAAACCAAGAAATGTACAGTAAG
TAAAAAGTCCCAATACTCACATCATGTAGTGGTGCAATGTAAGGATTCCTCCGTTGCTCG
TTTCCTGAATGAAGACCATAAGGGTTTCGTGTACATGATTTAAACGGCAAGATTTTTAGG
TGGTTTACAGAGAGTTATTTATTAGGCCCCGAAGGGAGCTCTGGGGAAAAATACCCAGGT
GAAAGGCTTGGTTCCTGGCCTCCGGGGGCTCACAACCTAGAGAGCACTGTGTGCTGTTTT
TTGTCTTTGCTGTAGAAGGCCACGCCAACTCATAAGGACAGAATTTATCTAAAACTCTAG
TGACAATTTAGAAAGAAAGCTAATTTTAGTGGGTGTTGGGGGGTGTGGGGGCTTTGTTGT
TTCTGTTTTTAGCAAACCATCTTGTTGCTCAGAGTCAGTTCATCCAGTAGGTGGCGATAA
CTGTGCCTCTTATGCAAGTCACCGGGTTAAAGGCGTGGAAAGGGCTACTGAAGGTCACTC
CCTTGAAATTCCCCTCCACTTCTTAATAATAATAATAATGATGGCATTTGTTAAGCGCTT
ACTATGTGCCAGGCACTCTTCTAAGCGCTGGGGGAAATACAAGGTAATCAGCTTGTCCCA
CGTGGGGCTCAGTCTTAATCCCCATTTTACAGATGAGGGAACTGAGGCCCAGAGAAGTGA
AGTGACTTGCACAAAGTCATTGGGCAGTTATTGCCATTGTTCTTGTCTGTCTGTCTCCCC
CGATTAGACTGTAAGCCCGTCAAAGGGCAGGGACTGTCTCTGTTACCGATCTGTACATTC
CAAGCGCTTAGTACAATGCTCTGCACATAGTAAGCGCTCAATAAATACTATTGAATGAAT
GAAAAGGGGCGGAGCTGGGATTTGAACCCATGACCTCTGACTCCCAAGCCCGGGCTCTTG
CCACTTTCTTTCTTTTCCTGTGGATAACAACCACAAAGTGACCTCGGTCCATTATCCTTG
ACAAGCCGAGCCCTTGCCTCTCGTTTTACCCTCCTCCCTGTTCGGTTCAAGATGTCCACC
ACAAAAAAAGTTTCACCGCAATTCAGATAGGTATTTTAAAATGAATTTGACCCTGATTAG
GCTTATTTCATCTCGGCCATTTTTCCCCCCGTCTCGTTTTCAATCCTAAAATAGCAGAAA
TCCAGAATTGATCCCGGGGGCTACCTGTGTTTAGTATTGAAGTGCTTTCTTGGTGGAATC
ACCACTGAGGATGGTTTTTAAAACAGAACCCAAAGGGTCATTCATTTCATTTAATTCAAT
AGTATTTATTGAGCGCTTACTATGTGCAGAGCACTGTACTAAGTGCTTGGAACGTACAGT
TCGGCAACAGATAGAGACAATCCCTGCTCAGTGACGGGCTCACAGTCTAAACGGGGGAGA
CACAGCAAAGCAAAACAGAACAAAACAAAACAAGACAACATCCTGAAGCAGCATGGCTCA
GTGGAAAAGAGCCCAGGCTTGGGAGTCAGAAATCATGGGTTTTGAATGCTGGCTCTGCCA
CTTGTCAGCTGTGTGACTGTGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCACTTGTCAGCTGTCTGACTGTGCGCAAGTCAATTT
AAATTCTCTGTGCTTCAGTTCCCTCATCTGTAAAATGGGGATAAAGGTTGTGAGCCTCAC
GGGAGACAACCTGATTACCCTGTATCTACCCCAGTGCTTAGAACAGTGCTCTGCACATAG
TAAGCGCTTAACAAATACCAAAATTATTATTATAAATAGAATCAAGGAGATATACACCTC
ATTAACAAAATAGGGTAATAAATATGTACAAATGAGCACAGAGTTGAGGGGAAGGGGGAA
GAGCAGAGGGTGGGAGGGAGGGGAGGGTCCAACCAGGAAATGTGACTAATAATGTAAATA
AATAACACGACACATTTGCAGTGTGCTTTAATTTTTGAAAAGGGTGTCAGACCGTCAGGG
TTAGTACAGAAAACATCCTCAACCATCAAGTTTCTCATCTCTGGCAAAAGTACGTTGTAA
GGTTGGGAAGTAAATAAATGGAAATAAATTAACTTGGAGGAAGTGATCAAAAACAAGTTC
CAGAGAGAGCCCATAATGGTCGCATCGTGACGACAAACTCCAGCGGTAGTCAGCTGTCCA
GGGTGTTTCCGTGCCTGAGACAGTGTTACACTGCTGGGAGATTAATGTTCTGTCATTTCA
ATCTGGTCGCCACTGTCACCGTTCTGGTAACTGCTGGTACCAGTGCAGGGCAGAACTCTG
CCTTTTGAGAGTGCGCTAAACATGTACTTCCCTGCTGTTTGGTGCTAGTCTGGGGGCAGA
CATAAAATGTACTCATAGTTCCTTCACTGTTTTCATTATTAACTGTACTTTTCATTATTC
TATGCCTGGCAGCAGTTGGACCCAAATTAAGTGTCTTCTCTGTAAGGTAGCAGGGTCTAG
TGGGAAGAGCACAGATCCATGAGTCAGGAGTTCTTGTCCCTGCTTTGCTACTGCCCTGCT
CTGCGACCTTAACCTCTCTGACTCTCAATTTTCCTCAACCGTAAAAAGGGGATAATTAAA
CCCGTGTACCGTACTTCACAAGGGTTCAGAGGGGGTAATGTGAAATTCATTAGCCCTTTG
GTAATTGTCAGAGAGGGATTAGAGAACACACCCCCACCCCACCCCCAGCAAATAAAGGTC
AATACCGTCTGTACCCAAGGGCAGGGCTATACTTTATGCAGCATGGGAAGCACTGTGGCC
TAGTGGATAGAGCATGGGCCTGGGAGTCAGAAGGTCCTGGGTTCTAATTCTGGCTCTGCC
ACTTGTCTTTAGAGAAGACTGTGGCTCTTTCAGAGTTTAGGATTTGGCATCTGCCAAACA
AATGGCACTGAAAAAAGGAAATAAGATAATTCTTTGAATTTGTAACACTGGGTTTCATTT
TTCCAGCATGTTTTTGCTTCAGTTATAGTAGTCCCATGGCATCGGTGGATGTTTTGTCTG
TGGCTCCACCTATCTGTCATCAACTGGGCCCTACCCCTGGCCACCTGCTATCTATTTGGT
TACCAGCAGCCAGAGTGCTGCCTCCTCAGGGCCTGGCTGGCTTTCTCTTACTCCCTCCCC
CACCCCATCCCAATGGGAAGTCTGCATCGTTAAGAGTCATTAAATAATGATGGTATTTGT
TAAGTGCCTGCTTTGTTCTAAGCCCTGGGTAGATAGAAGCAAATCGGGCTGGACACAGTC
CTGACCCATGTGGGGCTCACAGTCTCAATCCCCATTTTACAAAAGAGGGAATGGAGGCCC
AGAGAAGTGAAGTGACTTGCCCAAGGTCACACAGCAGGCAAGCGGCGGAGCCGGGATTAG
AATTTAGTTCCTTATGATTCCCAGGCCCATCCTCTAACCAATAGGCCACACGGCTTCTCT
AGTTCAGGGTGAACGTGTAGGTGATTTGCTGTTTTATAATGTTCAAAGTCAAGCCCAGGA
GAGAGAAACCCTGGGGGACCCAGCCATTTGCAGTGTGGTGTGAAGCAGAGGGACTCTTAC
CGTCAGAGGGTTCAGGAACGGCACACCGCTTGTCCCCAAAGCTCCCAGTTCTTTCTCTGT
GCTTCAAGCACCACTTTTAAAAAGGGCTGTGAAATACAGCACGGTGTCAGCCACAAATTC
TTGTCCTGGTGTGTTCCGGACAAGGGGCCTGATCTTGCCCGTAAAGGAGCAGGGGAGGAT
CCGTTACAGGTGGCACATTTCAGTGTGGGTGTGGTTGGCAAGGGCACAAGGAAATCCTGC
CGCTTTGCTAGTTTCCAGGTCCCTTTGTAGACGGCATACGGTTTCAGGGGAAGTCTGGGA
CGTGGTGGGGAGGGCTATACCTGCTTTTAAAGCACTCGATCAGCTCACACTATCCTACCT
GACCTCACTTGTCACCTACTTCAGCCCAGCCCACACACTATGCAGCTTACTCACTGTGCC
CCAATCTTGTCTATCTCGCCACCAACCCCATCCCCACATCCTCCCCCTAACCTGGAATCT
CTCCCCTTCTGTATAAACCAGGCCACCTTTCTCTCCCCCTTCAAAGCACAGTTAAGATCA
CATTATCTCCACGAGGCCTTCCCTGATGAAGACGTACTTTTCCTCAGTTCACTCTCCCTT
CTGCATCGTCTATGCACTTGGATCGGTGACTTTAGGACATTTGATTTTGCTCCAACCCCA
GAGTACTTATGCACATATCTTTAAATTGTTTATTCACATTAATGCTTGTCTCCCCCTCTA
GACTGAAAGCTCATTATGGGCAGGGAACGTATCTACCCACTCAGAGGAGATTGTACTCTC
CCAAGCACTTAGAACGATGCTCTGCACATAGTAAACACTCAGTAAATTCCATTGATTCAT
TCAATCCTATTTATTGAACGCTTATTGTGTGCAGAGCACTGTACTAAGCACTTGGAAAGT
ACAGTTCGGGAACAGATAGAGACAATCTCTACATAACAACAGGCTCACAGTCTAGAAGGT
TGATTGTATAAATCCCTGTTTCTTTCTTGCTTTTTCTACCTCCCATCTTTGGCTTGAAGC
TGGGGCGTCAGACAGTGACAGGGAATGAAGCGGTTCTTGAATGTCGGAGGACAGGCAGAC
CAACTTTCGAGGGTTGTGAGCCGCCTGCACTCTTTGGGCCTCTAGTTCGGTCACACTGGT
GTAAAAGAAAATACTAAGGACCTTGTGCCCAGGAGGATGCCACTCTGGATGACACGTTTC
TCTCTTTCTGTCACTAGGATTTTGAATATGGTCACCAGGCAAGGGGCGTTATGGGCTAAC
ACTCTCGGGTCTCTAGGTAAGTGGAGCTGTGGTCTGTCAGCTATGAAGAGTAAGCGAATG
TCATATCTCTTGAGGCTCCGTAACATCTGGGATTTCTGCCCAAAGATATAATTGTGGATT
TTCAAAAGTTTGTTGTAGAGCTTGTTCTGTTCATTACAGCCCCTCTCCTTCCTGCCACTG
AAGTGCAACAGCTGTGAATAAAAATGCATTAAGGACAATGAAAAAAATTGTTTTGAGTGC
CAGTTTGAATTCCAGTTTATTGGCTAAATTCTATTCCTTGTAGTCCCTTTATTCACAGTT
GGTGCATTTTGTCTTTTTGGAGCAAAAAAATAGTGCATTCAAAGCAAAAGGTTGTGTGGC
TAAGAATTAGAGGATTCAGAGTTCTGGCATGGAACAGTGGAGTGGCATATTAAACAAGCC
CCCCTGCCAGGTGTCTCCGGGGAGAACGATCTGTTGCTGTTTACCTGGCTCGATTCCACT
AAATCCAAGGCTAAATTCCCTATAAAGTACATCCTGTGTAATCAGTCCAAGAACATGTAG
CTCAGTGTTGGGTAGGGAGTGATGGTTCATTTGTCTTGTGGAAAAGTTAATAAACTTCTG
CACCCTTGGGCACCCTTAATCTGGCTTGGAAAATTCCCAAGGGTCCACTTCCCTGGAAAA
CTGCACCACACACAAACCATCAAAGATTTTGCTGCCAATTTTTCTCCCTTCCCTTTCCAG
CCTCCAAGAGAGATCTGGGATATTGAAGCCCAGTCCGTCCTGGAGCCAGGAACAGGCATA
AACCAGCTGTTCTTTCTCCCTGCCCCTTTAAAAAATATATACATGTTTACCCATATATAC
ATATATATATATATATATATATATATTTGTTATCACTTACTGTGTGCCAGGCACTGTACT
AAGCACTAGGGTAGATACCAGTTAGGCTGGATACAGTCCATGACCCAAATGGGGCATGCA
GCCTAAATTCCCATTTTACGGTTGAGGGAATTGAGTTCCGGAGAAGTTGAGTGAATTGCC
CAAGGTCACGCAGCAGTCAAGTGGTGGAGCCGGGAATAGAACCCAGGTCCTTCCGACTCC
CAGACCTGTGCTCTATTCACTCCACCACGTTGCTTTCTTGTAGATCTGGGCGGGTCTCGA
CAGTGGGGTCCAGCTCTGGCCAGGTACCTGCGGGACTCTGTTTCATTTTTTCCTCCCGGG
GCCCTCTACGCTGGCAATCTTGCACTTAACTTTAGAACCCACGTTCTTCTGAGTTCCTGG
TCTATGCTCTATCCACTGGGCCATGCTGCTTCTCATCCTTCCCAATTCATTTGTGGGATG
CTAACTGCCCAATTGACACCCCCTTTCTGGGCCTGACCTTGCTTCTTCCCCTCCCACCAA
CTACCAGAGCAACCTTTCTGACCCAGAATTGCCCAGATAAGGCAGGGATCAGGGATGATT
GGTGGAAATGGTTGAAATATTTTGTCCCTTTTGTGGGCATATTAGCAAAAGTGTTGGCAA
CCTGGGCGTGAAGGTCAGACTCATCTTGTCTGCAGGTGCAAACACTTTAACATTAGATCA
GTTGCTTAACATTACATTTGTTATGCGAAAACTTAAACGCAGCATGGCCTAGTAGAGCAT
GGATCAGGGAGTCCTGGCTCTGCCACTTGCCTGCTGTGTGACCTTGGGAAAAGTCACTTA
ACTGCTCTGTGCCTCAGTTTCCTCATCTGTAAAATGGAAATGCCACCAGATCTCCCTCGC
TCCTAAACCATGAGCGCTGGGTAGGACTGATCTGATTGTATTATATCTTCATCAATGCTT
AGCAGAGCACTTGGCACACGTTATTAAAATTTAAAACGCAGGCTTCTTTTTTGCATTAGT
GAGTATTAGTATTAGCCTGGATGGATGTGTAAAAGAGAGGTCTTCTGCTCGTTATCGGTG
ATGTAATGAGGTAAGAAATGCAAAGTTTCTGGGACTCCTTTAACAGAAGGATTTGGAAAA
GATGGACAGCTTTCACTCCAGGTGAAGTAATTCGGTGGGGCGAGTGAAAGCATTCAATTT
CATCTGAAGTGGTTGGGAAAATGAAATAGTGCTGCCCTTTTTGTCGATTTGAATCCTTTG
GAAGTATTGGAAGGGCTCTGCTTTATGCAGTTGTGTAGTTTTGGGGTACAGTTGGGTCCT
TTTGTATTTATTTTACTGGCCATTTCAGTTAAAAGTTTAAGTCCATAAGCATTGCTCTCC
TAGATCAGACTTTCCCCCCACCCACACTATTCATCCAGTCCAGAGTTTTGTCTACAAGAG
TGGTTAGAGGACACTTAGGGGATCCTTGTGATGTTGCTGGAAGCTCCTTGTGGGTAGGGA
TCACGTCTGCCAAGTGATCGTACTCTCCCAAGCACTTTTCGGGACGGTGCTCTGCACCAG
GTCAGCTCTCAGTGACCACCACTGATCGATAGATTGATCGTACTGGATATCTATCCTCAC
AGCTCGGCGTGGACCGACTGGCGACTCTGACTTTCCCCTTTGTACCTTCCAGCTCTGCTG
TACAGTGCATTTGGCGTGATTATAGAGAAAACACGAGGCGCAGAAGATGACATCAACACG
ATAGCAGCTGGGACCATGACTGGAATGCTGTACAAATGCACAGGTGGGTTTGTGTTAAAA
CTTGTTTTTCCTTTCTGTGATCTCTATCTCCGAAGGCAGATTTACCTGCTAGTGAAGCAA
ACTGTTAGACTTCCTTCATCGAGTCTGCGATTTTACAGGTAAAAAGATACGTGGTGGTCG
TTCCTCCTGTACTTTGATCTGTTTGACTTGGAAAACAAACACGTCCTCTTTCTGATCTAG
GTGGAAAGTTCAAAATGACTAATTTTTAAACGGGGTCCTAAACTGTCGGGCCAGTAATTA
AAAACTTAAAGGTATGAGGGTTGCCGGAAATATTGCCGTTCAAAGAACAGAAGGAGGGTC
AAGTTCTTATGGTGTTTGGCAAAGCTGCTGTCAGGCTTGTCAGAATTTTACATTGCCCAA
ATCCCCTTTAACAATTAAAAAACTAGCACCGAGTGTCTTGACCCCGAGTTCCAGTGATAG
TTGTTTGAGGTGTGTGATAGTATAGCACTCGTGGGAGGTGAACAGAATGTCTTTTGTTCT
GCCTGGCACCGTCGCCGCTCTGGGGACGGCTAGTATAGGCACAGGTCCGCCTCGCCAAAT
AGGCATGATAAGCGTCCCCCGGCATCGACCCTCGACTGACTGCTCACCTGTTTTCTCCGA
AAGAGTCAAGATCCGAACATTCGTGTGCTTATGCAGATGCTCAGTGAGTTGTGAGGTTGT
GTTGCATTTAACTGCTGTCATAAGGAAATGTTGAAATGTGACATTCAAATAAAAAATAAG
ATAAGGTAGCTTTCTTGCTGGGTGTTCCTTTACAAAGATAGTGGAGCTTTATGTGTATCA
AAGTCCAGAAACCAGAATTGCTGCAATGGCGATCATCCATGTACACATTGGCTGTGTATT
ATTATTGTTGTAGAAGAGGTGGGGCCCTGGGAAGAGGTTGGGAAAGAGAGCCTGGAACAA
CTGGACCTTGCTCAGGCGGCCCTATTCCCTGGCCTGACTCTTGCAAGGAATGTGCCAGTC
GTGGATGGGTGGGTGAGAAGCAGTGTGGTCTAGTGGATAGAGCACGGCCCAAAAGTCAGA
AGAACCTGGGTTCTGATCCTGGCTCTCCCGCTTGTCAGATGTTGGACCTTGGACAAGTCA
CTTGACTTGTCTGTGCCTCAGTTCCCTCATCTGTCAGATGAGGATTAAGACTGAGCCCCA
TGGGGGACATGGACCTGATGACCTTGTGCCTAGCACGTAGTAAGCACTTAAATAAATACC
ATAGTGAAAAAGAAAAGCCAAGTACCAGTCGTCAATGGGTGTCTGTGTGGACATTTCAGG
GCTGGTTCATTCTCCATCTTATCCCAGTCCCAAGCCACCCTAAATGGTGTGTGAGGAAGG
AGGGAGAGTAAAAGTCATCTGCCTAATAAAAACCACTACCTACTGCTCAGTGGTTGCCTT
GGAGTTAAGATAGATCTAAGTTCCTTGATTCTTGTTTTTGCAGTGGGTTAGCTTTATAAT
TGCCGAGAGTACTTTTGTGCTTTTTTTTCCTCAAATAAAGGCTGAGCTCAGTAGTTCTTA
GTTATACGCTTTTGAGGTTCTAGTTTGCAGAACTGCATTTTTCCCTGCGGTATATTTAGG
AATAGGCTATAAGTGATCAGAGAAGTGGGTTTTGGCAGAGGGGTTTTTTCTCTTCTTCCA
AAACAACTGCAAGGTTGTCATTTTCACCGACTTCATTTCTAATAATAAGGAATGAGCAGG
ACTTTTTAGTGTATTTTCCTCAGCTACGTAATCCGGTATTTGTGTGGCTTATAGAATCAA
ATCAGAAAAGGCACAGGAAATGTTGATTTTGAATCTTAAGGCTTAATAATTATTGATTAT
AATTAATGCTCTTGTAATGTTTATTTTCTGAAACCATGCATATAAATCATGGAGTGAAGC
ATTGGCACTAGCAGGCTTTTACGTAAAAGGGGATCTGGTGAGAAGAATTTCTAGAAAAGA
ATGCAGTTTTCGGTTTGTGTTTTAACCTAAAGAGCAGTTTGCTTTTCCGCAACACAGATG
AGGGATGGGCTCTAATGGAGTCTGCACTTCATGAGGTTTTGAGCCTCCCACTCGCTGTCT
GGTGTGGGGCTTTAGGGAGTGGCTAGACCCTCTTCATTTGGACTGTAACAGGGGGTTCTG
GCCACAAGAGAAAGAGCACGGCTGATGTAAAGGGCTCCTGTTTTGCCCAGGAGCAGCCAA
GCTTCTCTGACTTTCCCATGAAGCATTTGAGGGGAGTAAGAACTAGTGCCCTACTCAGAT
AG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1268, 3056..3149, 4470..4554, 9377..9435, 11932..12042, 12578..13281
1209..1268, 3056..3149, 4470..4554, 9377..9435, 11932..12041
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved